ID: 1188250917

View in Genome Browser
Species Human (GRCh38)
Location X:27893139-27893161
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188250915_1188250917 2 Left 1188250915 X:27893114-27893136 CCTCGCGATTAACTATGCTCCAA No data
Right 1188250917 X:27893139-27893161 AAGTACATGCTGTCATAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188250917 Original CRISPR AAGTACATGCTGTCATAGAG AGG Intergenic
No off target data available for this crispr