ID: 1188263221

View in Genome Browser
Species Human (GRCh38)
Location X:28041380-28041402
Sequence TGGCCCCGATTTCACAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188263221_1188263223 -3 Left 1188263221 X:28041380-28041402 CCAACTCTGTGAAATCGGGGCCA No data
Right 1188263223 X:28041400-28041422 CCACAGCTCACTTAACATCAAGG No data
1188263221_1188263224 -2 Left 1188263221 X:28041380-28041402 CCAACTCTGTGAAATCGGGGCCA No data
Right 1188263224 X:28041401-28041423 CACAGCTCACTTAACATCAAGGG No data
1188263221_1188263226 3 Left 1188263221 X:28041380-28041402 CCAACTCTGTGAAATCGGGGCCA No data
Right 1188263226 X:28041406-28041428 CTCACTTAACATCAAGGGGATGG No data
1188263221_1188263225 -1 Left 1188263221 X:28041380-28041402 CCAACTCTGTGAAATCGGGGCCA No data
Right 1188263225 X:28041402-28041424 ACAGCTCACTTAACATCAAGGGG No data
1188263221_1188263227 17 Left 1188263221 X:28041380-28041402 CCAACTCTGTGAAATCGGGGCCA No data
Right 1188263227 X:28041420-28041442 AGGGGATGGCCCATTTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188263221 Original CRISPR TGGCCCCGATTTCACAGAGT TGG (reversed) Intergenic
No off target data available for this crispr