ID: 1188282343 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:28285913-28285935 |
| Sequence | GGTCAGTACGCTTGGATTCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1188282337_1188282343 | 19 | Left | 1188282337 | X:28285871-28285893 | CCCAATTCTTCTTCCATATTACA | No data | ||
| Right | 1188282343 | X:28285913-28285935 | GGTCAGTACGCTTGGATTCATGG | No data | ||||
| 1188282338_1188282343 | 18 | Left | 1188282338 | X:28285872-28285894 | CCAATTCTTCTTCCATATTACAT | No data | ||
| Right | 1188282343 | X:28285913-28285935 | GGTCAGTACGCTTGGATTCATGG | No data | ||||
| 1188282339_1188282343 | 6 | Left | 1188282339 | X:28285884-28285906 | CCATATTACATGACAATTGCATT | No data | ||
| Right | 1188282343 | X:28285913-28285935 | GGTCAGTACGCTTGGATTCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1188282343 | Original CRISPR | GGTCAGTACGCTTGGATTCA TGG | Intergenic | ||