ID: 1188221500

View in Genome Browser
Species Human (GRCh38)
Location X:27546592-27546614
Sequence CATACATACTGTAAAATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188221492_1188221500 20 Left 1188221492 X:27546549-27546571 CCTGCTCCTCCAGCAGACTTCTA No data
Right 1188221500 X:27546592-27546614 CATACATACTGTAAAATCTAAGG No data
1188221497_1188221500 -3 Left 1188221497 X:27546572-27546594 CCAGGACATCCAGGCATTTCCAT 0: 607
1: 1295
2: 1664
3: 1426
4: 1083
Right 1188221500 X:27546592-27546614 CATACATACTGTAAAATCTAAGG No data
1188221495_1188221500 11 Left 1188221495 X:27546558-27546580 CCAGCAGACTTCTACCAGGACAT No data
Right 1188221500 X:27546592-27546614 CATACATACTGTAAAATCTAAGG No data
1188221494_1188221500 14 Left 1188221494 X:27546555-27546577 CCTCCAGCAGACTTCTACCAGGA No data
Right 1188221500 X:27546592-27546614 CATACATACTGTAAAATCTAAGG No data
1188221491_1188221500 30 Left 1188221491 X:27546539-27546561 CCATAAGGGGCCTGCTCCTCCAG No data
Right 1188221500 X:27546592-27546614 CATACATACTGTAAAATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188221500 Original CRISPR CATACATACTGTAAAATCTA AGG Intergenic
No off target data available for this crispr