ID: 1188261539

View in Genome Browser
Species Human (GRCh38)
Location X:28030554-28030576
Sequence ACTGTGCTGGGATTTCCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188261528_1188261539 30 Left 1188261528 X:28030501-28030523 CCGACACACAAGCACTCTGGAGG No data
Right 1188261539 X:28030554-28030576 ACTGTGCTGGGATTTCCAACAGG No data
1188261534_1188261539 -1 Left 1188261534 X:28030532-28030554 CCGAAAGGGTTTCCAAGGCACCA No data
Right 1188261539 X:28030554-28030576 ACTGTGCTGGGATTTCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188261539 Original CRISPR ACTGTGCTGGGATTTCCAAC AGG Intergenic