ID: 1188306047

View in Genome Browser
Species Human (GRCh38)
Location X:28560919-28560941
Sequence CAGGATGTTAAATCTGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188306041_1188306047 18 Left 1188306041 X:28560878-28560900 CCATCTGACCTGAACTTTAAGAT No data
Right 1188306047 X:28560919-28560941 CAGGATGTTAAATCTGATTCAGG No data
1188306043_1188306047 10 Left 1188306043 X:28560886-28560908 CCTGAACTTTAAGATTGGTTCTA No data
Right 1188306047 X:28560919-28560941 CAGGATGTTAAATCTGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188306047 Original CRISPR CAGGATGTTAAATCTGATTC AGG Intergenic
No off target data available for this crispr