ID: 1188246239

View in Genome Browser
Species Human (GRCh38)
Location X:27839369-27839391
Sequence AAACCCTGCTTTGTAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188246239_1188246241 12 Left 1188246239 X:27839369-27839391 CCTATCTTTACAAAGCAGGGTTT No data
Right 1188246241 X:27839404-27839426 CTTCTGTACTAGGATACCTCTGG No data
1188246239_1188246242 13 Left 1188246239 X:27839369-27839391 CCTATCTTTACAAAGCAGGGTTT No data
Right 1188246242 X:27839405-27839427 TTCTGTACTAGGATACCTCTGGG No data
1188246239_1188246240 2 Left 1188246239 X:27839369-27839391 CCTATCTTTACAAAGCAGGGTTT No data
Right 1188246240 X:27839394-27839416 GCAGTGATGTCTTCTGTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188246239 Original CRISPR AAACCCTGCTTTGTAAAGAT AGG (reversed) Intergenic
No off target data available for this crispr