ID: 1188243322

View in Genome Browser
Species Human (GRCh38)
Location X:27813953-27813975
Sequence CTTGATTCTCAGAAGGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188243322_1188243327 17 Left 1188243322 X:27813953-27813975 CCAGGGACCTTCTGAGAATCAAG 0: 1
1: 0
2: 0
3: 15
4: 195
Right 1188243327 X:27813993-27814015 GTGCTCAAAAGCCATTGTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188243322 Original CRISPR CTTGATTCTCAGAAGGTCCC TGG (reversed) Intronic
900312116 1:2038702-2038724 GTGGCTCCTCAGAAGGTCCCAGG - Intergenic
902155134 1:14479001-14479023 CATGCTTCCCAGAAGCTCCCAGG - Intergenic
902275581 1:15337151-15337173 CTTCATTCACACAAGGACCCTGG + Intronic
902959453 1:19952330-19952352 CTGCATTCTCACAAGTTCCCAGG - Intergenic
904400790 1:30255017-30255039 CTTGAGTCTCACAGGGTCACAGG + Intergenic
907642312 1:56203416-56203438 TTTGATTCTCATAAGATACCTGG + Intergenic
908357264 1:63334928-63334950 CTTGATTCTCAGAACAAACCTGG - Intergenic
909332190 1:74426726-74426748 ATAGGTGCTCAGAAGGTCCCTGG + Intronic
911051425 1:93674838-93674860 CCTGCTGCTCAGAAGGTCCATGG + Exonic
911583788 1:99667010-99667032 CTTTCTTCTCAGAATCTCCCTGG - Intronic
912489715 1:110055424-110055446 CCTGAGGCTCAGCAGGTCCCAGG - Intronic
913262243 1:117009950-117009972 AATGCTGCTCAGAAGGTCCCTGG - Exonic
915660129 1:157398777-157398799 CTGGATTTTCAAAATGTCCCTGG + Intergenic
917747935 1:178028534-178028556 CTTGATCCTCACAAAGCCCCTGG - Intergenic
918798105 1:188931932-188931954 CTTTATTGTCAGAAGTTTCCAGG + Intergenic
919282887 1:195514701-195514723 AGTTATTCTCTGAAGGTCCCAGG - Intergenic
919927651 1:202200632-202200654 CACGATTCTCAGAAGCCCCCAGG - Intronic
921251887 1:213305872-213305894 CTAGATTCTCAGAAGTTACAGGG - Intergenic
922047639 1:221962094-221962116 TATGTTTCTCAGAAGGTCTCAGG + Intergenic
924100451 1:240597600-240597622 CTTGCCTCTCAGCAGCTCCCAGG - Intronic
924563166 1:245173785-245173807 CCCTATTCTCAGAAGGTCCGTGG - Intronic
1063345238 10:5305936-5305958 ATTGTTTCTCACAAGGACCCCGG - Intergenic
1064091980 10:12393549-12393571 CTTAATTCGCTGAATGTCCCTGG - Intronic
1065341539 10:24711308-24711330 TTTGATTTTCAAAAGTTCCCAGG + Intronic
1065359016 10:24871686-24871708 CTTCCTTTTCAGAAGGTGCCTGG + Intronic
1067762947 10:49063477-49063499 GTAGCTTGTCAGAAGGTCCCAGG + Intronic
1068367357 10:56068313-56068335 CTGGGTTTTCAGAAGGGCCCTGG + Intergenic
1072152849 10:92696897-92696919 TTAGATTCTAAGAAGGCCCCTGG + Intergenic
1074178508 10:111034579-111034601 CATGATTCTCAGAAATTCTCTGG + Intergenic
1074288752 10:112122401-112122423 GTTGATTCTCAGGAGGACCAGGG + Intergenic
1076243533 10:128928321-128928343 CTTGGTTCTCAGAAAGTGCGGGG + Intergenic
1077453577 11:2664955-2664977 CTTGATTACGGGAAGGTCCCTGG + Intronic
1078846513 11:15123663-15123685 GATGATTCTAAGAAGGTCCCTGG + Intronic
1081136819 11:39449615-39449637 CATGAGTCTCAGAAGGGGCCAGG - Intergenic
1084273996 11:68042718-68042740 CTGGATGCGCAGCAGGTCCCGGG - Exonic
1084836848 11:71808180-71808202 CTTGACTCTCAGAAGGACCAAGG + Intergenic
1084969493 11:72762877-72762899 CCTGCTACTCAAAAGGTCCCTGG + Intronic
1088216226 11:107512785-107512807 CTTTATTCTCAGAAGGGCTGAGG - Intronic
1090397538 11:126429121-126429143 CTCCATTCCCAGAAGGTCCTGGG - Intronic
1092402386 12:8187924-8187946 CTTGACTCTCAGAAGGACCAAGG - Intronic
1093588733 12:20873437-20873459 CTTTATTCTCTGTAGTTCCCAGG + Intronic
1097015849 12:55986743-55986765 CTTAGCTCTGAGAAGGTCCCAGG - Intronic
1101099612 12:101378906-101378928 CTTGCTTCTTAGAAGCTCACAGG - Intronic
1102046421 12:109832824-109832846 CTGGACTCTCAGGACGTCCCGGG - Intronic
1102900608 12:116633633-116633655 CTGCACTCTCAGAAGGACCCTGG - Intergenic
1103212646 12:119178262-119178284 CTTGATTCCCAGTAGGTCATGGG - Intergenic
1103603865 12:122072292-122072314 CTGGAATCCCAGAAAGTCCCAGG + Intergenic
1104094155 12:125541287-125541309 CTTGAGTTTCAGAAGGAGCCAGG + Intronic
1105269803 13:18861867-18861889 GTTAATTCTAATAAGGTCCCAGG - Intergenic
1105608358 13:21945857-21945879 CTTGATCCTCATGAGGTCCTGGG - Intergenic
1108510567 13:51152017-51152039 CTTCATTCTAACAAGATCCCAGG + Intergenic
1111295445 13:86271680-86271702 CTTCATTCTCATAAGAACCCAGG + Intergenic
1113077433 13:106480894-106480916 CAAGAATCTCAGAAGGCCCCAGG + Intergenic
1113518566 13:110921600-110921622 CTTGAGTCACATAAGGTACCAGG - Intergenic
1114383276 14:22231448-22231470 TTGGCTTCTCAGAAGGCCCCAGG + Intergenic
1114656241 14:24317215-24317237 CTGTTTTCTCAGAAGGTCCCGGG - Exonic
1119323043 14:73742763-73742785 CTTTCTTCTCTGAGGGTCCCAGG - Intronic
1119532675 14:75373997-75374019 CTTGATTTTGAAAAGGTCCAGGG - Intergenic
1121489367 14:94346784-94346806 CTTCATTTTCATAAGATCCCAGG - Intergenic
1121557455 14:94849176-94849198 CGTGATGCTCCGAAGTTCCCTGG - Intergenic
1121624314 14:95373348-95373370 ATAGACTCTCAGAGGGTCCCTGG - Intergenic
1122423392 14:101591187-101591209 CTGCAGTCTCTGAAGGTCCCGGG - Intergenic
1125034396 15:35107075-35107097 CATGAATCTCAGATGGTCCATGG + Intergenic
1132143892 15:99415448-99415470 CCAGATTCTCAGCAGATCCCTGG - Intergenic
1132397117 15:101482209-101482231 CTGGTTTGTCAGAAGGTACCTGG + Intronic
1134760394 16:16709505-16709527 CTACATTTTCACAAGGTCCCTGG + Intergenic
1134985677 16:18649700-18649722 CTACATTTTCACAAGGTCCCTGG - Intergenic
1136046211 16:27617317-27617339 CTTCATTCTCAGGCGGTTCCAGG + Intronic
1138695932 16:58813518-58813540 ATGGGTTCTCAGAAGTTCCCTGG + Intergenic
1139125851 16:64076245-64076267 CTAGATTCTCAGAAGACCCTTGG - Intergenic
1139343485 16:66287161-66287183 CTTGATTCCCTGATGGTTCCCGG - Intergenic
1143881226 17:10031521-10031543 CTTGATTCTCAGATGCTGCAAGG - Intronic
1144675390 17:17158480-17158502 CTTGCTTCTCAGTAGGCCTCGGG - Exonic
1145932732 17:28697678-28697700 CTTGTGATTCAGAAGGTCCCGGG - Exonic
1147373179 17:40007962-40007984 CTTGCTTCTCAGGAGGCCTCAGG + Intergenic
1148132922 17:45273248-45273270 GTTGACTCTCCGTAGGTCCCAGG - Intronic
1150819144 17:68421003-68421025 CCGGATTCTCACAAGATCCCAGG - Exonic
1151343829 17:73489329-73489351 CTTCATTCCCTTAAGGTCCCTGG - Intronic
1152149668 17:78591087-78591109 CTTAATTCTCAAAGCGTCCCAGG - Intergenic
1153026424 18:676961-676983 CTTATTTCTCAGAACGCCCCAGG - Intronic
1153687013 18:7556554-7556576 TTTAAATCTCAGAAGTTCCCTGG + Intergenic
1154418243 18:14198110-14198132 GTTAATTCTAATAAGGTCCCAGG + Intergenic
1155802650 18:30128393-30128415 TTTGATTCTCAAAATGTCCCAGG + Intergenic
1158502229 18:58012973-58012995 CTTTATTTTCACAAGATCCCTGG + Intergenic
1159939485 18:74395913-74395935 CTTGATGCTGGGAAGGTCACTGG - Intergenic
1160716670 19:579881-579903 CTTGCTCCTCACTAGGTCCCGGG + Intronic
1161500404 19:4611423-4611445 CCTGAATCCCAGAAGGTCTCAGG - Intergenic
1167529756 19:50007945-50007967 CCTGACTCATAGAAGGTCCCAGG - Intronic
926572583 2:14545556-14545578 CTTGAATTTCAGAAGGGCCTAGG - Intergenic
933671422 2:85011164-85011186 CTTGATGCTCAAATTGTCCCAGG + Intronic
933969377 2:87457819-87457841 CTTGTTTCAGAGAAGGTGCCGGG + Intergenic
934499020 2:94839156-94839178 GTTAATTCTAATAAGGTCCCAGG - Intergenic
934789381 2:97045851-97045873 CTTGTTTCTTAGAATTTCCCAGG - Intergenic
936324410 2:111492675-111492697 CTTGTTTCAGAGAAGGTGCCGGG - Intergenic
938109797 2:128556278-128556300 CATCATTGTCAGCAGGTCCCAGG - Intergenic
938701375 2:133883164-133883186 GTTGCTTCTCAGAGGGTCCAAGG - Intergenic
939360308 2:141163047-141163069 CTTTATGCTCAGAAAGTTCCAGG + Intronic
940311428 2:152282982-152283004 TAAGATTCTCAGAAGGTCCTGGG - Intergenic
941758863 2:169218807-169218829 CTTGATACTCAGAATGACCTAGG + Intronic
941802549 2:169676412-169676434 CTTGATTTTAAAAACGTCCCTGG - Intronic
942420950 2:175807168-175807190 CTTGTTTATCAGATGGTGCCTGG + Intergenic
944667867 2:201971995-201972017 CTGGATCCTGGGAAGGTCCCAGG - Intergenic
945891740 2:215436848-215436870 CTTCATTCTCTGAACTTCCCCGG - Intergenic
947158086 2:227183927-227183949 CTTGATTCTCACAACAGCCCTGG + Intronic
947205289 2:227655445-227655467 CTTCAGTCTCAGAAGGTATCAGG + Intergenic
947350600 2:229240277-229240299 CTTTATTCACAGAATGTCTCAGG - Intronic
1169499030 20:6141505-6141527 CTGCATTCTAAGAAGGTCCCAGG + Intergenic
1169870478 20:10243142-10243164 CTGGATTTTTAGAAGATCCCAGG - Intronic
1170462570 20:16591002-16591024 CCTGATGCTTAGAAAGTCCCTGG - Intergenic
1170747412 20:19112864-19112886 CTTGAATCTCAGTAGGCTCCTGG + Intergenic
1171890261 20:30705877-30705899 GTTAATTCTAATAAGGTCCCAGG - Intergenic
1173409173 20:42794380-42794402 CTTGTTTCTCACAAGCTCCCAGG - Intronic
1173900952 20:46588446-46588468 CTTGATTTTCCGTAGGACCCTGG - Intronic
1174207674 20:48852647-48852669 CTTGCTACTCAGAATGTTCCAGG - Intergenic
1174782162 20:53399779-53399801 CCTGGCTGTCAGAAGGTCCCAGG + Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1176516628 21:7789198-7789220 CTTGACTCTCAGGGGGTCTCTGG + Intergenic
1176855057 21:13961163-13961185 GTTAATTCTAATAAGGTCCCAGG - Intergenic
1177295057 21:19162955-19162977 CTTGTATCTCAGTAGGTCACAGG + Intergenic
1178650656 21:34419210-34419232 CTTGACTCTCAGGGGGTCTCTGG + Exonic
1179494023 21:41760425-41760447 CTTGATTCTCCATAGCTCCCTGG - Intronic
1181543563 22:23587621-23587643 GTTGGTTCTCAGATTGTCCCTGG - Intergenic
1181709568 22:24673863-24673885 CTGGATCCTCACATGGTCCCAGG - Intergenic
1183571620 22:38657255-38657277 CTTGATCCTCACAACGACCCTGG - Intronic
1185114193 22:48922056-48922078 CTTAATTCTCAGACGGTGCAAGG - Intergenic
950021656 3:9792219-9792241 CTTAATCCTCAGAACATCCCAGG - Exonic
950309100 3:11940260-11940282 CTGACTTCTCACAAGGTCCCTGG - Intergenic
953626961 3:44579489-44579511 CTTGCTTCTCAGTAGGCCTCGGG + Intronic
955575020 3:60351704-60351726 CTAGATTTTCACAAGGCCCCAGG - Intronic
955907577 3:63823699-63823721 CTTCTCACTCAGAAGGTCCCAGG - Intronic
955960037 3:64331098-64331120 GGTGATTCTCAGAGTGTCCCTGG - Intronic
956603419 3:71047763-71047785 CTTTAGTCTCAGAAACTCCCAGG + Intronic
957195755 3:77065200-77065222 ATTAATTCTCAGAAGCTCCCTGG + Intronic
960718630 3:120603464-120603486 AGGGCTTCTCAGAAGGTCCCAGG - Intergenic
961554356 3:127688099-127688121 CCTGCTTCCCAGAGGGTCCCTGG - Intergenic
962743188 3:138378153-138378175 CCTGGTTCTCTGAAGGACCCTGG - Intronic
969702783 4:8776886-8776908 CTCGGTACTCAGAAGGTACCTGG - Intergenic
969778247 4:9375675-9375697 CTTGGCTCTCAGAAGGACCAAGG + Intergenic
969789657 4:9483801-9483823 CTGGATCCTCTGAAAGTCCCAGG - Intergenic
970215032 4:13750015-13750037 TTTGGTTCTAAGAAGGACCCTGG + Intergenic
970583582 4:17494694-17494716 CATGACTCTCAGCAGGTCACTGG + Intronic
986010979 5:3715045-3715067 CTCCATTTTTAGAAGGTCCCTGG - Intergenic
987283307 5:16432415-16432437 CTTGCATCTCAAAATGTCCCAGG - Intergenic
991706878 5:69367196-69367218 TTTTATTCTCAGCAGTTCCCCGG - Intronic
993428754 5:87803972-87803994 CTTTATTCTCATAATGTACCAGG - Intergenic
994049536 5:95346971-95346993 ATTGATTCTCTGAAAGTGCCAGG + Intergenic
994319420 5:98374890-98374912 CTTCATTCTCAGAAGGGACCTGG - Intergenic
994738151 5:103583562-103583584 CTTGATTCTCAGGCTGTCTCAGG + Intergenic
994829039 5:104754179-104754201 CTTGCTTCTCTGATGTTCCCTGG + Intergenic
997955461 5:138275338-138275360 CCTGATTCCCACAAGATCCCAGG + Intergenic
998498422 5:142611208-142611230 CTTGAAACTCAGAAGGGCTCTGG + Intronic
999627684 5:153537404-153537426 CTTCATTCTCCGCATGTCCCTGG + Intronic
1002058821 5:176614071-176614093 CTTGCTTTTCAGAAAGTCACTGG - Intergenic
1003222457 6:4173239-4173261 CTCTATTCCCAGAATGTCCCTGG - Intergenic
1004661365 6:17712810-17712832 CTTTATTCTAACAAGCTCCCGGG - Intergenic
1010578564 6:77564985-77565007 CTTGTTTCTCAGAACTTCACTGG + Intergenic
1012896240 6:104953213-104953235 CTTGATCCTCCGAAGGCCCAGGG + Intergenic
1013904091 6:115194937-115194959 CTTTCTTCCCAGGAGGTCCCTGG - Intergenic
1016979156 6:149838313-149838335 GTTGATTATCATAACGTCCCTGG + Intronic
1019486805 7:1293170-1293192 CTTGAGCCTCAGAACGTCCTGGG + Intergenic
1021768281 7:23970816-23970838 CTTGATTCTTTGAAGAGCCCAGG + Intergenic
1023282992 7:38590776-38590798 CCTGTCTCTCAGAAGTTCCCTGG + Intronic
1023851491 7:44152669-44152691 CTAGATCCTCAGTTGGTCCCTGG - Intronic
1024613852 7:51090580-51090602 CTTTTTTCTCAGTAGCTCCCAGG - Intronic
1033160694 7:138993801-138993823 GTTGATTCTCAGAAGGCTACAGG - Intergenic
1034075931 7:148231294-148231316 CTGGATTCTCTGCAGGTCTCTGG - Intronic
1034390901 7:150786968-150786990 CTGCATTTTCACAAGGTCCCAGG - Intergenic
1036275704 8:7349672-7349694 CTTGACTCTCAGAAGGACCAAGG + Intergenic
1036345651 8:7960685-7960707 CTTGACTCTCAGAAGGACCAAGG - Intergenic
1036840976 8:12121439-12121461 CTTGACTCTCAGAAGGACCAAGG - Intergenic
1036862785 8:12367691-12367713 CTTGACTCTCAGAAGGACCAAGG - Intergenic
1039515146 8:38126416-38126438 CTTAATTTTAAGAAGGTCCATGG + Intronic
1040308220 8:46223296-46223318 CTACCTTCCCAGAAGGTCCCTGG + Intergenic
1040330948 8:46385524-46385546 CTTGATTCCCAGAAGCCCCCAGG + Intergenic
1040336082 8:46416726-46416748 CTTCCTTCTCAGAAGCCCCCAGG + Intergenic
1040340272 8:46436992-46437014 CTTACATCTCAGAAGTTCCCAGG - Intergenic
1040514945 8:48126994-48127016 CTCGACTCTCAGCAGGGCCCAGG - Intergenic
1040763506 8:50878286-50878308 CTTGCTTCTCAGAAGACCTCAGG + Intergenic
1041181076 8:55248808-55248830 CTGGAGTCTCAGAGTGTCCCAGG + Intronic
1041296656 8:56363535-56363557 CTTGGCTCTCAGTCGGTCCCTGG + Intergenic
1044263672 8:90157734-90157756 CATGTTTCTCACAAGCTCCCAGG - Intergenic
1045330330 8:101150435-101150457 CTTCATTTTAAGAAGGTCCTTGG + Intergenic
1047305394 8:123649135-123649157 TTTTATTCTCAGAAGGTCAATGG + Intronic
1048462670 8:134635469-134635491 CTAGATTCTCTGAAGGGCTCAGG + Intronic
1051037672 9:12768340-12768362 CTTAATTCTCATAAGAACCCAGG - Intergenic
1053658136 9:40241388-40241410 GTTAATTCTAATAAGGTCCCAGG + Intronic
1053790932 9:41685801-41685823 CTTGGGAGTCAGAAGGTCCCTGG - Intergenic
1053908510 9:42870662-42870684 GTTAATTCTAATAAGGTCCCAGG + Intergenic
1054154220 9:61628971-61628993 CTTGGGAGTCAGAAGGTCCCTGG + Intergenic
1054179279 9:61897495-61897517 CTTGGGAGTCAGAAGGTCCCTGG - Intergenic
1054370257 9:64387663-64387685 GTTAATTCTAATAAGGTCCCAGG + Intronic
1054474005 9:65560091-65560113 CTTGGGAGTCAGAAGGTCCCTGG + Intergenic
1054526460 9:66134833-66134855 GTTAATTCTAATAAGGTCCCAGG - Intronic
1054658259 9:67683326-67683348 CTTGGGAGTCAGAAGGTCCCTGG + Intergenic
1054677888 9:67877419-67877441 GTTAATTCTAATAAGGTCCCAGG + Intronic
1055206849 9:73741595-73741617 CTTGATTTTCACATTGTCCCTGG + Intergenic
1058531762 9:105912916-105912938 CTGGATTCTCTGAAGCTCACTGG + Intergenic
1061605956 9:131711018-131711040 CCTGACACTCAGGAGGTCCCTGG + Intronic
1203790389 EBV:148430-148452 CTTGAGTCTCCAAAGGACCCAGG - Intergenic
1185505387 X:629761-629783 CTTTATTTGCAGAAGGTCCTTGG + Intronic
1186883412 X:13888994-13889016 CTTGCTTCTCAAAATGTCCCAGG - Intronic
1188243322 X:27813953-27813975 CTTGATTCTCAGAAGGTCCCTGG - Intronic
1188260751 X:28020345-28020367 TTTGCATCCCAGAAGGTCCCTGG - Intergenic
1189238577 X:39507761-39507783 CTTGCTGCTCAGAAGGCCCTTGG - Intergenic
1189540726 X:41985091-41985113 CTGGCTTCTCAGAGGGACCCAGG + Intergenic
1189644157 X:43108495-43108517 CTTGATTATCAGAAAGTATCAGG - Intergenic
1192131554 X:68556796-68556818 CATGATTCTCAGAAGATACAGGG + Intergenic
1194385499 X:93247871-93247893 CTCAATTCTGAGAAGTTCCCTGG + Intergenic
1197340374 X:125258612-125258634 GTTGATTCTCAGAATTTCCTGGG - Intergenic
1199091023 X:143692528-143692550 TTAGATTTTCAGAAGCTCCCTGG + Intergenic
1200227947 X:154429400-154429422 CTTGGTACTCAGTAGGTACCTGG - Intronic