ID: 1188260512

View in Genome Browser
Species Human (GRCh38)
Location X:28017320-28017342
Sequence ATGGTTCAACTGGTCCTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188260512_1188260520 13 Left 1188260512 X:28017320-28017342 CCCTGTAGGACCAGTTGAACCAT No data
Right 1188260520 X:28017356-28017378 TGGCAGAGCTCAGTTGTTTTAGG No data
1188260512_1188260522 28 Left 1188260512 X:28017320-28017342 CCCTGTAGGACCAGTTGAACCAT No data
Right 1188260522 X:28017371-28017393 GTTTTAGGGTCTTGCAGTTGAGG No data
1188260512_1188260521 14 Left 1188260512 X:28017320-28017342 CCCTGTAGGACCAGTTGAACCAT No data
Right 1188260521 X:28017357-28017379 GGCAGAGCTCAGTTGTTTTAGGG No data
1188260512_1188260517 -7 Left 1188260512 X:28017320-28017342 CCCTGTAGGACCAGTTGAACCAT No data
Right 1188260517 X:28017336-28017358 GAACCATCTGTTGGGCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188260512 Original CRISPR ATGGTTCAACTGGTCCTACA GGG (reversed) Intergenic
No off target data available for this crispr