ID: 1188282342

View in Genome Browser
Species Human (GRCh38)
Location X:28285905-28285927
Sequence TTGACATGGGTCAGTACGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188282339_1188282342 -2 Left 1188282339 X:28285884-28285906 CCATATTACATGACAATTGCATT No data
Right 1188282342 X:28285905-28285927 TTGACATGGGTCAGTACGCTTGG No data
1188282337_1188282342 11 Left 1188282337 X:28285871-28285893 CCCAATTCTTCTTCCATATTACA No data
Right 1188282342 X:28285905-28285927 TTGACATGGGTCAGTACGCTTGG No data
1188282338_1188282342 10 Left 1188282338 X:28285872-28285894 CCAATTCTTCTTCCATATTACAT No data
Right 1188282342 X:28285905-28285927 TTGACATGGGTCAGTACGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188282342 Original CRISPR TTGACATGGGTCAGTACGCT TGG Intergenic