ID: 1188282340 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:28285891-28285913 |
| Sequence | ACATGACAATTGCATTGACA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1188282338_1188282340 | -4 | Left | 1188282338 | X:28285872-28285894 | CCAATTCTTCTTCCATATTACAT | No data | ||
| Right | 1188282340 | X:28285891-28285913 | ACATGACAATTGCATTGACATGG | No data | ||||
| 1188282337_1188282340 | -3 | Left | 1188282337 | X:28285871-28285893 | CCCAATTCTTCTTCCATATTACA | No data | ||
| Right | 1188282340 | X:28285891-28285913 | ACATGACAATTGCATTGACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1188282340 | Original CRISPR | ACATGACAATTGCATTGACA TGG | Intergenic | ||