ID: 1188230043

View in Genome Browser
Species Human (GRCh38)
Location X:27650894-27650916
Sequence TCATACTGCATGGGAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 815
Summary {0: 1, 1: 29, 2: 120, 3: 232, 4: 433}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188230043_1188230049 21 Left 1188230043 X:27650894-27650916 CCAGTTTTTCCCATGCAGTATGA 0: 1
1: 29
2: 120
3: 232
4: 433
Right 1188230049 X:27650938-27650960 AAATGACTCATATTATTTTGAGG 0: 1
1: 12
2: 231
3: 1189
4: 1981
1188230043_1188230048 -10 Left 1188230043 X:27650894-27650916 CCAGTTTTTCCCATGCAGTATGA 0: 1
1: 29
2: 120
3: 232
4: 433
Right 1188230048 X:27650907-27650929 TGCAGTATGATGTTGGCTGTGGG 0: 11
1: 774
2: 11745
3: 7003
4: 4657

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188230043 Original CRISPR TCATACTGCATGGGAAAAAC TGG (reversed) Intronic
901891361 1:12268723-12268745 TCATACAGCATCTCAAAAACGGG - Exonic
901959655 1:12815103-12815125 TCATACTGAATGGACAAAAATGG - Intergenic
902144021 1:14381717-14381739 TCATGCTGAATGGGAAAAAACGG + Intergenic
904895023 1:33810792-33810814 TCATACTGAATGGGGAAATTGGG + Exonic
905355121 1:37377124-37377146 TCATACTGAATGGGAAAAACTGG - Intergenic
906441621 1:45851563-45851585 TCATGCTGAATGAGAAAAACTGG - Intronic
906586104 1:46980019-46980041 TCATACTGAATGGGCAAAACTGG + Intergenic
907286479 1:53383719-53383741 TGATCCTTCATGGGAAAAGCTGG - Intergenic
908427098 1:64017826-64017848 TCATTCTAAATGGTAAAAACAGG - Intronic
908712695 1:67034779-67034801 TCATACTGAATAGGGAAAAATGG - Intronic
908879322 1:68712693-68712715 TCATACTGAATGGGCAAAGCTGG + Intergenic
908884782 1:68776330-68776352 TCACAGTGCATGGGTAAAAGAGG - Intergenic
908892423 1:68862248-68862270 TCATGCTCCATGGCATAAACAGG - Intergenic
908939753 1:69417405-69417427 TCATACTGAATGGGCAGAGCTGG - Intergenic
909104203 1:71388912-71388934 TCATACTGAATGAGGAAAAATGG + Intergenic
909202507 1:72709281-72709303 TGATACAGCATGGGAAAGAATGG - Intergenic
909769932 1:79408959-79408981 TCATTCTTCAAGGGAAAAATTGG - Intergenic
909770726 1:79418177-79418199 TCATACTGAATGGGCAAAAACGG + Intergenic
909805555 1:79870419-79870441 TTATACTGAATGGGCAAAACTGG + Intergenic
909891581 1:81014220-81014242 TCATACTGAATGGGAAAAGCTGG + Intergenic
910082545 1:83358302-83358324 TCATACTGAATGGAAAAGGCTGG - Intergenic
910336114 1:86133450-86133472 ATCTACTGAATGGGAAAAACTGG - Intronic
910531499 1:88241462-88241484 TCATACTGAATGGCAAAAACTGG + Intergenic
910819535 1:91331019-91331041 TCATACTGAATGGGGATAAACGG + Intronic
910829483 1:91445892-91445914 TCATACTGAATGGCAAAAACTGG + Intergenic
911243141 1:95487114-95487136 TCATATTGAATGGGCAAACCTGG + Intergenic
911354087 1:96794947-96794969 TCATACTCCCTGGGTAACACTGG - Intronic
911479088 1:98413809-98413831 TCATACTGAATGGGCAAAAACGG - Intergenic
911963238 1:104334104-104334126 TCAAACTGAATGGGAAAAACTGG - Intergenic
911984914 1:104610386-104610408 TCATATTGATTGGGAAAACCTGG + Intergenic
913020681 1:114786424-114786446 TCGTACTGAATGGGCAAAGCTGG - Intergenic
915004657 1:152624514-152624536 TCACACTTAATGGGAAAAAAGGG + Intergenic
915114339 1:153586679-153586701 TCATACTGGATTAGAAAAAGAGG + Intergenic
915669801 1:157478929-157478951 TGATTCTGCAGGGGAAAACCTGG + Intergenic
915759792 1:158299113-158299135 TCATACTGAATGGGCAAAACTGG - Intergenic
915768014 1:158386644-158386666 TCATACTGAATGGGAAAAACTGG + Intergenic
915771421 1:158429106-158429128 TCATACTGAATAGGCAAAACTGG - Intergenic
915925031 1:160010788-160010810 TCATGCTGAATTGGAAACACTGG - Intergenic
915990966 1:160515896-160515918 TTATACTGAATGGGCAAAACTGG + Intronic
916892983 1:169131349-169131371 TAATACTGCAGAGGAAAACCAGG - Exonic
916915745 1:169404702-169404724 TCATAGTGAATGGGCAAAACTGG + Intronic
917024679 1:170629357-170629379 TCATAATGAATGGGCAAAAGTGG - Intergenic
917295314 1:173512750-173512772 TCATACTGAATGGCAAAAGCTGG - Intronic
917585371 1:176421279-176421301 TCATACTGCATAGGTAAAACTGG - Intergenic
918661969 1:187099767-187099789 TCATACTGAATGGGAAAAGCTGG - Intergenic
918956405 1:191214110-191214132 TCATACTGAATGGGCAAAACTGG - Intergenic
918986035 1:191627688-191627710 TAATACTGCAAGGGCAAAAAGGG + Intergenic
919014605 1:192016512-192016534 ACAAACTCCATGAGAAAAACGGG - Intergenic
919304882 1:195819511-195819533 TCATACTGAATGGGCAAAGCTGG - Intergenic
919403866 1:197151774-197151796 TCAAACTACACAGGAAAAACTGG + Intergenic
920294030 1:204944955-204944977 TCATGCCGCATGGGAGAACCAGG + Intronic
920776164 1:208939326-208939348 ACATATTTCATGGAAAAAACAGG - Intergenic
920939818 1:210471242-210471264 TAATACTTAATGAGAAAAACAGG - Intronic
921307904 1:213815282-213815304 TCACACTGCATCGAAGAAACTGG - Intergenic
921439171 1:215163518-215163540 TCACACTGAATGGGCAAAAGCGG - Intronic
921457087 1:215384767-215384789 TCATACTGAATGGGGAAAACTGG + Intergenic
921496730 1:215852077-215852099 ACATACTGAATGGGGAAAAGTGG + Intronic
1063294919 10:4795673-4795695 TCATACTGAATGGGAAAAGCTGG - Intronic
1063802325 10:9594426-9594448 TCATAATGGATGGGAATAACTGG + Intergenic
1063807067 10:9657736-9657758 CCATACTGCATTGGACAAAGGGG + Intergenic
1064484645 10:15773254-15773276 TCATACTGAATGGGCAAAAACGG + Intergenic
1065080182 10:22121526-22121548 TCATACTGAATGGGCAAAACTGG - Intergenic
1066411048 10:35169692-35169714 TCATACTGAATGGGCAAAAATGG - Intronic
1066709705 10:38220295-38220317 TCATACTGAATGGCAAAAAGTGG + Intergenic
1066757480 10:38725312-38725334 TCATACTGAATGGGCAAAACTGG + Intergenic
1066817394 10:39436749-39436771 TCATACTGAATGGGCAAAAACGG - Intergenic
1066819565 10:39468361-39468383 TCATACTGAATGGGCAAAAACGG - Intergenic
1066819761 10:39470724-39470746 TCACACTGAATGGTCAAAACTGG + Intergenic
1066822492 10:39512037-39512059 TCATACTGAATGGGCAAAAACGG + Intergenic
1068125270 10:52832226-52832248 TCATACTGAAAGGGGAAAAATGG + Intergenic
1068252887 10:54467255-54467277 TAATACTGAAAGGGAAAAAGTGG - Intronic
1068260963 10:54580993-54581015 TCATACTGAATGGGCAAAAGCGG + Intronic
1068567959 10:58596453-58596475 TCATAGTAAATGGGCAAAACTGG + Intronic
1069129173 10:64677643-64677665 TAATACTGAATGGGGAAAAGTGG - Intergenic
1069337018 10:67364364-67364386 TCATACTGAATGGCAAAAACTGG + Intronic
1070870917 10:79752012-79752034 TCATACTGAATGGGAAAAGCTGG + Intergenic
1071367847 10:84918426-84918448 TCATACTAAATGGGCAAAACTGG + Intergenic
1071637845 10:87274223-87274245 TCATACTGAATGGGAAAAGCTGG + Intergenic
1071657399 10:87463727-87463749 TCATACTGAATGGGAAAAGCTGG - Intergenic
1072018203 10:91371119-91371141 TCATACCGAATGGGAAAAACTGG + Intergenic
1072091596 10:92134059-92134081 TCATACTGAATGGGAAAAACTGG + Intronic
1072375301 10:94809665-94809687 TTATACTGAATGGGCAAAAATGG - Intronic
1072401524 10:95107366-95107388 TCATACTGAATGGGCATAACTGG - Intergenic
1072883546 10:99252209-99252231 TCATACTGAATGGGCAAAACTGG + Intergenic
1073913398 10:108373418-108373440 TCATACTGAAGGGCAAAAACTGG - Intergenic
1073966474 10:108996254-108996276 TCATACTGAAGGGGAAAAACTGG + Intergenic
1073979231 10:109135447-109135469 TCATATTGAATGGGCAAAAACGG + Intergenic
1074017639 10:109550332-109550354 TCATACTGAATGGGCAAAAATGG + Intergenic
1074190740 10:111133751-111133773 TGATACTGAATGGGCAAAAGTGG - Intergenic
1076340051 10:129739195-129739217 TCATACTGAATGGGCAAAACTGG + Intronic
1078036277 11:7808318-7808340 TCATACTGAATGGGGAAAAATGG + Intergenic
1078036530 11:7811246-7811268 TCATACTGAATGGCAAAAACTGG - Intergenic
1078560758 11:12369981-12370003 TCATACTCGATGGCAAAAACTGG + Intergenic
1078700387 11:13675071-13675093 TCACACTGCATGGTAACAACTGG - Intronic
1079957873 11:26886540-26886562 TCATACTGAGTGGACAAAACTGG + Intergenic
1080086927 11:28294154-28294176 TCATACTGAATGGGCAAACCTGG - Intronic
1080118305 11:28645311-28645333 TCATACTGAATGGGCAAAACTGG + Intergenic
1080348753 11:31357479-31357501 TCATACTGAATGGGCAAAAATGG + Intronic
1080714176 11:34782469-34782491 TCATACTACATGGACAAAGCTGG - Intergenic
1080949952 11:37019961-37019983 TCATACTGAATGGGAAAAACTGG - Intergenic
1080968515 11:37242795-37242817 TCATACTGAATGGGAAAAACTGG - Intergenic
1081037424 11:38166098-38166120 TCATACTGAATGGCAAAAACTGG - Intergenic
1081218661 11:40433891-40433913 TCATACTCTTTGGGAACAACTGG - Intronic
1081325780 11:41742798-41742820 TCATACTGAATGGCAAAAACTGG + Intergenic
1082554894 11:54552685-54552707 TCATACTGAATGGGCAAAACTGG + Intergenic
1082976542 11:59078056-59078078 TCATACTTAATGGGAGAAATAGG - Intergenic
1083127496 11:60585895-60585917 GCATACTGAATGGGGAAAAATGG + Intergenic
1083499598 11:63091799-63091821 TCATTCTAAATGGCAAAAACTGG + Intronic
1085672672 11:78483281-78483303 TCATACTGAATGGGCAAAGCTGG + Intronic
1085884794 11:80509133-80509155 TCATACTGAATGGGCAAAACTGG + Intergenic
1085964107 11:81499591-81499613 TCAGCGTGCATGGGAAAAACAGG - Intergenic
1085977418 11:81675981-81676003 TCATACTGAATGGGGAAAAATGG + Intergenic
1085992008 11:81859950-81859972 TCATATTAAATGGGAAAAAATGG - Intergenic
1086030212 11:82345659-82345681 TCACACTGAATGGGCAAAACTGG + Intergenic
1086057944 11:82669726-82669748 TCATATTGAATGGGGAAAAGTGG + Intergenic
1086271117 11:85068193-85068215 TCATACTGAATGGCAAAACCTGG + Intronic
1087865891 11:103226314-103226336 TTATACTGAATGGGGAAAAGTGG - Intronic
1088370159 11:109080176-109080198 TCATACTGAATGGGCAAAAACGG - Intergenic
1088975100 11:114809235-114809257 TCATACTGAATGGGCAAAAACGG + Intergenic
1089248648 11:117141329-117141351 TCATACTGAATGGGCAAAAACGG + Intergenic
1089882033 11:121783524-121783546 ACCTACTGAATGGGAAAAGCTGG - Intergenic
1090217211 11:124979866-124979888 TCATACTGAATAGGCAAAACTGG - Intronic
1090279979 11:125447481-125447503 AAATACTTTATGGGAAAAACAGG + Intronic
1091616938 12:2056719-2056741 TGATCCTGCATGGAGAAAACTGG + Intronic
1092327886 12:7553223-7553245 TCATCCTGAATGGGAAAAACTGG + Intergenic
1092679012 12:10956463-10956485 TCATACTAAATGGGCAAAACTGG + Intronic
1092680716 12:10977454-10977476 TCATACCGAATGAGCAAAACTGG + Intronic
1092703611 12:11260361-11260383 TCATACAGAATGGGCAAAACTGG + Intergenic
1092706190 12:11287627-11287649 TCATACAGAATGGGCAAAACTGG + Intergenic
1093060971 12:14603540-14603562 TCATACTCAATGGGGGAAACTGG - Intergenic
1094206674 12:27847685-27847707 TCATACTGAATGGGCAAAGGTGG - Intergenic
1094382914 12:29863236-29863258 CCATAATGCATGAGAAAAAAAGG + Intergenic
1094681436 12:32670740-32670762 TTAGAGTGCCTGGGAAAAACAGG + Intergenic
1095072201 12:37867004-37867026 TAATACTGAATGGGCAAAACTGG + Intergenic
1095106145 12:38235292-38235314 TCATACTACATGAGAAAATATGG - Intergenic
1095349757 12:41194759-41194781 TCATAGTTCATGGGAAACACAGG - Intronic
1095647185 12:44561221-44561243 TCATACTGAATGGGAAATGTTGG + Intronic
1096012149 12:48228012-48228034 TAATACTGAATGGGGAAAAGTGG + Intergenic
1096603244 12:52745618-52745640 AGTTACTGCATGGGCAAAACTGG + Intergenic
1096942215 12:55359271-55359293 TCATACTGAATAGGAAAAAACGG + Intergenic
1097313359 12:58145815-58145837 TCATACTGAATGGGCATAAGCGG - Intergenic
1097458165 12:59826578-59826600 TCATATTGCTTTGGAAAAAAAGG - Intergenic
1097546021 12:61002458-61002480 TCACACTGAATGGGCAAAAACGG - Intergenic
1098527090 12:71498843-71498865 TCTTACTGCATGGAAATAACTGG - Intronic
1098801831 12:74969918-74969940 TCATACTGAACAGGAAAAAGTGG + Intergenic
1098998757 12:77151677-77151699 TCATACTGAATGGGAGGAAGAGG - Intergenic
1099388569 12:82049877-82049899 ATATACTGAATGGGAAAAACTGG + Intergenic
1099531652 12:83789437-83789459 TCATACTGAATGGCAAAAACTGG - Intergenic
1099809280 12:87560211-87560233 TCATACTGAATGGGCAAAACTGG + Intergenic
1099902654 12:88731616-88731638 TAATACAGCATGTGAAAAGCAGG - Intergenic
1099920505 12:88951769-88951791 TCATAATGCCTGGGAAGAAGGGG + Intergenic
1100446572 12:94666096-94666118 TCTTTCTTCATGGGAAGAACAGG - Intergenic
1100958267 12:99933838-99933860 TCTTACTGAATGGGGAAAAATGG - Intronic
1100964087 12:99993626-99993648 TCATACAGAATGGGCAAAACTGG + Intergenic
1101251621 12:102941971-102941993 TTATACTGAATAGCAAAAACTGG + Intronic
1101562631 12:105873045-105873067 CCATATTGCATGGGGAAAAATGG + Intergenic
1101601412 12:106213313-106213335 TCCTAGTGCAGTGGAAAAACAGG + Intergenic
1103255072 12:119534515-119534537 TCATACTGAATGGGCAAAAACGG - Intronic
1104086645 12:125481149-125481171 TCATACTGAATAGGCAAAACTGG + Intronic
1105569135 13:21583601-21583623 CCCTACTGCAAAGGAAAAACAGG - Intronic
1105764122 13:23541824-23541846 TCATAACGCATGTCAAAAACAGG + Intergenic
1105926043 13:25009375-25009397 TCATACGGAATGGGCAAACCTGG - Intergenic
1106336137 13:28784650-28784672 CCGTACTGAATGGGAAAAGCTGG - Intergenic
1106349018 13:28909571-28909593 TCATACTGAATCACAAAAACTGG + Intronic
1106777906 13:33026422-33026444 TCATATTGAATGGGAAGAATGGG + Intronic
1107177246 13:37413375-37413397 GGATACTGCCTGGGCAAAACAGG - Intergenic
1107582736 13:41808648-41808670 CAATACTGAATCGGAAAAACTGG + Intronic
1107647169 13:42506505-42506527 TCATACTGAATGGGCAAAAGCGG - Intergenic
1107648534 13:42520318-42520340 TCATACTGAATGGGCAAAAGCGG + Intergenic
1108218064 13:48204901-48204923 TCATACTGAATGGGCAAAACTGG + Intergenic
1108655396 13:52526842-52526864 TCATACTGAGTGGGGAAAAATGG + Intergenic
1108765121 13:53619292-53619314 TCATACTGAATGGCAAAAACTGG - Intergenic
1108976858 13:56455517-56455539 TCATAATGGATGGCAAAAGCTGG - Intergenic
1109013920 13:56983675-56983697 TCATACCGAATGGCAAAAACTGG + Intergenic
1109361824 13:61303202-61303224 GCATACTGAATGGGCAAAGCTGG + Intergenic
1109631847 13:65059912-65059934 TCTTACTGGATGGGACACACTGG + Intergenic
1110118000 13:71843974-71843996 TCAAACTGCATAGGAGAAAAAGG + Intronic
1110360845 13:74623531-74623553 TGCTACTGAGTGGGAAAAACAGG + Intergenic
1110497337 13:76184179-76184201 TCCACCAGCATGGGAAAAACTGG - Intergenic
1110698069 13:78515307-78515329 TCATACTGAATGGGCAAAACTGG - Intergenic
1110818900 13:79891127-79891149 TCATACTGAATGGGCAAATCTGG + Intergenic
1111338397 13:86851465-86851487 TCCTACTGAATGGGCAAAACTGG + Intergenic
1111348714 13:86997882-86997904 TCATATTGAATGGGCAAAATCGG + Intergenic
1111712446 13:91833785-91833807 TCATACTGAATGGGCAAAAACGG + Intronic
1112043080 13:95567720-95567742 TCATACAGAATGGGCAAACCTGG - Intronic
1112586177 13:100720881-100720903 TCATACTGTGTGGGAACAAAGGG + Intergenic
1112644249 13:101311459-101311481 TCATACTGAATGGGCAAAAATGG - Intronic
1112663449 13:101541153-101541175 TCATACTGAATGGGCAAAAATGG - Intronic
1112886922 13:104185140-104185162 TCATACTGAATGGGCAAACATGG - Intergenic
1114132479 14:19808126-19808148 TGATACTGAATGGCAAAAGCTGG + Intronic
1114672126 14:24416938-24416960 TCTTCCTGCATGGGAAGAAGTGG + Exonic
1114688802 14:24561145-24561167 TCATACTGAATAGGCAAAACTGG + Intergenic
1114900618 14:27053130-27053152 TCATACTGAATGGGCAAAAGCGG + Intergenic
1115046670 14:29003307-29003329 TCATACTGAATGGCAAAAACTGG + Intergenic
1115056515 14:29134572-29134594 TCATACTGAATGGGCAAAGCTGG - Intergenic
1115107553 14:29779179-29779201 TCATACTGAATGGGCAAAAACGG + Intronic
1115858918 14:37662251-37662273 TCATACTGAATGGGCAAAGCTGG - Intronic
1116042227 14:39699687-39699709 TCATACTGAATGGGAAAAACTGG - Intergenic
1116066730 14:39993875-39993897 TCATACTGAAAGGGCAAAACTGG - Intergenic
1116085520 14:40232414-40232436 TCACACTGAATGGGGAAAAATGG - Intergenic
1116236155 14:42281829-42281851 TCATACTGAATGGGCAAAACTGG - Intergenic
1116262278 14:42645750-42645772 TCATACTGAATGTGCAAAGCTGG - Intergenic
1116320657 14:43458105-43458127 TCATACTGAATGGACAAAACTGG + Intergenic
1116379376 14:44246235-44246257 TCATACTGAATGACAAAAGCTGG - Intergenic
1116550475 14:46231211-46231233 TCATACTGAATGGGCAAAACTGG + Intergenic
1117264604 14:54074002-54074024 TCATACTGAAGGGCAGAAACTGG - Intergenic
1117707795 14:58490048-58490070 TTATACTGCAATGGAAATACTGG - Intronic
1117822702 14:59667501-59667523 TCTTACTGAATGGGCAAAAACGG + Intronic
1118414861 14:65524673-65524695 TCATACTGAATGGGCAAAAACGG - Intronic
1119703524 14:76770531-76770553 TCCTACTGCCAGGGAAAAAAAGG - Intronic
1119979800 14:79067065-79067087 TCATACTGCAGGGCAAAAGCTGG - Intronic
1122223714 14:100259946-100259968 TGATACTGCAAAGGATAAACTGG - Intronic
1122367951 14:101206856-101206878 TCATACTAAATGGTAAAAACCGG - Intergenic
1122803548 14:104245110-104245132 TCATCCTGCATGGGAAGGCCGGG - Intergenic
1122833188 14:104414119-104414141 TCATACTGAATGGGCAAAAACGG - Intergenic
1123165034 14:106318366-106318388 TGATACTGCATGAGAAAGATTGG + Intergenic
1202846291 14_GL000009v2_random:179933-179955 TCATACTGAATGGCAAAAACTGG - Intergenic
1202915754 14_GL000194v1_random:170538-170560 TCATACTGAATGGCAAAAACTGG - Intergenic
1123428869 15:20197007-20197029 TCATACTGAATGGGCAAAACTGG - Intergenic
1123452114 15:20374557-20374579 TCATACTGAATGGGCAAAACTGG - Intergenic
1123662447 15:22576097-22576119 TCCTACTGCATTGGAGAAACAGG - Intergenic
1124316247 15:28670381-28670403 TCCTACTGCATTGGAGAAACAGG - Intergenic
1124795299 15:32772374-32772396 TTATATGGCATGGGTAAAACTGG + Exonic
1124843799 15:33270228-33270250 TCATACTGAATGGGGAAAAATGG - Intergenic
1125007538 15:34835107-34835129 TCATACTGAATAGGGAAAAATGG + Intergenic
1125179543 15:36866817-36866839 TCATTTTGCATGGTAAGAACTGG + Intergenic
1126480600 15:49115168-49115190 TCATACTGAATGGGGAAAAATGG + Intronic
1127319949 15:57834036-57834058 TCATACTGAATGGCAAAAATTGG + Intergenic
1127491407 15:59467807-59467829 TCATACTGAATGGGCAAAACTGG - Intronic
1127654521 15:61043884-61043906 TCAGACTGCTTGGGATAATCTGG - Intronic
1127844739 15:62859577-62859599 TCATACTGAATGGAAAAAACTGG + Intergenic
1128212228 15:65910738-65910760 TCATTCTCCATGGGACAGACAGG + Intronic
1128782557 15:70371809-70371831 TCATACTGAATGGGCAAAACTGG + Intergenic
1129546083 15:76396910-76396932 TCATACTGAATGAGGAAAAATGG - Intronic
1130129287 15:81124137-81124159 TCATACTGAAAGGGGAATACTGG - Intronic
1130475840 15:84266201-84266223 TCATACTGAATGGGCAAAAACGG - Intergenic
1130483260 15:84380255-84380277 TCATACTGAATGGGCAAAAACGG - Intergenic
1130724375 15:86423429-86423451 TCATACTGAATAGCAAAAGCTGG + Intronic
1130734285 15:86532002-86532024 TCATACTGAATGGGAAAAACTGG + Intronic
1131341069 15:91601388-91601410 ATTTACTGCATGGGAAATACTGG - Intergenic
1132368881 15:101278916-101278938 TCATAGTTCATGGAAAAAAATGG + Intergenic
1134147122 16:11774446-11774468 TCCAACTTCATGAGAAAAACTGG + Exonic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1135812680 16:25603250-25603272 TCATATTGAATGGGCAAAAATGG - Intergenic
1135911119 16:26561824-26561846 TCGTACTGAATGGGCAAACCTGG + Intergenic
1137681229 16:50347302-50347324 TCATACCGAAAGGCAAAAACTGG + Intronic
1138274482 16:55723339-55723361 TCATACTGAATGGGCAAATCTGG + Intergenic
1138755015 16:59473689-59473711 TCACACTGAATGGGAAAAAGTGG + Intergenic
1139844164 16:69907621-69907643 TCAGACTGCATGCAAATAACAGG + Intronic
1140758603 16:78091141-78091163 ACATATTGCATGGGGAAGACTGG + Intergenic
1141313005 16:82933730-82933752 TCATTCCAAATGGGAAAAACTGG + Intronic
1143301071 17:5911046-5911068 TCATTCTACATGGGAAGAGCTGG + Intronic
1144137808 17:12314993-12315015 ACATACTAGATGGGAAAAACAGG - Intergenic
1148174096 17:45549275-45549297 TCATGCTCCATAGGAGAAACTGG + Intergenic
1149216128 17:54357048-54357070 CCATTCTGAATGGGAGAAACTGG + Intergenic
1149362277 17:55908306-55908328 TCATACTGAATGAGCAAAAGTGG - Intergenic
1150948260 17:69771834-69771856 TTGTACTGAATGGGCAAAACTGG + Intergenic
1151542265 17:74770591-74770613 GCAGACTGCATGTGAACAACTGG - Exonic
1152384081 17:79958786-79958808 TCATACTGAATGGTAAAAGATGG + Intronic
1153401101 18:4684554-4684576 TCATGCTGAATGGGCAAACCTGG + Intergenic
1153402708 18:4698693-4698715 TCATGCTGAATGGGCAAACCTGG + Intergenic
1153717488 18:7865285-7865307 TCATACTGAAGGGCAAAAACTGG - Intronic
1153846153 18:9051497-9051519 CCATACTGAATGGGAGAAATTGG - Intergenic
1154387155 18:13904440-13904462 TCATACTGAATGGGGAGAAATGG + Intronic
1154405597 18:14087230-14087252 TCATACTGAATGGGAAAAGCTGG + Intronic
1155773489 18:29728738-29728760 TCATACTGAATGGGGAAAAATGG + Intergenic
1155810302 18:30224859-30224881 TCATACTGAATGGGCAAAAACGG - Intergenic
1155815095 18:30297471-30297493 TCATACTGAATGGGCAAAATGGG - Intergenic
1155889659 18:31251078-31251100 TCATTCGGCATGTGGAAAACTGG - Intergenic
1156084097 18:33378535-33378557 TCATACTGAATGAGCAAAACTGG - Intronic
1156323013 18:36045867-36045889 ATAAACTGCATGGGAAAAAAGGG + Intronic
1157769884 18:50336817-50336839 TCAGACTTAAAGGGAAAAACAGG - Intergenic
1158526480 18:58219258-58219280 TCATTCTGGAAGGGAAAAAAAGG - Intronic
1158802243 18:60926045-60926067 TCATACTACATGTGCAAAAGAGG + Intergenic
1159143816 18:64428291-64428313 TCATACTGAATGGGCAAAACTGG + Intergenic
1159306834 18:66653843-66653865 TCATGATGCATGGGACTAACAGG + Intergenic
1161760775 19:6170181-6170203 TCATACTGAAGGGGAAAAGTTGG - Intronic
1164735225 19:30536231-30536253 GCATTCTGCATTGGAAGAACAGG - Intronic
1166904421 19:46096619-46096641 TCATACTGAATTGGCAAACCTGG - Intergenic
925269835 2:2596369-2596391 TCATACTGAATGAGGAAAAACGG + Intergenic
925403969 2:3593632-3593654 TCATACTTCATGGGCAAAAATGG - Intergenic
930522816 2:52489202-52489224 TCATACTGAATGGGCAAAGCTGG - Intergenic
930961696 2:57269964-57269986 TCATGCTGAATGGGGAAAAGTGG + Intergenic
931534059 2:63252325-63252347 TCATACTAAATGGCAAAAGCTGG + Intronic
931546265 2:63391433-63391455 TCATACTGAATGGGCAAAAACGG + Intronic
931551558 2:63451983-63452005 TCATACTGAATGGGCAAAAACGG + Intronic
933097630 2:78207077-78207099 TCATACTGAATGGGGAAAAGTGG + Intergenic
933166280 2:79079846-79079868 TCATGCTGAATGAGCAAAACTGG - Intergenic
933495341 2:83043600-83043622 TCATACTGAATGGCAGAAGCTGG - Intergenic
933594237 2:84266388-84266410 TCATACTGAATGGGCAAAACTGG + Intergenic
933880781 2:86667736-86667758 TCATACTGAATGGGAAAAACTGG + Intronic
934152864 2:89165381-89165403 TCATACTGAATGGGCAAAACTGG - Intergenic
934214377 2:90016551-90016573 TCATATTGAATGGGCAAAACTGG + Intergenic
934611034 2:95736630-95736652 TCTTCCTGCATGTGACAAACTGG - Intergenic
935021023 2:99231900-99231922 TCATACTGAATAGGCAAAAGTGG + Intronic
935481515 2:103595339-103595361 CCATTCTGAATGGGAGAAACTGG - Intergenic
936544374 2:113378205-113378227 TCCTCCTGCATGTGACAAACTGG - Intergenic
936885368 2:117304370-117304392 TCATACTGAATGGGGAAAAATGG + Intergenic
937725522 2:125160385-125160407 TCATACTGAATTGGCAAAACTGG + Intergenic
939144119 2:138391634-138391656 TCATTCTTCATGGGAAAGTCAGG - Intergenic
940054189 2:149496367-149496389 TCATACTGAATGGGTAAAACTGG - Intergenic
940492570 2:154382513-154382535 AAATACTGCATGGGAAACCCAGG + Intronic
941005096 2:160239803-160239825 TCAGACTCCATGGGAAAGAGAGG + Intronic
941120829 2:161528309-161528331 TCATACTGAATGGGCAAAATTGG - Intronic
941124324 2:161567663-161567685 TCATACTGAATGGGCAAAATTGG + Intronic
941224050 2:162822796-162822818 TTACAGTGCATGGGAAACACAGG + Intronic
942474797 2:176307998-176308020 TCATACTGAATAGGCAAAAATGG - Intronic
943136153 2:183915243-183915265 TCATACTGAATGGCAAAAACTGG - Intergenic
943681632 2:190774347-190774369 TCATACTGAATGGCAAAAACTGG - Intergenic
944327829 2:198427719-198427741 TCATACTGAAAAGGCAAAACTGG - Intronic
944347771 2:198688814-198688836 TCATACTGAATAGGCAAAATTGG + Intergenic
944375103 2:199032474-199032496 TCATACTGAATGGCAAAAACTGG + Intergenic
944499112 2:200340125-200340147 TTCTAGTGCATGGGAGAAACTGG - Intronic
944922600 2:204430994-204431016 TCATACTGAATGGGCAAAACTGG - Intergenic
945349818 2:208764156-208764178 TCATACTGAATGGGCAAAAACGG + Intronic
945564221 2:211376815-211376837 TCATACACCATGGGAAAATGCGG + Exonic
947335502 2:229078495-229078517 TCATACTGAAGGGGCAAAGCTGG - Intronic
947677504 2:231996207-231996229 TCATTCTTCCTGAGAAAAACAGG - Intronic
948721755 2:239905195-239905217 TCACACTGCATGGGGTACACAGG - Intronic
1168730461 20:74185-74207 ACATAATCCATGGGACAAACAGG + Intergenic
1168779900 20:480010-480032 TAATACAGCAGGGGAAAAGCAGG + Intronic
1170537153 20:17351741-17351763 TCATACTGAATGGGCAAAACTGG + Intronic
1171074869 20:22112629-22112651 TCATACTTAATGGGCAAAAGTGG + Intergenic
1171362181 20:24595111-24595133 TCATACTGAATGGCAAAAGTTGG - Intronic
1171772479 20:29334495-29334517 TCATACTGAATGGACAAAACTGG + Intergenic
1171979162 20:31615178-31615200 TCATGTTGCATGAGAAAATCAGG - Intergenic
1173234861 20:41235663-41235685 TCATACTGAATGGCAAAAACTGG + Intronic
1173477285 20:43369618-43369640 TCATACTGAATGGGCAAAACTGG + Intergenic
1174032299 20:47639672-47639694 TCAAACTCCATGGGAAGACCAGG + Exonic
1174323057 20:49757480-49757502 TCATACTGCAGGAGGAAGACAGG - Intergenic
1176345570 21:5742577-5742599 TTATACTGAATGGGTGAAACTGG - Intergenic
1176352384 21:5863161-5863183 TTATACTGAATGGGTGAAACTGG - Intergenic
1176499257 21:7581878-7581900 TTATACTGAATGGGTGAAACTGG + Intergenic
1176539891 21:8140647-8140669 TTATACTGAATGGGTGAAACTGG - Intergenic
1176558842 21:8323692-8323714 TTATACTGAATGGGTGAAACTGG - Intergenic
1176635106 21:9185185-9185207 TCATACTGAATGGCAAAAACTGG - Intergenic
1176969111 21:15245623-15245645 ACATACTGAATCAGAAAAACTGG + Intergenic
1177096063 21:16834744-16834766 ACATATTGAATGGGAAAAAATGG + Intergenic
1177113416 21:17056619-17056641 TCATACCAAATGGGAAAAGCTGG - Intergenic
1177280341 21:18973840-18973862 TCATACTGAATGGCAAAAGCTGG + Intergenic
1177524328 21:22272464-22272486 TCATACTAAATGGGCAAAACTGG - Intergenic
1177541368 21:22497528-22497550 TCATACTGAATGGGAAAAAGTGG + Intergenic
1177662198 21:24099482-24099504 TCATTCTGAGTGGGCAAAACTGG - Intergenic
1180492849 22:15870908-15870930 TCATAGTTCAGGGAAAAAACTGG - Intergenic
1184109476 22:42386644-42386666 TCATAGTGCATGGGCACAGCTGG + Intronic
1185230784 22:49679724-49679746 TCATAATGAATTGGAAAACCAGG + Intergenic
1203244842 22_KI270733v1_random:57002-57024 TTATACTGAATGGGTGAAACTGG - Intergenic
949798583 3:7878287-7878309 TCATAGTGCCTGGGAACAACAGG + Intergenic
949977010 3:9470219-9470241 TCTTTCTGGATGGGAAATACTGG - Intronic
950827468 3:15839943-15839965 TCACACTGAATGGGGAAAATTGG + Intronic
951261068 3:20509486-20509508 TCATACTGAGTAGGAAAAGCTGG - Intergenic
951286257 3:20817502-20817524 TCATACTGAATGGACAAAACTGG - Intergenic
951338412 3:21454631-21454653 TCATACTGAATGGGCAAAACTGG + Intronic
951341735 3:21496942-21496964 TCATACTGAATGGGCAAAGCTGG + Intronic
951580528 3:24158148-24158170 TCTTGCTTCATGTGAAAAACAGG + Intronic
951687237 3:25358579-25358601 TCATACTGAATGGGCAAACCTGG - Intronic
952158489 3:30669567-30669589 ACATAGTGCATGGGGAAGACTGG + Intronic
952586066 3:34893962-34893984 TCATTTTACAGGGGAAAAACAGG + Intergenic
952680058 3:36081387-36081409 TCATATAATATGGGAAAAACTGG - Intergenic
952940105 3:38437306-38437328 TCATACTGCATGGAGAAAAGTGG + Intergenic
953016978 3:39086854-39086876 TCAGACTGCATGGGAAAGGTAGG + Intronic
953074427 3:39555240-39555262 TCATACTGAATGGGAAAAGCTGG + Intergenic
953256694 3:41297414-41297436 ACATACTGCACTGGCAAAACAGG + Intronic
953354345 3:42242527-42242549 TTATACTGAATGGCAAAAACTGG + Intergenic
955629941 3:60962529-60962551 TCATACTGAATTGGCAAAACTGG - Intronic
955642324 3:61099018-61099040 TCATACTAAATGGGCAAAGCTGG - Intronic
955667526 3:61366324-61366346 TCATACTGAATGGGCAAAACTGG + Intergenic
956048265 3:65219777-65219799 TCATACTGAATGGGCAAAAACGG - Intergenic
956394825 3:68814208-68814230 TCATACTGAATGGGCAAAAATGG + Intronic
956713142 3:72055958-72055980 TCATCCTTCATGGGAAAAAATGG + Intergenic
956943819 3:74196229-74196251 TCATACTGAATGGGCAAAATTGG - Intergenic
957456127 3:80449176-80449198 GCATACCGCATGGTGAAAACTGG - Intergenic
957629717 3:82703508-82703530 TCATATTGAATGGGCAAATCTGG - Intergenic
957700361 3:83702336-83702358 TCATACTGAATGGGCAAAACTGG - Intergenic
957925809 3:86809607-86809629 TCATACTGAATGGGGGAAAATGG + Intergenic
958155954 3:89756075-89756097 TCATACTGAAGGGGCAAAAGTGG + Intergenic
958260893 3:91379846-91379868 TCATACTGAGTGGGCAAAACTGG - Intergenic
958422638 3:93945701-93945723 TCATACTGAATGGGCAAAAATGG + Intronic
958423378 3:93953619-93953641 TCATACTGAATGGGCAAAAATGG + Intronic
958597451 3:96245804-96245826 TCATATTACATGGTACAAACAGG - Intergenic
958654282 3:96981149-96981171 TCATACTGAATGGGCAAAACTGG - Intronic
958958788 3:100489562-100489584 TTATACTGAATGTGAAAGACTGG - Intergenic
958972328 3:100625627-100625649 TCGTACTGAATGGGCAAAAATGG - Intronic
959280058 3:104325910-104325932 ACATAGCGCATGGGAAAAGCTGG - Intergenic
959717637 3:109450604-109450626 TGATACTGAATGGGGAAAAATGG + Intergenic
960363817 3:116746883-116746905 TCACCCTGAAGGGGAAAAACTGG + Intronic
960612210 3:119565270-119565292 TCATACTGATGGGCAAAAACTGG - Intergenic
960686005 3:120294382-120294404 TCATACTGAAGGGCAAAAGCTGG + Intergenic
961932680 3:130550402-130550424 TCATACTGAATGGGGAAAGCTGG - Intergenic
961982883 3:131100057-131100079 TCATACTGAATGGCAAAAACTGG - Intronic
962184958 3:133248522-133248544 GCATACTGCAAGGGAAAGGCTGG - Intronic
962699577 3:137983867-137983889 TCATACTGAATGGGCAAAACTGG + Intergenic
962966118 3:140356117-140356139 TCACAGTCAATGGGAAAAACAGG - Intronic
963109422 3:141674218-141674240 TCATACTGAATGGGCAAAACTGG + Intergenic
963245980 3:143063115-143063137 GCATATTGCATGGGAACAGCAGG - Intergenic
963387588 3:144616707-144616729 TCATACTGAATGGGCAAAACTGG - Intergenic
963516191 3:146311788-146311810 TCATATTGAATGGGGAAAAACGG - Intergenic
963567023 3:146942772-146942794 TCATACTGAATGGCAAAAACTGG - Intergenic
963614934 3:147524788-147524810 TCATACTGAATGGGCAAAGCTGG - Intergenic
964007406 3:151848365-151848387 TCATACTAAATGGGCAAAGCTGG - Intergenic
965029273 3:163342394-163342416 ACATAGTGCATGGGGAAGACTGG - Intergenic
965186659 3:165473697-165473719 TCATACTGAATGGACAAACCTGG - Intergenic
965748160 3:171947048-171947070 TTATACTGAATGGGCAAAACTGG - Intergenic
966341616 3:178931200-178931222 TCTTGCTGAATGGGCAAAACTGG + Intergenic
966359420 3:179119210-179119232 TCATACTGAATGGGGAGAAATGG + Intergenic
966753569 3:183346453-183346475 TCATACTGAATGGGCAAAGCTGG + Intronic
967043114 3:185712003-185712025 TCACATTTCATGGGAAAACCAGG - Intronic
967157832 3:186709886-186709908 TGATACTGCAGGGGAATAATGGG + Intergenic
967284976 3:187860193-187860215 TCATACTGAATGGCAAAAGCTGG + Intergenic
967360802 3:188629146-188629168 TCATACTGAACAGGAAAAGCTGG + Intronic
967613284 3:191533995-191534017 TCATAGTGGATGGGAACAAATGG + Intergenic
967696590 3:192539238-192539260 TCATAGTGAATGGGGAAAAATGG - Intronic
968257722 3:197292868-197292890 TCCTTGTGCATGAGAAAAACTGG - Intronic
968388495 4:167950-167972 TCATACAGAATGGGCAAAAAAGG - Intergenic
969976111 4:11103515-11103537 TCATACTGAATGGGCAAAACTGG + Intergenic
970205375 4:13650223-13650245 TCATACAGCATGAGAATAATGGG - Intergenic
970494677 4:16613254-16613276 TCATATTGAATGGCAAAAGCTGG + Intronic
970755226 4:19417756-19417778 TCATACTGAATGGGCAAAAATGG - Intergenic
971463258 4:26925570-26925592 TCATACTGAATGGGCAAAACTGG + Intronic
971939867 4:33200442-33200464 TCATTCTAAATGGGAAAAATAGG - Intergenic
971989137 4:33868275-33868297 TTGTACTGAATGGGAAAAGCTGG + Intergenic
972027836 4:34409237-34409259 TCATACTGAATGGGTAAAACTGG - Intergenic
972914489 4:43858913-43858935 TCATACTGAATGGGCAAACCTGG - Intergenic
973117307 4:46477510-46477532 TCATACTGAATGGCAAAAGCTGG + Intergenic
973237288 4:47919131-47919153 TCATACTGAATGGCAAAAACTGG - Intronic
973563023 4:52155526-52155548 TCATACAGAATGGGCAAAGCTGG + Intergenic
974110386 4:57518954-57518976 TGATACTGAATGGGAAAAACTGG + Intergenic
974142293 4:57902643-57902665 TCATACAGAGTGGGAAAAAGTGG - Intergenic
974151034 4:58009357-58009379 TTATACTGAATGGGAACAACTGG - Intergenic
974288147 4:59896005-59896027 TCATACTGAATGGGCAAAACTGG + Intergenic
974533648 4:63146152-63146174 TCATACTGAATGTGAAAAGCTGG + Intergenic
974567257 4:63593643-63593665 TCATACTGAATGGGAAAAACTGG + Intergenic
974706160 4:65519419-65519441 TCATACTGAAAGGGCAAAAACGG + Intronic
974830323 4:67180942-67180964 TCGTACTGAATGGGCAAAAATGG + Intergenic
975192014 4:71475503-71475525 TTACACAGCCTGGGAAAAACTGG - Intronic
975249616 4:72163504-72163526 TCATACTGAATGGCAAAAGCTGG - Intergenic
975402572 4:73954763-73954785 TCATACTGAATGGGAAAAAATGG - Intergenic
975511729 4:75201083-75201105 TGATACTGAATGGGCAAAAATGG - Intergenic
975520324 4:75293746-75293768 TCATACTGAATGTGCAAAATGGG - Intergenic
975842639 4:78491694-78491716 TCATATTGAATGGCAAAAGCTGG + Intronic
975930759 4:79519336-79519358 AGTTACTGAATGGGAAAAACTGG - Intergenic
975977855 4:80119607-80119629 TCATACTGAATGGCAAAAACTGG + Intronic
976007179 4:80443572-80443594 TCATACTGAATGGGCAAAAGCGG + Intronic
976263455 4:83168090-83168112 TCATACTGAATGGGCAAAACTGG + Intergenic
976394483 4:84541278-84541300 TCATACTGAATGGGCAAAACTGG + Intergenic
976462268 4:85326170-85326192 TCATACAGAATGGGCAAAAACGG + Intergenic
976533956 4:86189846-86189868 TCATACTGAATGGGAAAAGCTGG - Intronic
976592897 4:86867024-86867046 TCATACTGAATGGGCAAAACTGG + Intergenic
976681044 4:87756191-87756213 TGATACTGAATGGGCAAAACTGG - Intergenic
976957895 4:90925942-90925964 GCATCTTGCATGTGAAAAACTGG + Intronic
977083993 4:92571046-92571068 TCATACTGAGTGGCAAAAACTGG - Intronic
977198980 4:94092908-94092930 TGATACTGAATGGGAAAAATTGG - Intergenic
977260895 4:94795883-94795905 TCATACTGCATTTGTAAAAGTGG + Intronic
977316108 4:95449933-95449955 TCAGACTGCAGTGGAAAATCTGG + Intronic
977433791 4:96967406-96967428 TCATACTCAATGGGCAAAAACGG + Intergenic
977488817 4:97685606-97685628 TGATACTGTATGGGAGATACAGG + Intronic
977522085 4:98097519-98097541 TCATACTGAATGGGAAAAACTGG + Intronic
977896764 4:102373960-102373982 TTATACTGAATGGCAAAAGCTGG - Intronic
977986558 4:103389419-103389441 TTGTACTGAATGGGCAAAACTGG + Intergenic
978051243 4:104202919-104202941 TCATACTGAATGGCAAAAACTGG + Intergenic
978095885 4:104776979-104777001 TCATACTGAATGTGGAAAAGCGG - Intergenic
978662826 4:111149142-111149164 TCATACTGAATGGGTAAAACTGG - Intergenic
978923863 4:114218706-114218728 TCATGCTGAATGGCAAAAGCTGG + Intergenic
979012157 4:115386093-115386115 TCATACTGAATGGCAAAACCTGG - Intergenic
979401033 4:120249948-120249970 ACATACTGAAAGTGAAAAACAGG - Intergenic
979520546 4:121661484-121661506 TCATACTGAATGGGCAAAACTGG + Intergenic
979853487 4:125602565-125602587 TCATACTACATGTCACAAACGGG - Intergenic
980152877 4:129069854-129069876 TAATACTGAATGGGGAAAAGTGG - Intronic
980540045 4:134181412-134181434 TCATACTGAATGGCAAAAGCTGG + Intergenic
980584435 4:134793621-134793643 TCATACTGAATGGGAAAAAATGG + Intergenic
980653375 4:135749923-135749945 TCATACTGAATGGGCAAAAATGG - Intergenic
980952062 4:139390458-139390480 TGATACTGTGGGGGAAAAACAGG + Exonic
981397226 4:144266702-144266724 TCATACTGCCTGGAAATAATAGG + Intergenic
981789275 4:148518004-148518026 TCATACTGAATGGGCAAAAGCGG - Intergenic
981984357 4:150835900-150835922 TCATACTGAATGGGCAAAACTGG - Intronic
982279805 4:153671669-153671691 TCATGCTGAATGGGGAAAAATGG - Intergenic
982298583 4:153855810-153855832 TCATACTGAATGGGCAAAAATGG - Intergenic
982359803 4:154507224-154507246 TGATACTGCTTTGCAAAAACAGG + Intergenic
982669913 4:158307918-158307940 TCATACTGATTGGGCAAACCTGG + Intergenic
982910892 4:161141546-161141568 TTATACTGCATGGGGAAAAATGG + Intergenic
982976413 4:162067597-162067619 TCATACTGAATGGCAAAAGCTGG + Intronic
983728694 4:170965611-170965633 TCATATTGAATGGGAGAAAATGG + Intergenic
984063811 4:175023629-175023651 TCATACTGAATGGACAAAACTGG + Intergenic
984301090 4:177918651-177918673 TCACACCGCATGGGCAAAGCTGG + Intronic
984340157 4:178446897-178446919 TCAAACTGAATGGGCAAAGCTGG - Intergenic
985099907 4:186448611-186448633 TCTGGCTGCCTGGGAAAAACAGG - Intronic
985193621 4:187404499-187404521 TTATACTGAATGGCAAAAGCTGG - Intergenic
985225486 4:187756035-187756057 TTATACTGAATGGACAAAACTGG - Intergenic
986490502 5:8284712-8284734 TCATACTCAATGGGCAAAAATGG + Intergenic
986515206 5:8554715-8554737 ACATATTGCAAGTGAAAAACTGG + Intergenic
988012849 5:25512733-25512755 TTATACTAAATGGGAAAAAGTGG - Intergenic
988063870 5:26209343-26209365 TCATACTGAAGGAGAAAACCTGG + Intergenic
988087774 5:26493925-26493947 TAAAACTGCCTTGGAAAAACTGG + Intergenic
989334420 5:40298845-40298867 TCATACTGAAAGGGCAAACCTGG - Intergenic
989488877 5:42026660-42026682 TCATGCTGAATGGGGAAAAACGG - Intergenic
989692943 5:44167164-44167186 TCATACTGAATGGAGAAAGCTGG - Intergenic
989728893 5:44624147-44624169 TCATACTGAATGGGCAAAAACGG + Intergenic
989768982 5:45119905-45119927 CCATACTGAATGGGCAAAAAGGG + Intergenic
989828066 5:45883329-45883351 TCATACTGAATGGGAAAAACTGG - Intergenic
989994621 5:50813691-50813713 TCATACTGAAGGGCAAAAACTGG - Intronic
990167788 5:53014199-53014221 TCATACTGAATGGGCAAAAGTGG - Intronic
990600486 5:57353597-57353619 TCATACTGAATGGAAAAAACTGG - Intergenic
990841877 5:60090570-60090592 TCATTCTGAATGGGGAAAAATGG + Intronic
990922943 5:60987817-60987839 TCATACTGAATGGGCAAAGCTGG + Intronic
991159070 5:63474532-63474554 TCATACTCTATGGGAATCACTGG + Intergenic
991209825 5:64091212-64091234 TCATACTGAATGGGAAAAACTGG + Intergenic
991211197 5:64106694-64106716 TCATACTGAATGGGAAAAACTGG - Intergenic
991532301 5:67629046-67629068 TCATACTAAATGGGCAAAGCTGG - Intergenic
992502494 5:77356365-77356387 TCATATTGCATAGGGAAAAAAGG + Intronic
992766159 5:80002477-80002499 TCATGCTGCCTCGGAAAAGCTGG + Intronic
992785189 5:80163434-80163456 TCATACTGAGTGGGGAAAAATGG - Intronic
992854151 5:80843003-80843025 TCATACTGAATGGGAAAAACTGG - Intronic
992896557 5:81250891-81250913 TCATATTGCTTGGGAAAATCTGG - Intronic
993061621 5:83045135-83045157 TTATATTTCATGGGAAATACAGG + Intergenic
993286728 5:86008696-86008718 TCATACTGAATGGGTGAAGCTGG - Intergenic
993420598 5:87696568-87696590 TCATACTGAATGGGCAAAAATGG + Intergenic
993435227 5:87884678-87884700 TCATATTGAATGGGCAAAAATGG - Intergenic
993586473 5:89736808-89736830 TCATACTGAATAGGCAAACCTGG - Intergenic
993883556 5:93391205-93391227 TAATACTGAATGGGGAAAAATGG - Intergenic
994160670 5:96553452-96553474 TCATACTGAATGTGTAAACCTGG + Intronic
994288199 5:97995348-97995370 TCATACTGAATGGGAAAAACTGG + Intergenic
994390186 5:99183012-99183034 TCATACTGAATGGGAAAAACTGG - Intergenic
994527009 5:100918116-100918138 TCATACTGAATGGGCAAAACTGG - Intergenic
994591378 5:101777526-101777548 TCATATTGAATGGGCAAAAATGG + Intergenic
994802574 5:104397812-104397834 TCATACTGAATGGGGAAACCTGG + Intergenic
994858719 5:105160290-105160312 TCACACTGAATGGGAAAAGCTGG - Intergenic
995177164 5:109192235-109192257 TCATCCTGCCTTGGAATAACTGG - Exonic
995228700 5:109733461-109733483 TCATACTGAATGGGAAAAACTGG - Intronic
995310954 5:110710804-110710826 TCACACTGAATGGGGAAAAATGG + Intronic
995563872 5:113412870-113412892 TCATACTGAATGGACAAACCTGG - Intronic
995713643 5:115060239-115060261 TCATACTGAATGGGCAAAAACGG + Intergenic
996046333 5:118877579-118877601 TCATACTGAATGGGCAAAAGAGG + Intronic
996181793 5:120428499-120428521 TCATACACAATGGGCAAAACTGG - Intergenic
996386123 5:122912568-122912590 TCATACTGAATGGGCAAAACTGG - Intronic
996526672 5:124487575-124487597 TCATACTGAATGGGCAAAACTGG - Intergenic
996538442 5:124603384-124603406 TCACAGAGCATGGAAAAAACTGG + Intergenic
996555957 5:124779074-124779096 GCATGCAGCATGGGAAAAAGAGG - Intergenic
996612957 5:125405867-125405889 TCATACTGCATTTGAAAGAATGG + Intergenic
997130118 5:131268421-131268443 TCATACTACCTGGGAAAACTTGG + Intronic
997799886 5:136849809-136849831 TCATACTGAATGGACAAAAACGG - Intergenic
997814876 5:137006796-137006818 TCATACTGAATGGGCAAAGCTGG - Intronic
998755650 5:145375995-145376017 TCATACTGAACGGCAAAAGCTGG - Intergenic
998976512 5:147654811-147654833 TCATACTGAATGGAAAAAACTGG - Intronic
999714037 5:154344740-154344762 TCATGCTGCCTGGGAAAACTCGG - Intronic
999938981 5:156519907-156519929 TTATATTGAATGGGAAAAGCTGG + Intronic
999984310 5:156988461-156988483 ATATACTGCATGGGCAAAAGCGG + Intergenic
1000068315 5:157716035-157716057 TTATACTGCAAGGGAAAACATGG - Intergenic
1000181218 5:158813321-158813343 ACCTACTGCATGGGAAATAGTGG + Intronic
1000185827 5:158856927-158856949 AGATACTGCATGGTAAAATCTGG + Intronic
1000387574 5:160689269-160689291 TCATACTGAATGGAAAAAGCTGG + Intronic
1000437081 5:161225390-161225412 GCATACTGAATGGCTAAAACTGG - Intergenic
1000521866 5:162305202-162305224 TCACACTAAATGGGCAAAACTGG + Intergenic
1000693830 5:164355481-164355503 TCATTCTGAATGTGCAAAACTGG - Intergenic
1000704389 5:164492410-164492432 TCATACTGAATGGGCAAAAATGG - Intergenic
1001000090 5:167997282-167997304 TCATACAGTATGTGAGAAACTGG - Intronic
1001477493 5:172060997-172061019 TCATTCTTCATGGGGAAACCTGG - Intronic
1001673099 5:173490814-173490836 CCAAACTGAATGGGAAAAGCGGG + Intergenic
1003840859 6:10117924-10117946 TCATACAGTATGGGAAAAGAAGG + Intronic
1004090791 6:12498675-12498697 TCATACTGAATGGCAAAAGCTGG + Intergenic
1004983705 6:21056622-21056644 TCATACTGAATGGGAAAAGCTGG - Intronic
1005235467 6:23757086-23757108 TCATACTGATTGGGCAAAGCTGG - Intergenic
1005781061 6:29192749-29192771 TCATACTGAATGGAAAAAGCTGG + Intergenic
1005789061 6:29277477-29277499 TTATACTGAATGGACAAAACTGG + Intergenic
1007124963 6:39418207-39418229 TAAAACTGCATGAGAAAAACTGG - Intronic
1008215591 6:48784028-48784050 TCATATTGAATGGGGAAAAATGG + Intergenic
1008485941 6:52035847-52035869 TCAAACTGCAGGAAAAAAACTGG + Intronic
1008575133 6:52853122-52853144 TCATACTGAATGGGCAAAACTGG - Intronic
1008757997 6:54820763-54820785 TCATAATGAATGGCAAAAGCTGG - Intergenic
1008782235 6:55121560-55121582 TCATACTGAATGGGAAAAACTGG - Intronic
1008817748 6:55589444-55589466 TCATACTGAATGGGAAAAACTGG + Intergenic
1008898528 6:56584693-56584715 TCATACTGAATGGGCAAAAACGG - Intronic
1008968452 6:57338746-57338768 TCATACTGAATGGGCAAAAACGG + Intronic
1008978251 6:57453886-57453908 TCATACTGAATGGGCAAAAACGG - Intronic
1009336432 6:62496058-62496080 TCATACTGAATGGACAAAGCTGG + Intergenic
1009801176 6:68538201-68538223 TCATAATGAATGTGCAAAACTGG + Intergenic
1010491908 6:76486865-76486887 TCATACTGAATGGGCAAAAATGG - Intergenic
1010820335 6:80407953-80407975 TCATACTGAATGGGAAAAACTGG - Intergenic
1011188320 6:84703374-84703396 TCATACTGAATGGGAAAAACTGG + Intronic
1011251464 6:85376499-85376521 TATTTCTGCATGGCAAAAACTGG + Intergenic
1011324744 6:86137836-86137858 TCATACTTAATGGGAAAAAGTGG + Intergenic
1012043646 6:94241365-94241387 TCATACTGAATGAGCAAAACTGG + Intergenic
1012220819 6:96646957-96646979 TCATACTGAATGGGAAAAGCTGG + Intergenic
1012415375 6:99007085-99007107 TCATACTGAACGGGCAAAACTGG + Intergenic
1012785533 6:103620491-103620513 TCATAATGAATGGCAAAAGCTGG + Intergenic
1012858061 6:104526795-104526817 GTATCCTGTATGGGAAAAACAGG + Intergenic
1012941354 6:105419038-105419060 TCATACTGAATGGGCAAAAACGG + Intergenic
1013124091 6:107166264-107166286 TCATACTGAATGGGCAAAACTGG - Intronic
1013258604 6:108414813-108414835 TCATACTGAATGGGCAAAACTGG + Intronic
1013258973 6:108418488-108418510 TCATACTTCATAGAAAAAAAAGG - Intronic
1013964569 6:115939374-115939396 TCATACTGAATGGGTAAACCTGG + Exonic
1013994734 6:116295050-116295072 TCATACTGCAGTGTGAAAACAGG + Intronic
1014320312 6:119919991-119920013 TCATACTGAATGGGGAGAAATGG - Intergenic
1014330509 6:120058157-120058179 TCATACTGAATGGGCAAAGCTGG + Intergenic
1014956169 6:127619204-127619226 TAATATTGCATGGAAACAACAGG - Intergenic
1015446079 6:133306350-133306372 TCATTTTGCATGTGAAAAACTGG + Intronic
1015707179 6:136100866-136100888 TCATACTGAATGGGCAAACCTGG - Intronic
1016398238 6:143649736-143649758 TCATACTGAATGGGAAAAGCTGG + Intronic
1016523530 6:144973801-144973823 TCATACTGAATGGGAAAAACTGG - Intergenic
1016790018 6:148058630-148058652 CCATACTGAATGGCAAAAGCTGG - Intergenic
1017380529 6:153823198-153823220 TCATACTGAATGGGCAAAATTGG + Intergenic
1018555949 6:165050743-165050765 TCTAACTGCAGGTGAAAAACAGG + Intergenic
1020609428 7:10376585-10376607 TCATACTGAATGGGCAATAACGG + Intergenic
1021371604 7:19855559-19855581 CAATACTGCAAGGGAAAAAAAGG - Intergenic
1021469997 7:20991134-20991156 TCATACTTCATTGGAGAAAAGGG + Intergenic
1021748978 7:23775928-23775950 TCATACTGAATGGGAAAATCTGG - Intronic
1022740735 7:33118453-33118475 TCATACTGAATGGGGAAAAATGG - Intergenic
1023174313 7:37420996-37421018 ACATACTGCATGGCAGAAGCAGG - Intronic
1023498262 7:40820863-40820885 TCATACTGAATGGGCGAAAATGG - Intronic
1023510728 7:40950556-40950578 TCATACTGAATGGGCGAAAATGG - Intergenic
1023511248 7:40955729-40955751 TCATACTGAATGGGAAAAACTGG - Intergenic
1024345047 7:48304890-48304912 TCACACTGGAAGGGTAAAACAGG - Intronic
1024380354 7:48688970-48688992 TCATACTGAATGGGCAAAACTGG + Intergenic
1024892716 7:54222142-54222164 TCATACTGAATGGGCAAAAATGG + Intergenic
1024901200 7:54320245-54320267 TCATACTGAATGGGCAAAAATGG - Intergenic
1024998135 7:55291025-55291047 TCATACTGAATGGGCAAAGTTGG - Intergenic
1025514260 7:61612749-61612771 TCGTACTGAATGGGCAAAAACGG - Intergenic
1025538603 7:62041589-62041611 TCGTACTGAATGGGCAAAAACGG - Intergenic
1027299384 7:76814516-76814538 TCATACTGAATGGAAAAGGCTGG - Intergenic
1027451835 7:78340848-78340870 TCATACTGAATGGGAAAAAATGG + Intronic
1027651477 7:80873931-80873953 GCTTTCAGCATGGGAAAAACAGG - Intronic
1028100009 7:86807844-86807866 TCGTACTGAATGGCAAAAACTGG - Intronic
1028159469 7:87469265-87469287 TCATACTGAATGGGAAAAACTGG + Intronic
1028282274 7:88946186-88946208 TGATACTGAATGGGCAAAAGTGG - Intronic
1028287300 7:89018115-89018137 TCATACTGTATAGGGAAAAACGG - Intronic
1028395679 7:90365863-90365885 TCATACGGAATAAGAAAAACTGG - Intronic
1028469367 7:91187807-91187829 ACATAGTGCATGGGGAAGACTGG + Intronic
1028627589 7:92894819-92894841 TCATACTAAATGGCAAAACCTGG - Intergenic
1028734507 7:94192099-94192121 TCATACTGAATGGGCAAAAACGG + Intergenic
1028782529 7:94753706-94753728 TTATACTGAATGGGAAACACTGG - Intergenic
1028794399 7:94887252-94887274 GCATATTGCATGGGAAGACCTGG + Intergenic
1029979821 7:104868120-104868142 TCATACTGAATGGGCAAAAACGG + Intronic
1030373638 7:108729053-108729075 TCATACTGAATGGGCAAAAACGG - Intergenic
1030426414 7:109384550-109384572 TCATACTGAACGGAAAAAACTGG + Intergenic
1030468973 7:109939129-109939151 TCATACAGCATTTGAAATACAGG + Intergenic
1030475816 7:110032229-110032251 TCATACTGAATGGGCAAAGCTGG - Intergenic
1030741977 7:113120511-113120533 TCATACAGCTTGGGAAAAATGGG - Intergenic
1031287801 7:119893669-119893691 TCATACTGAATGTTAAAAAATGG + Intergenic
1031388357 7:121181147-121181169 TCATACTGCAGGAGAAACAATGG + Intronic
1031703050 7:124948869-124948891 TCATACTGAATGGCAAAAGCTGG + Intergenic
1032312184 7:130798424-130798446 TCATACTGAATGGGCAAAAATGG - Intergenic
1032321318 7:130888681-130888703 TCACACTGCAGGTGAAACACTGG + Intergenic
1032535967 7:132664237-132664259 TCATACTGAATGGGCAAAAACGG - Intronic
1032647692 7:133843761-133843783 TCATACTGAATGAGCAAAGCTGG - Intronic
1033274521 7:139961270-139961292 TCCTACTGTGTGAGAAAAACTGG + Intronic
1033293107 7:140105387-140105409 TCATAATGAATGGGCAAAACTGG - Intronic
1034856704 7:154556280-154556302 TCATAGTGAATGGTATAAACAGG + Intronic
1035575985 8:705567-705589 TCATACAGGATGGTGAAAACAGG + Intronic
1035885868 8:3290924-3290946 TCATACTGAATGGGAAAAACTGG - Intronic
1036189054 8:6653340-6653362 ACATACTGAATGGCAAAAACTGG + Intergenic
1037049910 8:14360154-14360176 TCATACTTAATGGAAAAAACTGG + Intronic
1037155226 8:15691608-15691630 TCATAGTGAATGGGCAAAGCTGG - Intronic
1037325536 8:17685373-17685395 TCAAACAGAATTGGAAAAACAGG + Intronic
1037398182 8:18465497-18465519 TCATACTGAATGACAAAAGCTGG - Intergenic
1037544760 8:19908305-19908327 TCATACTGAATGTACAAAACTGG - Intronic
1038156166 8:24992434-24992456 TGATAGTGCATGGGAAAGGCAGG + Intergenic
1038388900 8:27176242-27176264 TCATGCTGGATGGTAAATACTGG + Intergenic
1038398932 8:27268325-27268347 TTAAAGTGGATGGGAAAAACAGG - Intergenic
1038550968 8:28468383-28468405 TCACACTGAATGGCAAAAAGAGG + Intronic
1038809059 8:30821584-30821606 CCAGACTTCAGGGGAAAAACTGG - Intergenic
1038846350 8:31233362-31233384 TCATACTGAATGGCAAAAACTGG - Intergenic
1039111725 8:34048159-34048181 TCATAATGAATGGGCAAAACTGG - Intergenic
1039281151 8:35986397-35986419 TCATATTGAATGGGCAAAAACGG - Intergenic
1039718835 8:40140319-40140341 TCATACTGAATGGGCAAAACTGG - Intergenic
1039746880 8:40436120-40436142 TCATACTGAATGGGCAAAAACGG + Intergenic
1039754417 8:40508166-40508188 TCATGCTGAATGGGCAAACCTGG - Intergenic
1040443339 8:47467748-47467770 TCATACTGAATGGACAAAAATGG + Intronic
1040612794 8:49002209-49002231 TCATACTGAATGGGCAAAACTGG + Intergenic
1040753260 8:50737950-50737972 TCATACTGAATGGGCAAAAGTGG + Intronic
1040766810 8:50921014-50921036 TCATACTGAATGGGCAAAACTGG + Intergenic
1040867409 8:52062988-52063010 TCATACTCAATATGAAAAACTGG - Intergenic
1041407860 8:57519964-57519986 TCATACTGCCAGGCAAGAACTGG - Intergenic
1042627879 8:70779048-70779070 TCATACTGAATGGGCAAAAACGG - Intronic
1042629360 8:70799960-70799982 TCATATTGAATGGGAAAAGCTGG - Intergenic
1043025294 8:75059832-75059854 TCATACTGAATGGCCAAAACTGG + Intergenic
1043675064 8:82940851-82940873 TCATACTGAATGGGCAAAAGCGG + Intergenic
1043691156 8:83154135-83154157 TCATATTGCAGGGGATAAATAGG - Intergenic
1043742551 8:83832436-83832458 TCATATTAAATGGGAAAAACTGG - Intergenic
1044135543 8:88581185-88581207 TCATACTGAAAGGGCAAAGCTGG - Intergenic
1044144410 8:88693713-88693735 TCATACTGAGTGGGAGAAAATGG - Intergenic
1044193979 8:89352899-89352921 CCATTCTGAATGGGAGAAACTGG + Intergenic
1044394796 8:91698478-91698500 TCATACTGAATGGGGAAAAATGG - Intergenic
1045577276 8:103438176-103438198 TTATACTGCTTTGGAAAAAAGGG + Intronic
1045738767 8:105328816-105328838 TCAAACAGCATTGGAAAATCTGG - Intronic
1045882870 8:107061781-107061803 TCATACTGAAAGGGCAAAAATGG - Intergenic
1046218545 8:111181784-111181806 TCATACTGAATGGGCAAACCTGG - Intergenic
1047022485 8:120790278-120790300 TCATACTGAATGGGAAAAAATGG + Intronic
1047147291 8:122217283-122217305 TCATACTGAATGGGCAAAGCTGG + Intergenic
1047565881 8:126042977-126042999 TCATACTGAATGGGAAAAACTGG - Intergenic
1047687814 8:127318751-127318773 TCATACTAAATGGGCAAAAACGG + Intergenic
1048461483 8:134625164-134625186 TCTTACTACAGGGGAAGAACAGG + Intronic
1048789782 8:138089980-138090002 AAATGCTGCAAGGGAAAAACTGG - Intergenic
1049823407 8:144650795-144650817 TCATACTGAATGGTAAAAGCTGG + Intergenic
1049945322 9:589534-589556 TCATAAAGAAAGGGAAAAACAGG + Intronic
1050055884 9:1653804-1653826 GCATAGTGGATGGGAAAAATAGG + Intergenic
1050393510 9:5171377-5171399 TCATACTGAATGGGTAAAGCTGG + Intronic
1050431485 9:5566720-5566742 TAATACAACATGGAAAAAACTGG + Intronic
1050973543 9:11908495-11908517 TCATACTGAATGGACAAATCAGG - Intergenic
1052173706 9:25431916-25431938 TCATACTGAATGGGAAAAACTGG + Intergenic
1052951192 9:34213562-34213584 TAATACTGAATGGGGAAAAGTGG + Intronic
1055033368 9:71792854-71792876 ACATACTGAATGGAAAGAACTGG - Intronic
1055037459 9:71833200-71833222 TCATATTGAGTGGGGAAAACCGG + Intergenic
1055189228 9:73497479-73497501 TCTTGCTGCAGGGGAAAAAAAGG + Intergenic
1055234440 9:74103397-74103419 TCATACTGAATGGGCAAAGCTGG + Intergenic
1055262346 9:74452069-74452091 TCATACTGAATGGGGAATAATGG - Intergenic
1055745069 9:79434740-79434762 TTATACTGAATGGGCAAAAACGG - Intergenic
1056778181 9:89529271-89529293 TCACAGGGCTTGGGAAAAACAGG - Intergenic
1058034200 9:100233469-100233491 TCATAATGAATTGGCAAAACTGG - Intronic
1058080337 9:100694621-100694643 TCATACTGAATGGGCAAAACTGG + Intergenic
1058142974 9:101377647-101377669 TCATAATGAATGGGCAAACCTGG + Intronic
1058243493 9:102596964-102596986 TCATACTGAATGGGCAAATCTGG - Intergenic
1058809694 9:108627477-108627499 ACATTTTGCAAGGGAAAAACTGG - Intergenic
1059745857 9:117200461-117200483 TCATATTGAATGGGAAAAGCTGG - Intronic
1060206380 9:121685014-121685036 TCATACTTCAAGGAGAAAACTGG - Intronic
1060581030 9:124746833-124746855 CCAGACTGCATTGGAAAAATAGG + Intronic
1062603467 9:137331296-137331318 TCATACTAAATGGGGAAAAGTGG + Intronic
1203461173 Un_GL000220v1:40085-40107 TTATACTGAATGGGTGAAACTGG - Intergenic
1203408430 Un_KI270538v1:69800-69822 TCATACTGAGTGGGCAAATCTGG + Intergenic
1186369710 X:8934259-8934281 TCATACTGAATGGGCGAAAATGG - Intergenic
1186600530 X:11032019-11032041 TCATACTGAATGGGCAGAAATGG + Intergenic
1186947835 X:14589175-14589197 TTATACTGGATGGCAAAAGCTGG - Intronic
1187115256 X:16342934-16342956 TCAGACTGAATGGGCAAAGCTGG - Intergenic
1188014560 X:25093876-25093898 TCATAATGAATGAGAAAAACTGG - Intergenic
1188230043 X:27650894-27650916 TCATACTGCATGGGAAAAACTGG - Intronic
1188579183 X:31689011-31689033 TCATACTGAATGGGCAAAACTGG + Intronic
1188723200 X:33548374-33548396 ACATACTGAATGGGAAAAAGTGG - Intergenic
1188931024 X:36111201-36111223 TCATACTGAATGGGCAAAGGTGG - Intronic
1189852733 X:45193258-45193280 TCATACTGCAAATGAAAATCAGG + Intronic
1190965412 X:55295666-55295688 TCATAGTGAATGGCAAAAGCTGG - Intergenic
1191023450 X:55887795-55887817 TCATACTGAATGGACAAATCTGG - Intergenic
1191073373 X:56426154-56426176 TCATACTGAATGGGCAAAAATGG - Intergenic
1191075702 X:56451088-56451110 TCATACTGAATGGGCAAAAACGG - Intergenic
1191096412 X:56677723-56677745 TCACACTGAATGGCAAAAACTGG + Intergenic
1191115748 X:56850869-56850891 TCATACTGAATGGGAAAAGCTGG + Intergenic
1191124132 X:56936261-56936283 TCATACTGAATGGGCAAAACTGG - Intergenic
1191156312 X:57277465-57277487 TCATACTGAATGGGCAAACCTGG + Intergenic
1191165245 X:57383218-57383240 TCATACTGAATGGCAAAAACTGG + Intronic
1191218153 X:57954696-57954718 TCATACTGAATGGCACAAACTGG + Intergenic
1191266475 X:58399667-58399689 TCATACTGAATGGGCGAAACTGG + Intergenic
1191585630 X:62823624-62823646 TCATACTGAATGGTCAAAAACGG + Intergenic
1191639697 X:63416692-63416714 TCACACTGAATGGGGAAAAGTGG - Intergenic
1192074034 X:67972324-67972346 TCATGCTGAATGGGGAAAAATGG + Intergenic
1192253661 X:69435822-69435844 TCATACTGAATGGGCAAACCTGG - Intergenic
1192376362 X:70566503-70566525 TCATACTGAATGGGCAAAAACGG - Intronic
1192832370 X:74764067-74764089 TCATACTGAATGGGCAAAAACGG - Intronic
1192842307 X:74869364-74869386 TCATACTGAATGAGGAAAAATGG + Intronic
1192934221 X:75841787-75841809 TCATACTGAATGGGCAAATTTGG - Intergenic
1193010867 X:76673669-76673691 TCATACTGAATGGGCAAACCTGG + Intergenic
1193028387 X:76871016-76871038 TCATACTGAATGGGCAAAACTGG + Intergenic
1193035044 X:76940540-76940562 TCATACTGAATGGGCAAAACTGG + Intergenic
1193069319 X:77291141-77291163 TCATACTGAATGGACAAAAACGG - Intergenic
1193180358 X:78447685-78447707 TCATACTGAATGGAAAAAACTGG - Intergenic
1193219582 X:78907898-78907920 ACATACTGAATGGGGAAAAATGG - Intergenic
1193224855 X:78970699-78970721 TCATACTGAATGGGCAAAGTTGG - Intergenic
1193362665 X:80594442-80594464 TCATACTGAATGGGCAAAACTGG + Intergenic
1193516670 X:82474190-82474212 TCACACTGAATGGGCAAAACTGG - Intergenic
1193542812 X:82792353-82792375 TCATACTGAATGGCAGAAACTGG + Intergenic
1193581141 X:83264463-83264485 TCATACTGAATTGGCAAACCTGG + Intergenic
1193625655 X:83817338-83817360 TCATTCTGAATGGGCAAAAGCGG - Intergenic
1193756317 X:85413330-85413352 TCATATTGAATGGGAAAAAATGG - Intergenic
1193781892 X:85713059-85713081 TCATACTGAATGGGCAAAACCGG + Intergenic
1194005698 X:88488707-88488729 TCATACTGAATGGCAAAAGCTGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194199782 X:90940570-90940592 TCATACTGAATGGAAAACTCTGG + Intergenic
1194246191 X:91514645-91514667 TCAGACTGAATGGGCAAAAACGG + Intergenic
1194259463 X:91675949-91675971 TCATACTGAATGGGCAAAAATGG - Intergenic
1194328554 X:92552632-92552654 TAATACTGAATGGGGAAAAATGG - Intronic
1194444642 X:93972930-93972952 TCATACTGAATGGGCAAAGCTGG - Intergenic
1194911133 X:99646020-99646042 TCATACTGAATGGGCAAAAGTGG - Intergenic
1195098378 X:101528375-101528397 TCATACTGAATGGCAAAAACTGG + Intronic
1195312684 X:103647987-103648009 TCATACTGAATGGGAAAAACTGG + Intergenic
1195665440 X:107425738-107425760 TCATACTGAATGGGCAAAAACGG + Intergenic
1196159379 X:112465863-112465885 TCATACTGAATAGGCAAATCTGG + Intergenic
1196216962 X:113064349-113064371 TCATACTAGATGGGCAAAGCTGG - Intergenic
1196248840 X:113433806-113433828 TCATACTGAATGGGGAAAAACGG + Intergenic
1196252371 X:113477005-113477027 TCATACTGAATGGGGAAAAATGG - Intergenic
1196367443 X:114939375-114939397 TCATACTGAATGGGAAAAACTGG - Intergenic
1196511423 X:116516707-116516729 TCATACTGAATGGGCAAAACTGG - Intergenic
1196560771 X:117145459-117145481 TCATACTGAATGGGCAATGCTGG - Intergenic
1196589057 X:117464290-117464312 TCATACTGAATGGGCAAAACTGG - Intergenic
1196914633 X:120520007-120520029 TCATATTGAATGGGCAAAAACGG + Intergenic
1196947900 X:120846378-120846400 TAATACTGAATGGGGAAAAATGG - Intergenic
1197008547 X:121533305-121533327 TCATACTGAATGGGCAAAAATGG - Intergenic
1197036620 X:121881397-121881419 TCATACTGAATGGGCAAAAACGG + Intergenic
1197139697 X:123103538-123103560 TCATCCTGAATGGGGAAAAATGG + Intergenic
1197141822 X:123125780-123125802 TCATACTGAATGGGCAAAAGTGG + Intergenic
1197302605 X:124799701-124799723 TCATACTGAATGGGAAAAGCTGG - Intronic
1197402684 X:126010990-126011012 TCATACTGAATGGGAAAATGTGG + Intergenic
1197575217 X:128202967-128202989 TCATACTGAATGGGCAAAACTGG + Intergenic
1198206687 X:134472272-134472294 TCACACTGAACAGGAAAAACTGG - Intronic
1198579023 X:138042990-138043012 TCATACTGAATGGGCAAAGCTGG + Intergenic
1198796006 X:140395470-140395492 CCATACTGCTTGGGGAAAAATGG + Intergenic
1198891178 X:141398468-141398490 TCATACTGAATGGCAAAAGCTGG - Intergenic
1198916731 X:141680642-141680664 TCATACTGAATGGGCAAAAACGG - Intronic
1199170669 X:144731602-144731624 TCATTCTAAATGGGAAAAATTGG + Intergenic
1199219615 X:145302495-145302517 TTATACTGAATGGGCAAAAGTGG - Intergenic
1199739551 X:150720757-150720779 TCAAATTGGAAGGGAAAAACTGG - Intronic
1200471454 Y:3591156-3591178 TCACACTGAATGGGGAAAACTGG - Intergenic
1200545772 Y:4516986-4517008 TCATACTGAATGGAAAACTCTGG + Intergenic
1200637263 Y:5671852-5671874 TCATACTGAATGGGGAAAAATGG - Intronic
1200941902 Y:8792149-8792171 TCATACTGAATGGGCAAAAATGG + Intergenic
1200974588 Y:9195116-9195138 TCATACTGAATGGGCAAACCTGG - Intergenic
1201308603 Y:12573579-12573601 TCATAGTGAATGGGCAAAAACGG + Intergenic
1201309188 Y:12579669-12579691 TCATACTGAATGGGCAAAAATGG - Intergenic
1201340146 Y:12924985-12925007 CCATACTCCATGGCATAAACAGG - Intergenic
1201353811 Y:13075793-13075815 TCATACTGAATGATAAAACCTGG + Intergenic
1201459843 Y:14210271-14210293 TCATACTGAATGGAGAAAACTGG + Intergenic
1201493000 Y:14563143-14563165 TCATACTGAAGGGCAAAAGCTGG - Intronic
1201915410 Y:19176540-19176562 ACATACGGAATGGGCAAAACTGG + Intergenic
1201925775 Y:19286003-19286025 TCATACCGAATGGACAAAACTGG - Intergenic
1201952660 Y:19582577-19582599 ACATACTGAATGGGCAAAACTGG - Intergenic
1201956225 Y:19626237-19626259 TCATACTGAATTGGAAAAACTGG - Intergenic
1201970017 Y:19781832-19781854 TCATACTGAACGGGCAAAACTGG + Intergenic
1202017829 Y:20430627-20430649 TCATACTGAATGGGCAAAACTGG - Intergenic
1202070023 Y:20981792-20981814 TCATACTGAATGGGCACAGCTGG - Intergenic
1202112693 Y:21440270-21440292 TCATACTGAATGGCAGAACCTGG - Intergenic