ID: 1188254677

View in Genome Browser
Species Human (GRCh38)
Location X:27947073-27947095
Sequence CGGTAATCACAGATGCAATT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188254674_1188254677 11 Left 1188254674 X:27947039-27947061 CCTTAAGTGTATGCAAACTTAAA No data
Right 1188254677 X:27947073-27947095 CGGTAATCACAGATGCAATTCGG No data
1188254673_1188254677 30 Left 1188254673 X:27947020-27947042 CCTTTAATACAATGTAGAACCTT No data
Right 1188254677 X:27947073-27947095 CGGTAATCACAGATGCAATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188254677 Original CRISPR CGGTAATCACAGATGCAATT CGG Intergenic
No off target data available for this crispr