ID: 1188232150

View in Genome Browser
Species Human (GRCh38)
Location X:27677663-27677685
Sequence CAGGTCATGCAGGACCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 2, 1: 3, 2: 15, 3: 88, 4: 418}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188232150 Original CRISPR CAGGTCATGCAGGACCTTGC AGG Intronic
900373955 1:2344791-2344813 CTGGCCATGGAGGACCTTGGGGG + Intronic
901309372 1:8257418-8257440 TAGGTCCTGCAGGCCCTTGTAGG + Intergenic
901436199 1:9248731-9248753 CAGGCCTTGAAGGACATTGCTGG + Intronic
902045243 1:13519116-13519138 CAGGCCATGCAGGATCTGGTGGG - Intergenic
902406154 1:16184731-16184753 CTGGTCATGCAGAGCCTTGGTGG - Intergenic
902749348 1:18496419-18496441 CAGGTGATGCTGAATCTTGCTGG + Intergenic
903001655 1:20270540-20270562 CAGGCCATGCAGAACCTTGCAGG - Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905726235 1:40254106-40254128 CAGGTAATGAAGGACCTCGAAGG + Intergenic
905843310 1:41204438-41204460 CAGATCATGCAGGACTATGTGGG - Intronic
905926568 1:41754191-41754213 AGGGTCGTGCAGGACCTTGCAGG + Intronic
906559912 1:46748821-46748843 CAGGTCATCCCTGGCCTTGCAGG - Intergenic
906824068 1:48959864-48959886 CAGATCATGTAGGGCCTTGTAGG + Intronic
907383532 1:54110695-54110717 CAGGACACGGAGGACCTTGTAGG - Intronic
907587729 1:55636045-55636067 CAGGTCATGCTGGATCCTGGAGG + Intergenic
907908301 1:58805067-58805089 CAGGTCACACAGAGCCTTGCAGG - Intergenic
907952162 1:59194151-59194173 CAGAGCATGCATGACCTTGTTGG - Intergenic
908253834 1:62286346-62286368 CAGGTAATCCCTGACCTTGCTGG + Intronic
908647065 1:66289610-66289632 CAGGTCTCGCAGGATCTTGTAGG + Intronic
909140549 1:71859129-71859151 GAAGTCATACAGGGCCTTGCAGG - Intronic
910322641 1:85965902-85965924 CAGGTCATGTAGGGCCTTGCAGG + Intronic
910339746 1:86172562-86172584 ACGGTCATGTAGGACCTTTCAGG + Intergenic
910791395 1:91054761-91054783 CAGATGGTGCAGGGCCTTGCAGG + Intergenic
910902319 1:92134354-92134376 CAGATCATGGAGGGTCTTGCAGG - Intronic
912884688 1:113458028-113458050 CAGGTCACGTAGGAACTTGTGGG + Intronic
913177344 1:116286807-116286829 AAGGTCATGCAGCAGATTGCTGG - Intergenic
915276168 1:154789680-154789702 CAGGACAGGCAGGGCCTTGGGGG + Intronic
915647245 1:157281683-157281705 CAGATGGTGCAGGGCCTTGCAGG + Intergenic
916357811 1:163932990-163933012 CACGTCATGAAGGGCCTTGTAGG - Intergenic
916366926 1:164039711-164039733 CAAATGATGCAGGATCTTGCAGG - Intergenic
916784163 1:168071786-168071808 TATGTCATGTAGGACCTTGAAGG - Intronic
916915174 1:169399070-169399092 CAGGTAATGTATAACCTTGCTGG + Intronic
918327211 1:183421320-183421342 CAGATCATACAGGGCCTTGTAGG + Intergenic
918413264 1:184282470-184282492 CAGATCCTGCAGGGCCTTTCAGG + Intergenic
919821214 1:201473387-201473409 CAGGTCTTAGAGGGCCTTGCAGG - Intergenic
919843496 1:201626370-201626392 CAGGTCAGGCATGACCAGGCTGG - Intronic
920034885 1:203059371-203059393 CAGTTCAGGAAGGGCCTTGCTGG - Intronic
921232575 1:213088041-213088063 CAGGACTTGCATTACCTTGCTGG + Intronic
921936451 1:220801131-220801153 CAGGTCATGTTGGGCCTTCCAGG - Intronic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
922474623 1:225898711-225898733 CAGGTCATCCAGCCCCTTCCTGG - Intronic
923403237 1:233636139-233636161 CAGATCATGTAGGACCTTATGGG + Intronic
923616870 1:235545442-235545464 CAGGGCAGGCAGGGCCTTGGAGG + Intergenic
924941507 1:248815499-248815521 CATGTCTTGGGGGACCTTGCTGG + Intronic
1067254670 10:44625060-44625082 CAGGTCACATAGGGCCTTGCAGG - Intergenic
1067307007 10:45073251-45073273 CAGGGCTTGCAGGACCTGGCGGG + Intergenic
1069173363 10:65260485-65260507 CAGATCAGGCAGGGCCTTACAGG + Intergenic
1069573152 10:69506708-69506730 CAGGTCACACAGGACCATGAGGG + Intronic
1069824091 10:71244743-71244765 TAGGACCTGCAGGACCTTGCTGG - Intronic
1071455682 10:85849840-85849862 CTGGTCAAGCAGGATCTTGCTGG - Intronic
1071461780 10:85903659-85903681 CAGGTCATGTAGAACTTTTCTGG - Intronic
1071986950 10:91061535-91061557 CAGATCATGGGGGACCTTGTAGG - Intergenic
1073118635 10:101107968-101107990 CTGGTCATGCAGGACTTTGCTGG - Intronic
1073147357 10:101289606-101289628 CAGGTGGTGCAGGCCCTTGAGGG - Intergenic
1075462524 10:122627018-122627040 CAGATCATTCAGGGCCTTGTGGG + Intronic
1075686390 10:124367807-124367829 CAGGCCATGGAGGGCCTGGCAGG - Intergenic
1076697320 10:132253268-132253290 CAGGCCCGGCAGGACCTTCCAGG - Intronic
1077649366 11:3956078-3956100 CAGATCATTCTGGGCCTTGCAGG + Intronic
1078095478 11:8293813-8293835 CAGGTTACACAGGGCCTTGCAGG - Intergenic
1078334005 11:10450166-10450188 GAGGTCATTCAGGACTTTGAGGG + Intronic
1078521522 11:12067714-12067736 CAGGGCGTTCAGGACCTTACAGG - Intergenic
1079281499 11:19090900-19090922 CAGGCCATGAAGGACCTTGAAGG - Intergenic
1079504323 11:21136328-21136350 CAGGTCATGTAGGGCCATGTGGG + Intronic
1080373176 11:31676063-31676085 CAGGTCATGTAGGGTCTTGGTGG - Intronic
1081646217 11:44792441-44792463 AAGGTCATGAGGGGCCTTGCGGG + Intronic
1081708330 11:45199809-45199831 CAGGGCAGGCAGGATCTCGCAGG - Intronic
1081925050 11:46819387-46819409 CAGATCATGCAGGACTATGAAGG + Intronic
1082216220 11:49573099-49573121 CAGGCCATGTAGGACATTGTAGG - Intergenic
1082773124 11:57224242-57224264 CAGGTCATGTAGGACCTTGAAGG - Intergenic
1084362030 11:68674969-68674991 AAGGTCAAGGAGGACCCTGCAGG + Intergenic
1084977538 11:72810860-72810882 CAGATCAAGCAGGGCCTTGAAGG + Intergenic
1085263925 11:75225198-75225220 CAGGCCATGCTGGGCCTTGCAGG - Intergenic
1085336182 11:75698241-75698263 AAGGTTATGCAGGGCCTTGAAGG - Intergenic
1086633367 11:89051381-89051403 CAGGCCATGCAGGATGTTGCAGG + Intronic
1088280055 11:108126432-108126454 CAGATCATGCAGGTTCTTGGAGG + Intronic
1088673685 11:112168971-112168993 CAGATAATACAGGACCTTGAAGG + Intronic
1089539434 11:119181200-119181222 CAGGTCTCGGAGGTCCTTGCAGG - Exonic
1091156387 11:133377924-133377946 CAGTTCCTGCAGGACCTTCAGGG + Intronic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1092147984 12:6227975-6227997 CAGATCCTGCAGGTCATTGCAGG + Intronic
1092391985 12:8088720-8088742 CAGATCACGCAGGGCCTTGTGGG - Intronic
1092737353 12:11595093-11595115 CCGATCATGCAGGACATTGTAGG - Intergenic
1093354673 12:18152232-18152254 CAGTTCATGGAGGGCTTTGCAGG - Intronic
1093655019 12:21684589-21684611 CAGGTTATACAGGTCCTTGTAGG + Intronic
1094055506 12:26265432-26265454 TAGATCATGAAGGACCTTGCAGG + Intronic
1095282177 12:40366092-40366114 CAGCTCATGCAGCACCTTGTAGG - Intronic
1095472992 12:42556277-42556299 CAGGTCTTCCAGGGTCTTGCTGG - Intronic
1095700504 12:45186220-45186242 CAGATCATGTAGGGCCTTACAGG + Intergenic
1096176222 12:49521279-49521301 AAGATCATCCAGGACCTTACAGG + Intronic
1096558942 12:52422365-52422387 CAGCTCATGATGGACCTGGCTGG - Intergenic
1097414380 12:59296217-59296239 CAGGTGGTGCAGGGCCTTGTAGG + Intergenic
1097422693 12:59400028-59400050 CAGGGCAATCAAGACCTTGCAGG - Intergenic
1097862141 12:64528434-64528456 AAGGTCATGCAGGGAGTTGCTGG + Intergenic
1097973400 12:65659406-65659428 TGGATCATGCAGGACCTCGCAGG - Intergenic
1098252521 12:68584961-68584983 CAGGTAATGCAGGAACTGGCAGG + Intergenic
1098641938 12:72849525-72849547 CAGATAATACAGGACCTTGTAGG + Intergenic
1099318679 12:81117621-81117643 CAGATCATATAGAACCTTGCAGG + Intronic
1101761126 12:107660034-107660056 CAGCTCATGCTGGCCCTTGGTGG - Intergenic
1102596584 12:113997385-113997407 CAGATCATGCAGGGACATGCAGG + Intergenic
1102968526 12:117147788-117147810 CAGGTCATGGAGGGCATAGCTGG - Intronic
1103813545 12:123634818-123634840 CAGGTCATGCAGGGCCTTATTGG + Intronic
1103858331 12:123990679-123990701 GAGGTCAGGCAGGAACTAGCTGG - Intronic
1104112683 12:125718425-125718447 CAGATCCTGCAGGACAGTGCAGG - Intergenic
1104411305 12:128560320-128560342 CAGATCACTCAGGATCTTGCAGG - Intronic
1104657160 12:130581900-130581922 CAGGTCATGCAGAGCCTTTCGGG - Intronic
1104732223 12:131113801-131113823 CAGGTCATGCGTGACCTGGAGGG - Intronic
1105033244 12:132899820-132899842 CAGGTCATGCAGTAATTTGGTGG + Intronic
1106041704 13:26099831-26099853 CAGATCAAGCAAGTCCTTGCTGG + Intergenic
1106102279 13:26705485-26705507 CAGGTCATGCAGGGGGATGCAGG + Intergenic
1106310082 13:28546444-28546466 TAGATCATGCAGAACCTTGTAGG + Intergenic
1106446374 13:29835923-29835945 TAGATCATGCAGGACCCTGAAGG + Intronic
1107175219 13:37391953-37391975 CAGATCATGTAGGGCTTTGCAGG + Intergenic
1107821029 13:44285843-44285865 CAGTTCATGCAGGACCTGAGGGG - Intergenic
1107975423 13:45683828-45683850 GAGGTCATGTAGGGCCTTGAGGG - Intergenic
1108161549 13:47645463-47645485 CAGATCATGCAGGGCCCTGTAGG - Intergenic
1109482119 13:62969587-62969609 CAGGTTATACAGGACCTTGAAGG - Intergenic
1110013567 13:70370119-70370141 CAAGTAATGCAGCACATTGCAGG + Intergenic
1110480945 13:75975426-75975448 CAGGTCATGAAGGACTGTGTAGG + Intergenic
1111908956 13:94288493-94288515 CAGATAATGCAAGAGCTTGCAGG - Intronic
1113794946 13:113051369-113051391 CCGGTCATGCAGAATATTGCAGG + Intronic
1116578105 14:46601910-46601932 CCAGTAATACAGGACCTTGCAGG + Intergenic
1116901523 14:50366457-50366479 CAGATCCTACAGGGCCTTGCAGG + Intronic
1117344616 14:54820033-54820055 CAGGTCATGAAGGGTCTTGTGGG - Intergenic
1117611160 14:57484728-57484750 CAGGTCATGCAGGGCCTGACAGG + Intronic
1118221238 14:63856195-63856217 CAGATCATGCAGGGCCTTTCTGG + Intronic
1119215926 14:72869010-72869032 CTGGTCATGAAGGGCCTTGATGG - Intronic
1119520466 14:75280889-75280911 CAGGTCATCAGGGATCTTGCAGG - Exonic
1121898360 14:97670125-97670147 CTGGACATGCAGGATCTTGGTGG + Intergenic
1122020051 14:98830351-98830373 CAAGGCACACAGGACCTTGCAGG - Intergenic
1122146141 14:99689943-99689965 CAGGTCATGTAGAGCCTTGTGGG - Intronic
1123157243 14:106239968-106239990 GAGGTGCTGCAGGACATTGCAGG + Intergenic
1123188761 14:106546769-106546791 CAGTTCATGCAAAACCTGGCAGG - Intergenic
1123198358 14:106638775-106638797 TGGGTCATGCAGGAACTTGTAGG + Intergenic
1124089002 15:26579997-26580019 CAGGTCATTGATGACCTTGGAGG - Intronic
1124160644 15:27265605-27265627 CAGGTCTTCAAGGACCATGCTGG + Intronic
1125102745 15:35933822-35933844 CAGATCATCCAGGGCCTTGTTGG + Intergenic
1125306356 15:38320392-38320414 CAGCTCATGCAGGGCCTAGTAGG + Intronic
1125841612 15:42806502-42806524 CAGATAATGCAGGGCCTTGTAGG - Intronic
1125900629 15:43343337-43343359 CAGATCATGTGGGACCTTGTAGG - Intronic
1127345054 15:58086447-58086469 CATATCATGCATGACCTTGGTGG + Intronic
1128546828 15:68574020-68574042 CAGGTCTTGGAGGACCCTGTTGG + Intergenic
1128581049 15:68810175-68810197 CAGACCATGCAGCACCTTGTTGG + Intronic
1128728597 15:70005947-70005969 CAGGTCCTGCAGGACAGTGCAGG - Intergenic
1130898942 15:88192627-88192649 CAGCTTGTGCAGGACCTTGAGGG - Intronic
1131799524 15:96054458-96054480 CAGGTTTTGGGGGACCTTGCCGG + Intergenic
1132321619 15:100929744-100929766 CAGGGCAGGCAGGGCCTTGCAGG + Intronic
1134036155 16:11032830-11032852 CAGGTCATGAAGGGCCTTGAAGG + Intronic
1134801144 16:17085892-17085914 CAGATCATGCATTACCCTGCAGG - Intergenic
1134819910 16:17238627-17238649 CTGGTCATGCAGGACCTTGTAGG - Intronic
1135357936 16:21785570-21785592 AAGGTCATGCTGGGTCTTGCAGG - Intergenic
1135387654 16:22058019-22058041 CAGGTAATACAGGACCTGGTAGG + Intronic
1135456441 16:22601688-22601710 AAGGTCATGCTGGGTCTTGCAGG - Intergenic
1136056730 16:27695311-27695333 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1136596421 16:31253254-31253276 CAGGTCATGCAGGTCCTTGTAGG + Intergenic
1136869387 16:33791523-33791545 CAGTTCATGCAAAACCTGGCAGG + Intergenic
1136993489 16:35172076-35172098 CAAGGCATGCAGGAGCCTGCAGG + Intergenic
1137358118 16:47786427-47786449 CAGATCATGTGGGGCCTTGCAGG - Intergenic
1137408095 16:48205747-48205769 CAGTCCAAGCAGGACCTGGCTGG - Intronic
1137435075 16:48448249-48448271 CAGGTAATGGTGGACCTTGAGGG - Intronic
1137484758 16:48881933-48881955 CAGGTGTAGCAGGACCTAGCAGG + Intergenic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1139607908 16:68033012-68033034 CTGATCATGCAGGGCCTTGTGGG + Intronic
1139739250 16:69021172-69021194 TAGATCATGAAGGGCCTTGCAGG - Intronic
1140590619 16:76347856-76347878 CAGATCATTGAGGACATTGCAGG + Intronic
1203102786 16_KI270728v1_random:1324545-1324567 CAGTTCATGCAAAACCTGGCAGG - Intergenic
1144031797 17:11329730-11329752 CTGGTTCTGCTGGACCTTGCTGG - Intronic
1144285044 17:13765975-13765997 CAAGTCATGCAGGATCTTGCGGG + Intergenic
1144687556 17:17236419-17236441 CAGGGCAAGGAGGAGCTTGCTGG - Intronic
1145203508 17:20967951-20967973 GACGTCATGCAAGTCCTTGCAGG + Intergenic
1146791803 17:35755074-35755096 TAGATCATGCAGGGCCTTGTAGG + Intronic
1146889311 17:36495528-36495550 TAGGTCATGCAGGCCTTTACCGG + Exonic
1146962900 17:36999962-36999984 CAGGTCCTGTGGGACCTTGTAGG + Intronic
1147863693 17:43539171-43539193 CAAGTCATGCAGAGCCTTGGAGG - Intronic
1149451861 17:56755934-56755956 CAAATCATGCAGGAGCTTGGGGG - Intergenic
1149814734 17:59712724-59712746 CAGGTCATGCAGAATTTTGCAGG + Intronic
1150209877 17:63436088-63436110 CAGCCCGTGCAGGACCTTGGTGG + Exonic
1150584450 17:66504915-66504937 CAGGACATGCAGAACATTACAGG - Intronic
1150650219 17:67005291-67005313 CATGTCATGCAGGGCCATGGGGG + Intronic
1151947809 17:77329098-77329120 CAGGTCGTGCCGGGCCTTGGAGG + Intronic
1152280845 17:79384133-79384155 CAGGTCAGGCAGGTCCAGGCAGG + Intronic
1152717074 17:81905358-81905380 TGGGTCATGCTGGCCCTTGCTGG - Intronic
1153018161 18:602945-602967 AAGGTCTTGCAGGACCTTGTAGG + Intronic
1153200602 18:2643684-2643706 AAGATCATGCAGGGCCTTGGAGG - Intergenic
1155134869 18:22980599-22980621 CAGGTCATGTAGGATCTTCATGG + Intronic
1155243236 18:23883157-23883179 CAGATCCTGCAGAACCCTGCAGG + Intronic
1155337522 18:24780036-24780058 CAGATCACACAGGACCTTGTAGG - Intergenic
1156048774 18:32907005-32907027 CGGGACATGCAGGGCTTTGCAGG - Intergenic
1156202703 18:34852610-34852632 CAGGTCAGGTAAGACCTTGCAGG - Intronic
1157104824 18:44764149-44764171 CAGGTCATGCAGGACTCCGCAGG - Intronic
1158191266 18:54831397-54831419 CAGGTCTTGGAGGACTTTGAAGG + Intronic
1158543437 18:58376787-58376809 CAGGCCACGCAGGACCTTGTGGG - Intronic
1158903538 18:61988352-61988374 CAGGTCATGTGGGGCCTTGCAGG + Intergenic
1159945375 18:74441065-74441087 CAGCTGATGCAGCACCATGCTGG + Intronic
1160676335 19:393339-393361 CAGGTCATTCAGGGCCTGGTGGG + Intergenic
1160696302 19:486247-486269 CTGGGCTTGTAGGACCTTGCAGG - Intergenic
1160940496 19:1618473-1618495 CAGGTCATGCGGGGCCTTGTGGG - Intronic
1160988438 19:1850924-1850946 CAGGTCATGCAGAACCCTATGGG + Intergenic
1161274924 19:3410570-3410592 CGGGCCATGCAGGGCCTTGTGGG + Intronic
1161277459 19:3426640-3426662 CAGGTTGTGCAGGGCCTTGTGGG - Intronic
1161286468 19:3471056-3471078 CAGGTCATTCAGGGCCTTGTGGG + Intergenic
1161300028 19:3538044-3538066 CAGGGCGTGCAGGGCCTTGTGGG + Intronic
1161301596 19:3545370-3545392 CAGGTCGTGCAGGGCCTGGTGGG - Intronic
1161451769 19:4350299-4350321 CAGGTCATGCAGGGCTCTGTAGG + Intronic
1161482999 19:4519955-4519977 CAGGTTATGCAGGGCCTACCGGG - Intergenic
1161541026 19:4851676-4851698 GAGGTTGTGCAGGACCTTGTGGG + Intronic
1161605645 19:5213344-5213366 CTGGTCATGCAGGATCCTGTGGG - Intronic
1161619195 19:5289533-5289555 CAGGTCGTGCAGGACCTGGTGGG - Intronic
1161621412 19:5299225-5299247 CAGGTCATGCAGGGCCTTGTGGG - Intronic
1161623189 19:5310006-5310028 CAGGTTGTGCAGGCCCTTGTGGG - Intronic
1161634238 19:5377234-5377256 CAGGTCATGCAGGGCCTTGTGGG + Intergenic
1161644489 19:5444680-5444702 TAGGTCATGCAGGGCCTTGTGGG - Intergenic
1161649363 19:5474819-5474841 CAAGTCATGCAGGGCTTTGCGGG + Intergenic
1161650382 19:5480608-5480630 CAGGTCGTGCAGGGCCTGGTAGG + Intergenic
1161741104 19:6021713-6021735 CGGGTCCTGCAGGGCCTTGTGGG + Intronic
1162148624 19:8629428-8629450 CAGGTCATGAAGGGCCTTGTGGG + Intergenic
1162429932 19:10622276-10622298 CAGGTCATGCAAGGCTTTGTGGG + Intronic
1162456542 19:10788421-10788443 CAGGTTGTGCAGGGCCTTGTGGG + Intronic
1162894364 19:13756277-13756299 CAGGTGATGCTGGGCCTTACCGG - Exonic
1164478678 19:28594720-28594742 CAGGTCATGCAGGCTCCTGGAGG - Intergenic
1164669595 19:30064971-30064993 CAGGACACGCAGGCCCTGGCAGG + Intergenic
1165062276 19:33210733-33210755 CCGGCAATGCAGGACCTTCCGGG - Intronic
1165649172 19:37470557-37470579 CAGATTATGCAGGGCCCTGCAGG - Intronic
1165661326 19:37582989-37583011 CAAATCATGTAGGACCTTGTTGG - Intronic
1165759676 19:38313645-38313667 TGGGTCATGCAGGGCCTAGCAGG - Intronic
1166728217 19:45041749-45041771 CAGGCCATGCAGGACCCTAAAGG - Intronic
1167325087 19:48819479-48819501 CAGATCAGGCAGGGCCTTGAAGG - Intronic
925103591 2:1270069-1270091 AAGGTCATGCAAGACCTCTCAGG + Intronic
927002449 2:18812317-18812339 CAGCTCATGCAGGCCATTTCAGG + Intergenic
927238303 2:20898392-20898414 CATATCCTGCAGGGCCTTGCAGG - Intergenic
928129236 2:28637687-28637709 CAGGTGGTGCAGGACGCTGCTGG - Intronic
928331542 2:30361449-30361471 CAGGTCTTCCAGGACCTTCCTGG - Intergenic
928440788 2:31290228-31290250 CAGGTCATGCAGGGCCTTAAAGG - Intergenic
928443929 2:31316348-31316370 CAGAGCATGCAGGCACTTGCAGG - Intergenic
929800225 2:45093381-45093403 CAGGTTGTGGGGGACCTTGCAGG + Intergenic
929920172 2:46166108-46166130 CCAGTCATGCAGGAGCATGCAGG - Intronic
929982254 2:46692464-46692486 CAGATCATGCAGAACTTTGAAGG - Intergenic
930277971 2:49335852-49335874 CAGATCATGCATGGCCATGCAGG + Intergenic
931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG + Intergenic
931339211 2:61382280-61382302 CAGATTATTCAGGACCTTGTAGG - Intronic
932381688 2:71289591-71289613 CAGGTGGTTCAGGACTTTGCAGG + Intronic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
933644723 2:84801386-84801408 CAGCTCATACAGTATCTTGCAGG - Intronic
934845702 2:97660213-97660235 CAGGCCATGCAGCCCCTTGGTGG + Intronic
935832851 2:107018656-107018678 CAGGTCATACAGGACTATGTAGG + Intergenic
936271859 2:111055144-111055166 CTGGTCCTGCAGGACCAGGCAGG + Intronic
936328812 2:111529230-111529252 CATGTCCTCCAGGACCCTGCTGG + Intergenic
937103182 2:119287254-119287276 CAGAGCTTGCTGGACCTTGCTGG + Intergenic
937940791 2:127284321-127284343 CAGGTCTTGTAGGACCTTGTAGG - Intronic
940165326 2:150764466-150764488 CAGGTCATTCAGCACCATGCAGG - Intergenic
940415683 2:153417298-153417320 CAGATGATGTAGGGCCTTGCAGG + Intergenic
940736042 2:157453633-157453655 TAGAACATGCAGGACCTTGAAGG - Intronic
941351504 2:164442835-164442857 AAGCTCTTGCAGGACCTTGTAGG + Intergenic
941354207 2:164468652-164468674 CAGGTCATGCAGCAACTTAGTGG + Intergenic
941721972 2:168821869-168821891 CAGATCATGCAGAGCTTTGCAGG + Intronic
942428134 2:175880757-175880779 TAGATCATGCAGGACCTTCACGG + Intergenic
942616032 2:177793147-177793169 CTAGTCATGCAGGGCCTTTCAGG + Intronic
942664689 2:178304744-178304766 CAGTCCCTGCAGGACCTTGTAGG - Intronic
942741149 2:179179775-179179797 CAGGTCATGGAAGACCATGTAGG - Intronic
942792732 2:179779408-179779430 TTGGTCATGCAGGCCTTTGCAGG + Intronic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944395529 2:199262213-199262235 CAGATCATGTAGGGCCTTGCAGG + Intergenic
944668573 2:201976528-201976550 AAGCTCATGTAGGACCTTGTAGG + Intergenic
946028614 2:216687819-216687841 CTGGTCATGCAGAACTTTGGGGG - Intronic
946096034 2:217274759-217274781 CACGTCATGGAGGGCCTGGCAGG - Intergenic
946413006 2:219524821-219524843 CAGGGCATCAAGCACCTTGCAGG - Intronic
946460688 2:219865894-219865916 TAGATCTTGCAGGACCTTGAAGG - Intergenic
946664819 2:222037485-222037507 CAGGTCATGAATAACTTTGCTGG - Intergenic
947671648 2:231940761-231940783 CGGGTCATGCAGGACCAGGATGG - Intergenic
948202820 2:236142203-236142225 CAGATCACGTAGGACCTTGCAGG - Intergenic
948797344 2:240411822-240411844 CAGGACATGCCGTACCTTGCAGG - Intergenic
948888421 2:240895542-240895564 GAGGACACACAGGACCTTGCTGG + Exonic
1168812665 20:715894-715916 CAGCTTGTGTAGGACCTTGCAGG + Intergenic
1168914286 20:1473736-1473758 CAGCTCATGCAGGGCCCTACAGG + Intronic
1169216355 20:3796700-3796722 CAGACCATGCACGACCTCGCCGG + Exonic
1169477469 20:5945229-5945251 CAGATCATTTATGACCTTGCAGG - Intronic
1171152030 20:22835697-22835719 CAGATCCTGCAGGGCCTTGCAGG + Intergenic
1172041111 20:32046684-32046706 CAGGCCACTCAGGACCTTGCAGG - Intergenic
1172134828 20:32679875-32679897 AAGGTCATGCAGACCCTTCCAGG + Intergenic
1172646781 20:36475131-36475153 AAGGTCAGGCAGGACCCTGGGGG + Intronic
1172807105 20:37619913-37619935 CAGAACATGCAGGACCTCGTAGG + Intergenic
1172985588 20:38986009-38986031 CAGGTCAGGGAGGACCTACCTGG - Intronic
1173029075 20:39337940-39337962 CAGATCATGGAGGACCTTCCAGG - Intergenic
1173338655 20:42134847-42134869 CAGATCATGCAAGACATTGCAGG - Intronic
1173559552 20:43993150-43993172 CGGATCATGCAGGACTTTGCAGG + Intronic
1174006517 20:47415486-47415508 CAGGTCACGGAGGAACTTGTAGG - Intergenic
1174115299 20:48222837-48222859 CAGATCCTGCAGGCCCTTGTGGG + Intergenic
1174117577 20:48237864-48237886 CAGGCCATGGAGGGCCTTGCAGG - Intergenic
1174163935 20:48571283-48571305 CAGGCCATGGAGGGCCTTGCAGG + Intergenic
1174199675 20:48798484-48798506 CAGAGCATGCAGGGCCTTCCAGG - Intronic
1174263112 20:49311743-49311765 CGGGTCATGTAGGCCCTTGTAGG + Intergenic
1174413823 20:50353734-50353756 CAGACCAGGCAGGGCCTTGCGGG + Intergenic
1174466715 20:50723489-50723511 CAGATCATGCAGCCTCTTGCAGG - Intergenic
1174562158 20:51439137-51439159 CAGGTTGTGCAGGGCCTTGAGGG - Intronic
1176167066 20:63679922-63679944 CAGATCATCCAGCACCTGGCAGG + Exonic
1176958184 21:15129999-15130021 TAGATCATGCAGGATCTTGAAGG + Intergenic
1177245038 21:18512267-18512289 CATGTCATGGCTGACCTTGCTGG + Intergenic
1177863100 21:26478499-26478521 CAACTCATGCAGTACCTTGAAGG + Intronic
1178942419 21:36917163-36917185 CAGATCATGTAGGAGCTGGCAGG - Intronic
1179942161 21:44647296-44647318 CAGGCCAGGCGGGAGCTTGCGGG - Exonic
1181786491 22:25231083-25231105 CTGGCCAGGCAGGTCCTTGCAGG + Intronic
1181852573 22:25760807-25760829 ATGGTCAGGCAGGACCCTGCAGG - Intronic
1181919318 22:26307938-26307960 CAGCTCATGCAGATCTTTGCAGG - Intronic
1182001937 22:26926830-26926852 CAGATTGTGCAGGATCTTGCAGG + Intergenic
1182007179 22:26970518-26970540 CAGGTCATTAAGAACCTTGTGGG + Intergenic
1182271259 22:29155175-29155197 CAGAACTTGCAGGACTTTGCTGG - Intronic
1182642481 22:31779522-31779544 CAGTTCATGCAGGGCCTTCAAGG + Intronic
1182805903 22:33070162-33070184 CAGGAATTGCAGGTCCTTGCAGG - Intergenic
1183237503 22:36630568-36630590 GAGGTCATGAAGGACCCTGTTGG + Intronic
1183244335 22:36682186-36682208 CAGGGCTTGAAGGCCCTTGCAGG + Intronic
1183380278 22:37487230-37487252 CAGCTCACGCAGGGCCTTGTGGG - Intergenic
1183589100 22:38769611-38769633 CAGGCCATGCTGGGCCTCGCAGG + Intronic
1184939329 22:47749624-47749646 CAGGTCAGACAGGACATTCCAGG - Intergenic
1185351286 22:50340811-50340833 CAGGTCATGTAGGGCCCTGTGGG + Intergenic
950201657 3:11048682-11048704 CAGATCAGACAGGGCCTTGCAGG - Intergenic
950358384 3:12430982-12431004 CAGGTCATGAAGGACATTAAAGG + Intronic
951277798 3:20710949-20710971 CAGATCATGCAAGGCCTTGTAGG + Intergenic
952279339 3:31908203-31908225 CAGATCACACAGAACCTTGCAGG + Intronic
953086329 3:39671643-39671665 GGAGTCATGCAGGACCTTGTGGG - Intergenic
953512699 3:43558886-43558908 CAGATCACGCAGAACCCTGCAGG + Intronic
954397539 3:50300879-50300901 CTGGTCAGCCAGGACTTTGCAGG + Intronic
954568399 3:51619538-51619560 CAGGTCATCAAGGACATTGTTGG - Intronic
955243863 3:57205463-57205485 CAGGTCATGTAGGGTCCTGCAGG - Intronic
955365595 3:58307212-58307234 CAGGTGAGGCAGAGCCTTGCAGG + Intronic
955552711 3:60101251-60101273 CACATTATGCAGGGCCTTGCAGG - Intronic
955891213 3:63652092-63652114 CAGGCCATGCAGGAACTTTTAGG - Intergenic
956541851 3:70348764-70348786 CAGGTCACAGAGGACTTTGCAGG + Intergenic
957814905 3:85284759-85284781 CAGGTTTTGTAGGACCTTGTAGG + Intronic
958822506 3:98991728-98991750 CAGGTCAGGCAGGAGCTTCAAGG - Intergenic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
960406160 3:117262409-117262431 CAGGTCATGGTGGGCCTTGTAGG - Intergenic
960486954 3:118264949-118264971 CAGATCATGTAGGGCCTTTCAGG + Intergenic
962072713 3:132048360-132048382 TGGATCATGCAGGACCTTGCAGG - Intronic
962230325 3:133659980-133660002 GAGGTCATGTAGGGCCTTGTGGG - Intronic
962435613 3:135363841-135363863 CAGATCTTGCAAGTCCTTGCTGG + Intergenic
964373950 3:156031269-156031291 CAGATCATGCAGGGCCCTGTTGG + Intergenic
964466227 3:156996442-156996464 CACATCATGCAGGGCCTTGCAGG + Intronic
964625773 3:158758016-158758038 CAGGTAATGCAGAACCTAGAGGG - Intronic
964931140 3:162024898-162024920 CAGGTCATGGAGGGGCTTGCTGG - Intergenic
965676768 3:171205786-171205808 CAGATCATTCAGGGCTTTGCAGG - Intronic
966160495 3:176962491-176962513 CAGGTCATGCAGGACCTTGCAGG + Intergenic
967702578 3:192610704-192610726 CAGATCTTGCAGGGCCTTGCAGG - Intronic
967811385 3:193763999-193764021 CAAGTCATGTAGGACCTGGTGGG - Intergenic
967866413 3:194193680-194193702 CAGGTCATGAAGGACCTAGACGG + Intergenic
969058344 4:4415747-4415769 CAGGTCTTGCAGGACTCTGCTGG + Intronic
969312902 4:6364381-6364403 CAGCTCCTGCAGGGCCTTGGAGG + Intronic
969849891 4:9947909-9947931 CACGCCATGCAGGACCACGCAGG - Intronic
971262593 4:25070586-25070608 TAGGTGATGCAGGCCTTTGCAGG + Intergenic
971459562 4:26880101-26880123 CAGATCATGCAGCAATTTGCAGG - Intronic
974010092 4:56598733-56598755 CAGATCATGTAGGGCCTTGTAGG + Intronic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
976145107 4:82034643-82034665 CTGGGCATGCAGGAGCCTGCTGG - Intronic
976274591 4:83263341-83263363 CAAGTCATGGAGGGCCTGGCAGG + Intronic
978103051 4:104866815-104866837 CAGATCATACAGGTCCTTGTAGG - Intergenic
979960134 4:127009064-127009086 CAGGTCATGCATGGCCGTGTTGG + Intergenic
980383232 4:132054511-132054533 CAGGTCTTGCAGCAACTTCCAGG + Intergenic
981452974 4:144920690-144920712 GAGGCCATGCAGGACATTGGAGG - Intergenic
981702296 4:147619934-147619956 CAGATCATGTTGGACCTTGATGG - Intronic
981721695 4:147808417-147808439 CAGATCATGCAGGGTCTTTCAGG + Intronic
982306848 4:153941539-153941561 CTGGTCATACAGGACTTTGTAGG - Intergenic
983430409 4:167642887-167642909 CAGGTCATGCAGAAACTTCTAGG - Intergenic
983971080 4:173875014-173875036 CAGGTCATGTCAGACCTTACTGG + Intergenic
984823268 4:183903187-183903209 CAGATCATGCCGGAACTTGCAGG - Intronic
985031352 4:185793935-185793957 CAGGCCAGGCAGGAGCCTGCGGG - Intronic
985668745 5:1195666-1195688 CAGGGCAGGTAGGACCCTGCTGG + Intergenic
985789350 5:1916839-1916861 CACGGCATGGAGGAACTTGCTGG - Intergenic
986314409 5:6576652-6576674 CAGGGCATGCTGGCCCTTGAAGG - Intergenic
988815995 5:34835745-34835767 CAGGTCATGGAGGGCCTTATAGG - Intergenic
989807195 5:45624110-45624132 CAGATAATGCAGGACCTTATGGG + Intronic
990887189 5:60607940-60607962 CAGATCATGCAGAACTTTGTAGG + Intronic
990911267 5:60854780-60854802 CAGGTCAAGAAGGGCCTTGTAGG - Intergenic
992124070 5:73624014-73624036 TAGGTCACTCAGGACATTGCTGG - Intergenic
992189485 5:74277075-74277097 CAGGACATGCAGAATCCTGCAGG + Intergenic
993712061 5:91234986-91235008 CCAGTCATTCAGGACCTTGCAGG + Intergenic
993714298 5:91259736-91259758 CAGCTCATGCAGGGCTTTGTAGG - Intergenic
993946214 5:94119901-94119923 CAGATCATGCAGGACTTTATAGG - Intergenic
994139524 5:96326296-96326318 CTTGTCATGGAGGACCTTGTAGG - Intergenic
994873654 5:105385993-105386015 CAGTTAATGCAGCACTTTGCAGG + Intergenic
994981527 5:106880882-106880904 CAGGTTATGCAATACCTTGCAGG - Intergenic
995132232 5:108642735-108642757 CAGATCATGCAGAGCCTTCCTGG - Intergenic
995313426 5:110739204-110739226 CCGGTGCTGAAGGACCTTGCAGG - Exonic
995523899 5:113035531-113035553 CAGGTCAAGCAGGGCCTTAGAGG - Intronic
995624190 5:114058718-114058740 CAGATCCTGCAGGGCTTTGCAGG + Intergenic
995864849 5:116680050-116680072 CAGGTCAGGCAAGACCTTGCAGG - Intergenic
996550671 5:124726758-124726780 CAGGTCATGCAGGGCCTTGTAGG - Intronic
996769855 5:127074204-127074226 CTGGCCATGCAGGGCCTTTCAGG + Intergenic
997448797 5:133965038-133965060 CAGATCATGTAGGATCTTGAAGG - Intronic
997705037 5:135942506-135942528 CAGACCTTGCAGGACCTTGTGGG - Intronic
997745695 5:136298396-136298418 CAGGTCATGCAGCACTTTGTAGG + Intronic
998348998 5:141488732-141488754 GAAGTCATGCAGGAAGTTGCTGG + Intronic
998375336 5:141686936-141686958 CAGGCCATGCAGGCCCTTGGAGG + Intergenic
998692627 5:144604021-144604043 CAGATCAAGTAGGACCTTGCAGG + Intergenic
998885694 5:146691681-146691703 CAGGTCATGAAGGGCCTTTTAGG - Intronic
999411270 5:151351936-151351958 TGGATCATGCAGGACCTTGTGGG - Intergenic
999559162 5:152781166-152781188 CAGATCATGTAGGGCCTTGCAGG - Intergenic
1000112076 5:158117786-158117808 CAAGTCATACAGGACATTGTAGG + Intergenic
1001077458 5:168641114-168641136 CAGGTCATGCCCGGCCATGCCGG - Intergenic
1001238671 5:170051266-170051288 CAGATCATGGATGGCCTTGCAGG - Intronic
1001264928 5:170267355-170267377 CAGCTCAGGCAGGGCCTCGCAGG - Intronic
1001313267 5:170626057-170626079 CAGACCCTGCAGGGCCTTGCAGG + Intronic
1001566484 5:172702750-172702772 CAGGTCAGGCAAGGCCCTGCAGG - Intergenic
1001697096 5:173679017-173679039 CAGGTCATGCAGCACTCTGCAGG + Intergenic
1001955404 5:175845306-175845328 CAGGTGATGTGGGGCCTTGCGGG - Intronic
1002318112 5:178357428-178357450 CCGGGCATGCAGGCTCTTGCTGG + Intronic
1002664203 5:180810629-180810651 CAGGTCAAGCAGGCCGTCGCTGG - Intronic
1005362553 6:25044514-25044536 CAGGTCATGTGGGACATTCCTGG + Intergenic
1005818232 6:29574785-29574807 CAGGGCATTCAGGAGATTGCTGG + Intronic
1005819869 6:29588832-29588854 CAGGGCATTCAGGAGATTGCTGG + Exonic
1006302922 6:33203635-33203657 CAGGTGGTGCAGGTCCTGGCTGG + Exonic
1006377080 6:33677586-33677608 CAGGTCCAGCATGACCTTGTGGG - Exonic
1006710472 6:36064862-36064884 CAACTCATGTAGGACCTTTCAGG - Intronic
1007219930 6:40270389-40270411 GAGATCAGGCAGGGCCTTGCAGG - Intergenic
1007528078 6:42514341-42514363 CAAATCATGCAGGGGCTTGCAGG + Intergenic
1008364974 6:50667383-50667405 CAGGTCATGGAAGACATTCCAGG + Intergenic
1008626901 6:53325998-53326020 CAGGTTATTAAGGACTTTGCAGG + Intronic
1011801365 6:91019740-91019762 CAGGTCCTGCAGGACTTTGTGGG - Intergenic
1012188126 6:96247298-96247320 CAGATCATGTAGGACTTTGTAGG + Intergenic
1012969422 6:105711714-105711736 CAGAGCATGTAAGACCTTGCAGG - Intergenic
1013852101 6:114528451-114528473 CAGGTCATGCAGAGCTTTGTGGG - Intergenic
1014805788 6:125827849-125827871 CAGATCATGCAGGGCCTTCTTGG + Intronic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1015374277 6:132492084-132492106 CAGGTCAGGTAGGGCCTTGCAGG - Intronic
1016307986 6:142703261-142703283 CATGTCATGCACCACCCTGCAGG - Intergenic
1016329351 6:142940578-142940600 AAGGTAATGCAGGGCCTTGAAGG - Intronic
1016603289 6:145888578-145888600 CAGGTCACACAGGGCCTTCCAGG + Intronic
1016791096 6:148067723-148067745 CAGGCCATCCTGCACCTTGCAGG + Intergenic
1019162701 6:170079862-170079884 CTGGTGATGAAGGACCTTGGTGG - Intergenic
1019309279 7:352403-352425 CAGGCCATGGTGGACCTTGGTGG - Intergenic
1019375364 7:688502-688524 CAGATCACGCAGGGCCTTGCTGG - Intronic
1019618486 7:1977990-1978012 CGTGGCATTCAGGACCTTGCAGG + Intronic
1019856741 7:3616367-3616389 CAGGTTGTGCAGGGCCTTGCAGG - Intronic
1019936653 7:4262545-4262567 CAGGCCATTCAGTACCTGGCCGG + Intronic
1020397158 7:7729273-7729295 CTGGTCATGCTAGACCTTGTAGG + Intronic
1020524060 7:9235835-9235857 CAGATCATGCAGCAACTTGTTGG + Intergenic
1021874190 7:25033098-25033120 CAGGTCATGCAGGGCCTGATGGG + Intergenic
1022477005 7:30717577-30717599 AAGGTCATGCAGGGCCCTGTGGG + Intronic
1022491826 7:30826589-30826611 CAGATCATGGAGAGCCTTGCAGG + Intronic
1022518499 7:30990351-30990373 CAGGACACCCAGGGCCTTGCAGG - Intronic
1022606271 7:31817440-31817462 CAGATCATGCAGGGCTTTGGAGG + Intronic
1022656950 7:32328446-32328468 CAGATCATGCAGGGACTTGGAGG - Intergenic
1023066687 7:36384934-36384956 CAGATCATGCATGGCCTTGTAGG + Intronic
1024595878 7:50937012-50937034 CATGACATGCAGGACCCTGTGGG - Intergenic
1025256714 7:57388837-57388859 CAGACCAGGCAGGGCCTTGCAGG - Intergenic
1026375526 7:69746721-69746743 CAGGTCATATAGGACCTTGTAGG + Intronic
1026823820 7:73568588-73568610 CAGGTTACACAGGACCTTGCAGG + Intergenic
1029211079 7:98908868-98908890 CAGGTTCAGCAGGAGCTTGCAGG - Exonic
1029360975 7:100088604-100088626 CAGATCAGGCAGGGCCTTGCAGG + Intergenic
1029457120 7:100676945-100676967 CTGGACAGGCAGGACCATGCTGG + Intronic
1030115692 7:106060626-106060648 CCGCTCACGCAGGATCTTGCTGG + Intergenic
1030432507 7:109468718-109468740 CATGTCATGATGGACCTGGCAGG + Intergenic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1030908790 7:115220571-115220593 CAGGTCAGGGAGCACTTTGCAGG - Intergenic
1031509095 7:122626141-122626163 CAGATCACACAGGACTTTGCAGG + Intronic
1031560477 7:123232172-123232194 CAGATTATCCAGGACCTTGTAGG - Intergenic
1032686089 7:134235208-134235230 AAGATCATGGAGGACTTTGCAGG - Intronic
1033133732 7:138767767-138767789 CAGATCATGGAGGACCCTGGGGG - Intronic
1035202006 7:157273661-157273683 CAGGCCAGGCAGGCACTTGCTGG - Intergenic
1037462960 8:19131548-19131570 CAGGTCAGGCAGGGCCTTGTTGG + Intergenic
1037754840 8:21704024-21704046 CTTGTCATGCAGGGCCTTGCAGG - Intronic
1038464031 8:27743407-27743429 CAGTCCATGCAGGCCCTTGCTGG - Intronic
1039050262 8:33486127-33486149 GAGGTCATGCAGAATCTTGTAGG + Intronic
1040471202 8:47737384-47737406 CAGCTCACGCGGGACCTGGCCGG - Exonic
1042000136 8:64112838-64112860 CAGGTCACGTAGGACTGTGCAGG + Intergenic
1042096903 8:65226144-65226166 CAGATCACGCAGGGCCTTGTAGG + Intergenic
1042150798 8:65781368-65781390 CAGATCATGCTGGACCTTTGTGG + Intronic
1043543617 8:81290987-81291009 CAGGTTATACACGACCTGGCAGG - Intergenic
1044934473 8:97279448-97279470 CAGATCATACAGGGCCTTGCAGG - Intergenic
1045025839 8:98085724-98085746 CAGGTCATGGAGGGCCCTGCAGG - Intronic
1045100085 8:98835478-98835500 CATGTGTTGCAGGACCTGGCTGG - Intronic
1045312759 8:101017407-101017429 CACTTCAGGCAGGACCATGCTGG - Intergenic
1045624730 8:104030495-104030517 CAGGTCATGTAGGGCCTTATAGG - Intronic
1045663092 8:104458270-104458292 CAGGTCATGCAGGACCTTATGGG - Intronic
1045977382 8:108145074-108145096 CAGATCATGCAGGACCCTCTTGG + Intergenic
1046212683 8:111099063-111099085 AAGATCCTGCATGACCTTGCCGG - Intergenic
1046770998 8:118116409-118116431 AAAATCCTGCAGGACCTTGCAGG - Intergenic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1047512727 8:125528076-125528098 CAGGTCATGCTGGACATGGCAGG - Intergenic
1048334815 8:133494639-133494661 CAGTTCATGTAGGATCTTGCAGG - Intronic
1048624912 8:136174523-136174545 TAGGTCATCCAGGACTTTGCAGG + Intergenic
1048704083 8:137130827-137130849 CAGGTCATGAAGGGCATTGTAGG + Intergenic
1049620146 8:143594481-143594503 CAGGCCGTGCAGCACCTTGGTGG - Intronic
1050412931 9:5385061-5385083 CAGATCATGTGGGACCTTCCAGG + Intronic
1051564829 9:18485759-18485781 CAGATCATGCAGGGTGTTGCAGG + Intronic
1051650650 9:19321017-19321039 CAGGTTATGCAGGATCTTTTAGG + Intronic
1053122694 9:35558468-35558490 GAGGCCATGCAGGACCTTGGTGG - Exonic
1054861835 9:69961793-69961815 CAGATCATGATGGATCTTGCAGG + Intergenic
1055359027 9:75469137-75469159 AAGCTCATCCAGGAACTTGCAGG - Intergenic
1056235405 9:84588922-84588944 CACGTCAAGGAGGACCTTCCTGG + Intergenic
1056275877 9:84993676-84993698 CAGGACATGCAGGATGTCGCAGG - Intronic
1056289274 9:85126387-85126409 CAGGTCATGCAGGATCTTCTGGG + Intergenic
1056651125 9:88463989-88464011 CAGGTCATGCAGCAATATGCAGG - Intronic
1056736641 9:89215429-89215451 CTGTTTATGCAGGACCTTGTGGG - Intergenic
1056986051 9:91364417-91364439 GAGGGCATGCAGGGCCTTCCTGG - Intergenic
1058007659 9:99935958-99935980 CAGATCATGGAGAGCCTTGCAGG + Intronic
1058126282 9:101198895-101198917 CAAATCATGCAGTAACTTGCAGG + Intronic
1058358447 9:104110633-104110655 CACATCATGAAGCACCTTGCAGG - Intronic
1058779341 9:108317753-108317775 CTGGTGAAGCAGGTCCTTGCTGG - Intergenic
1059348245 9:113646795-113646817 CAGATCACGCAGGGCCTTGAAGG - Intergenic
1059385689 9:113962507-113962529 CAGCTCATGCAGAGCCTTGCAGG - Intronic
1059604029 9:115813461-115813483 CAGGTCATGAAGGACCATGTGGG - Intergenic
1059866794 9:118523285-118523307 CAGGTCAAGTAGGACCTGGTAGG - Intergenic
1060059816 9:120449075-120449097 TAGGTCCTGCAGGACTTTGTAGG - Intronic
1060463655 9:123882931-123882953 CAGATCATGTAGGACTTTGTAGG - Intronic
1062242520 9:135547990-135548012 CAGGACATGCAGGCCCCAGCGGG - Intronic
1186722695 X:12322577-12322599 CAGGTCATTCAGGGCCTTGTAGG + Intronic
1187248494 X:17575270-17575292 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1187927560 X:24263896-24263918 CAGAGCATGTGGGACCTTGCAGG - Intergenic
1188232150 X:27677663-27677685 CAGGTCATGCAGGACCTTGCAGG + Intronic
1188458027 X:30389444-30389466 AAGATCATGCAAGGCCTTGCAGG + Intergenic
1189145963 X:38655055-38655077 CAGGTCAAGTAGGACCTTGCAGG + Intronic
1189537986 X:41956206-41956228 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1190853077 X:54265553-54265575 CAGATCCTGTAGGACTTTGCAGG + Intronic
1192139989 X:68638921-68638943 CAGGTCAGCCAGAACCTGGCAGG - Intergenic
1192273832 X:69610180-69610202 CAGATCATGTAGGGCCTTGTAGG + Intergenic
1192340777 X:70261663-70261685 CAGATCATGAAGGTCCTTGGAGG + Intergenic
1195408582 X:104544271-104544293 CAGATCATAAAGGACCTTGTGGG - Intergenic
1196004040 X:110816648-110816670 CAGATCATGCTAGGCCTTGCAGG + Intergenic
1196799930 X:119533300-119533322 CAGGCCATGTAGGGCCTTGCAGG - Intergenic
1197170868 X:123432514-123432536 CAGGTTATACATGACCTGGCTGG - Intronic
1197741707 X:129900057-129900079 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1198320441 X:135514398-135514420 CAGATCATGCAGGGCCTAGTTGG - Intergenic
1198448235 X:136739922-136739944 CAGATCCTGGAGGACCTTGGAGG + Intronic
1198710430 X:139495661-139495683 CAGATCATGGAGGTCCTTGTAGG - Intergenic
1198802002 X:140457672-140457694 CAGGTCATGCAGGGCCCTGCAGG - Intergenic
1199429832 X:147746265-147746287 CAGGTCATGGAGGGCCCTGCTGG - Intergenic
1200303029 X:154997727-154997749 CATAACATGTAGGACCTTGCAGG + Intronic
1201935532 Y:19407197-19407219 CAGGGGCTGCAGGTCCTTGCTGG + Intergenic