ID: 1188221495

View in Genome Browser
Species Human (GRCh38)
Location X:27546558-27546580
Sequence ATGTCCTGGTAGAAGTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188221495_1188221501 16 Left 1188221495 X:27546558-27546580 CCAGCAGACTTCTACCAGGACAT No data
Right 1188221501 X:27546597-27546619 ATACTGTAAAATCTAAGGATAGG No data
1188221495_1188221500 11 Left 1188221495 X:27546558-27546580 CCAGCAGACTTCTACCAGGACAT No data
Right 1188221500 X:27546592-27546614 CATACATACTGTAAAATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188221495 Original CRISPR ATGTCCTGGTAGAAGTCTGC TGG (reversed) Intergenic
No off target data available for this crispr