ID: 1188287756

View in Genome Browser
Species Human (GRCh38)
Location X:28349065-28349087
Sequence ATCATGTAGGTATAATTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188287756_1188287764 6 Left 1188287756 X:28349065-28349087 CCTTTTAATTATACCTACATGAT No data
Right 1188287764 X:28349094-28349116 GTGGAATCAGGACTAAAACTGGG No data
1188287756_1188287763 5 Left 1188287756 X:28349065-28349087 CCTTTTAATTATACCTACATGAT No data
Right 1188287763 X:28349093-28349115 GGTGGAATCAGGACTAAAACTGG No data
1188287756_1188287762 -6 Left 1188287756 X:28349065-28349087 CCTTTTAATTATACCTACATGAT No data
Right 1188287762 X:28349082-28349104 CATGATCTTGGGGTGGAATCAGG No data
1188287756_1188287766 29 Left 1188287756 X:28349065-28349087 CCTTTTAATTATACCTACATGAT No data
Right 1188287766 X:28349117-28349139 CCAATCAGATACTTTTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188287756 Original CRISPR ATCATGTAGGTATAATTAAA AGG (reversed) Intergenic
No off target data available for this crispr