ID: 1188262111

View in Genome Browser
Species Human (GRCh38)
Location X:28034359-28034381
Sequence GCTCCTCCCTGGTATCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188262111_1188262118 19 Left 1188262111 X:28034359-28034381 CCTCCAGGATACCAGGGAGGAGC No data
Right 1188262118 X:28034401-28034423 TATCTAGGGCACCAGCTCATGGG No data
1188262111_1188262116 5 Left 1188262111 X:28034359-28034381 CCTCCAGGATACCAGGGAGGAGC No data
Right 1188262116 X:28034387-28034409 GGTCACTGATAGAGTATCTAGGG No data
1188262111_1188262115 4 Left 1188262111 X:28034359-28034381 CCTCCAGGATACCAGGGAGGAGC No data
Right 1188262115 X:28034386-28034408 AGGTCACTGATAGAGTATCTAGG No data
1188262111_1188262117 18 Left 1188262111 X:28034359-28034381 CCTCCAGGATACCAGGGAGGAGC No data
Right 1188262117 X:28034400-28034422 GTATCTAGGGCACCAGCTCATGG No data
1188262111_1188262119 20 Left 1188262111 X:28034359-28034381 CCTCCAGGATACCAGGGAGGAGC No data
Right 1188262119 X:28034402-28034424 ATCTAGGGCACCAGCTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188262111 Original CRISPR GCTCCTCCCTGGTATCCTGG AGG (reversed) Intergenic
No off target data available for this crispr