ID: 1188290290

View in Genome Browser
Species Human (GRCh38)
Location X:28379430-28379452
Sequence ACAAATGGAATACACTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188290290_1188290295 11 Left 1188290290 X:28379430-28379452 CCTCCTCAGTGTATTCCATTTGT No data
Right 1188290295 X:28379464-28379486 GAGACCTAAACTATGCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188290290 Original CRISPR ACAAATGGAATACACTGAGG AGG (reversed) Intergenic
No off target data available for this crispr