ID: 1188260049

View in Genome Browser
Species Human (GRCh38)
Location X:28012370-28012392
Sequence CACTTCTTCCACCTTAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188260049_1188260052 11 Left 1188260049 X:28012370-28012392 CCACCATTAAGGTGGAAGAAGTG No data
Right 1188260052 X:28012404-28012426 AGTTTTTAACATCAATAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188260049 Original CRISPR CACTTCTTCCACCTTAATGG TGG (reversed) Intergenic
No off target data available for this crispr