ID: 1188304092

View in Genome Browser
Species Human (GRCh38)
Location X:28541257-28541279
Sequence TAGGGGAGGAGTGGTGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188304084_1188304092 -3 Left 1188304084 X:28541237-28541259 CCAGAGGCTGGGATGAATAGTAG No data
Right 1188304092 X:28541257-28541279 TAGGGGAGGAGTGGTGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188304092 Original CRISPR TAGGGGAGGAGTGGTGGTGG AGG Intergenic
No off target data available for this crispr