ID: 1188280319

View in Genome Browser
Species Human (GRCh38)
Location X:28260128-28260150
Sequence AATCTGGGGCTCTGACAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188280311_1188280319 19 Left 1188280311 X:28260086-28260108 CCTACTCCCTAATGATAATGGTA No data
Right 1188280319 X:28260128-28260150 AATCTGGGGCTCTGACAGCTTGG No data
1188280313_1188280319 12 Left 1188280313 X:28260093-28260115 CCTAATGATAATGGTAAGCTAGA No data
Right 1188280319 X:28260128-28260150 AATCTGGGGCTCTGACAGCTTGG No data
1188280312_1188280319 13 Left 1188280312 X:28260092-28260114 CCCTAATGATAATGGTAAGCTAG No data
Right 1188280319 X:28260128-28260150 AATCTGGGGCTCTGACAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188280319 Original CRISPR AATCTGGGGCTCTGACAGCT TGG Intergenic
No off target data available for this crispr