ID: 1188285579

View in Genome Browser
Species Human (GRCh38)
Location X:28322485-28322507
Sequence CGGCGAACAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188285579_1188285590 22 Left 1188285579 X:28322485-28322507 CCGTCCACCACTGCTGTTCGCCG No data
Right 1188285590 X:28322530-28322552 TTCCACCCCTCCTCCGGATCCGG No data
1188285579_1188285592 26 Left 1188285579 X:28322485-28322507 CCGTCCACCACTGCTGTTCGCCG No data
Right 1188285592 X:28322534-28322556 ACCCCTCCTCCGGATCCGGCAGG No data
1188285579_1188285589 16 Left 1188285579 X:28322485-28322507 CCGTCCACCACTGCTGTTCGCCG No data
Right 1188285589 X:28322524-28322546 GTTGACTTCCACCCCTCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188285579 Original CRISPR CGGCGAACAGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr