ID: 1188256498

View in Genome Browser
Species Human (GRCh38)
Location X:27967379-27967401
Sequence ATGCTGTTTTACATTAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188256492_1188256498 9 Left 1188256492 X:27967347-27967369 CCAAACCCACAAGCAGCTGCAAA No data
Right 1188256498 X:27967379-27967401 ATGCTGTTTTACATTAAACAGGG No data
1188256491_1188256498 30 Left 1188256491 X:27967326-27967348 CCTTTGGGCTTTTAATACATACC No data
Right 1188256498 X:27967379-27967401 ATGCTGTTTTACATTAAACAGGG No data
1188256494_1188256498 3 Left 1188256494 X:27967353-27967375 CCACAAGCAGCTGCAAACTGCCA No data
Right 1188256498 X:27967379-27967401 ATGCTGTTTTACATTAAACAGGG No data
1188256493_1188256498 4 Left 1188256493 X:27967352-27967374 CCCACAAGCAGCTGCAAACTGCC No data
Right 1188256498 X:27967379-27967401 ATGCTGTTTTACATTAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188256498 Original CRISPR ATGCTGTTTTACATTAAACA GGG Intergenic
No off target data available for this crispr