ID: 1188287761

View in Genome Browser
Species Human (GRCh38)
Location X:28349078-28349100
Sequence ATTCCACCCCAAGATCATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188287761_1188287768 30 Left 1188287761 X:28349078-28349100 CCTACATGATCTTGGGGTGGAAT No data
Right 1188287768 X:28349131-28349153 TTGCCCTGGAAATGTCAAGAGGG No data
1188287761_1188287764 -7 Left 1188287761 X:28349078-28349100 CCTACATGATCTTGGGGTGGAAT No data
Right 1188287764 X:28349094-28349116 GTGGAATCAGGACTAAAACTGGG No data
1188287761_1188287763 -8 Left 1188287761 X:28349078-28349100 CCTACATGATCTTGGGGTGGAAT No data
Right 1188287763 X:28349093-28349115 GGTGGAATCAGGACTAAAACTGG No data
1188287761_1188287766 16 Left 1188287761 X:28349078-28349100 CCTACATGATCTTGGGGTGGAAT No data
Right 1188287766 X:28349117-28349139 CCAATCAGATACTTTTGCCCTGG No data
1188287761_1188287767 29 Left 1188287761 X:28349078-28349100 CCTACATGATCTTGGGGTGGAAT No data
Right 1188287767 X:28349130-28349152 TTTGCCCTGGAAATGTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188287761 Original CRISPR ATTCCACCCCAAGATCATGT AGG (reversed) Intergenic
No off target data available for this crispr