ID: 1188287766

View in Genome Browser
Species Human (GRCh38)
Location X:28349117-28349139
Sequence CCAATCAGATACTTTTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188287756_1188287766 29 Left 1188287756 X:28349065-28349087 CCTTTTAATTATACCTACATGAT No data
Right 1188287766 X:28349117-28349139 CCAATCAGATACTTTTGCCCTGG No data
1188287761_1188287766 16 Left 1188287761 X:28349078-28349100 CCTACATGATCTTGGGGTGGAAT No data
Right 1188287766 X:28349117-28349139 CCAATCAGATACTTTTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188287766 Original CRISPR CCAATCAGATACTTTTGCCC TGG Intergenic
No off target data available for this crispr