ID: 1188295408

View in Genome Browser
Species Human (GRCh38)
Location X:28441198-28441220
Sequence TTGAATATACAAAGGAACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188295408_1188295412 24 Left 1188295408 X:28441198-28441220 CCCTTGTTCCTTTGTATATTCAA No data
Right 1188295412 X:28441245-28441267 TTAAACTTAATGTTATAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188295408 Original CRISPR TTGAATATACAAAGGAACAA GGG (reversed) Intergenic
No off target data available for this crispr