ID: 1188287105

View in Genome Browser
Species Human (GRCh38)
Location X:28341127-28341149
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188287097_1188287105 28 Left 1188287097 X:28341076-28341098 CCACTGGAATTATTTATTTCTTA No data
Right 1188287105 X:28341127-28341149 CCACTCACGCACTTTTCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188287105 Original CRISPR CCACTCACGCACTTTTCTAT GGG Intergenic
No off target data available for this crispr