ID: 1188282340 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:28285891-28285913 |
Sequence | ACATGACAATTGCATTGACA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1188282338_1188282340 | -4 | Left | 1188282338 | X:28285872-28285894 | CCAATTCTTCTTCCATATTACAT | No data | ||
Right | 1188282340 | X:28285891-28285913 | ACATGACAATTGCATTGACATGG | No data | ||||
1188282337_1188282340 | -3 | Left | 1188282337 | X:28285871-28285893 | CCCAATTCTTCTTCCATATTACA | No data | ||
Right | 1188282340 | X:28285891-28285913 | ACATGACAATTGCATTGACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1188282340 | Original CRISPR | ACATGACAATTGCATTGACA TGG | Intergenic | ||