ID: 1188314824

View in Genome Browser
Species Human (GRCh38)
Location X:28660065-28660087
Sequence AAGCAGAAGCAGAGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1013
Summary {0: 1, 1: 0, 2: 9, 3: 115, 4: 888}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188314820_1188314824 -8 Left 1188314820 X:28660050-28660072 CCGCTCCAGATTCCAAAGCAGAA 0: 1
1: 0
2: 0
3: 30
4: 279
Right 1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG 0: 1
1: 0
2: 9
3: 115
4: 888

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188314824 Original CRISPR AAGCAGAAGCAGAGTGAGGA TGG Intronic
900459308 1:2793945-2793967 AAGAAGAAGGAGGGCGAGGAGGG - Intronic
900508532 1:3043939-3043961 AAGCAGCAGCAGGGTGGGAAAGG - Intergenic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
900944620 1:5822838-5822860 GGGCAGAAGCATGGTGAGGACGG - Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901316290 1:8311780-8311802 AAGCAGAAAGAGAGTGAGACAGG - Intergenic
901354643 1:8634155-8634177 TAGTAGCAGCAGCGTGAGGATGG - Intronic
901472920 1:9470224-9470246 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
902818834 1:18931250-18931272 AGACAGAAGCAGTGGGAGGAGGG - Intronic
902999281 1:20253272-20253294 TGGCAGAAGCAGAGTAAAGAGGG + Intergenic
903076510 1:20772373-20772395 GAGCAGCATCATAGTGAGGATGG - Intronic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904431617 1:30468168-30468190 TGGCAGAAGCAGAGCGTGGAAGG - Intergenic
904547403 1:31286482-31286504 GAGCCGTAGCAGAGTGATGAGGG - Intronic
904807272 1:33140861-33140883 AAGGAGAAGGGGAGAGAGGAGGG - Intergenic
905385405 1:37600016-37600038 TAGCAGAGCCAGGGTGAGGAAGG + Intergenic
905507668 1:38493065-38493087 AAATAAAAGCAGAGTAAGGAAGG + Intergenic
905678034 1:39843686-39843708 AAGCAGAAGCATAGCTGGGAGGG - Intronic
905853746 1:41293630-41293652 AAGCAGAACTACAGTGAAGAGGG - Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906518249 1:46452244-46452266 AAGAGGAAGCAGAGTGGGGCTGG + Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906831593 1:49037484-49037506 AAGTAGAAGCCAAGTGAGGAGGG - Intronic
907373590 1:54018268-54018290 AAGCAGAGGCAAAGGCAGGAGGG + Intergenic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907534740 1:55140720-55140742 GGGCAGCAGCAGAGTGAGGTAGG + Intronic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
908909342 1:69055046-69055068 AAATAGAGGCAGGGTGAGGAGGG - Intergenic
909456370 1:75854316-75854338 CAGCATAGGCAGAGTGAAGATGG - Intronic
909584820 1:77278409-77278431 TAGCAGGAACAGGGTGAGGAAGG - Intergenic
909692391 1:78423417-78423439 AAGCTTGAGCAAAGTGAGGAAGG - Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910723456 1:90313012-90313034 GAGAACAAGCAGAGTAAGGAAGG + Intergenic
911133442 1:94414729-94414751 AGACCGAAGCAGATTGAGGAAGG - Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
912024448 1:105149905-105149927 AAGCAGAAGCAGGGTTTGAAAGG + Intergenic
912032855 1:105271774-105271796 AAGCAGAAGCAGAGTTTGAGAGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912322547 1:108727781-108727803 AAGCAGGAGCAGAGGGAAAATGG - Intronic
912563386 1:110566317-110566339 AAGCAGAGGCAGAGTAGTGAAGG + Intergenic
912822737 1:112880852-112880874 AAGCAGCTTCAGAGTGGGGAGGG + Intergenic
912900906 1:113647258-113647280 GAGCAGGAACAGATTGAGGAAGG + Intronic
913252924 1:116927085-116927107 AAACAGAAGCAGAAAGAGCAAGG + Intronic
913397492 1:118388391-118388413 AAGCAGAAGCAGAATGACTCTGG + Intergenic
913474331 1:119222649-119222671 AAGCAGCAGCAGATTCAGGGTGG + Intergenic
914447903 1:147765660-147765682 AGGCAGGAGCAGATTGTGGAGGG + Intronic
914887014 1:151593832-151593854 AAGCAGAAGCGGTTTGGGGAGGG + Intergenic
915468540 1:156112557-156112579 CACCAGAAGCAGAGGCAGGAGGG - Intronic
915471580 1:156128952-156128974 AAGCAGCTGCAGGGGGAGGAGGG - Intronic
915515714 1:156411321-156411343 CAGCAGAAGCACAATGCGGAGGG + Intronic
915580653 1:156811081-156811103 AAGGAGATGCTGAGAGAGGAGGG - Intronic
915646090 1:157273715-157273737 AAGGAGTTGCAGAGTGGGGATGG + Intergenic
915733663 1:158071255-158071277 AGGCAGAGGGAGAGCGAGGAGGG - Intronic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
916790156 1:168117864-168117886 AAGCAAAAGCAGAGTGGAAATGG - Intronic
917028093 1:170663754-170663776 AAACAGAAGAAGAGAGAAGAAGG - Intronic
917048331 1:170888972-170888994 AGGCTGTAGCATAGTGAGGATGG - Intergenic
917953311 1:180064178-180064200 AAGCCCAAGCACAGTGAGGATGG - Intronic
918062976 1:181078100-181078122 AAACAGCAGCAGAGTTGGGAGGG + Intergenic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918225294 1:182475670-182475692 AATCAGGAGCAGAGTGAGCTTGG - Intronic
918237207 1:182592201-182592223 AGGCTGGAGCAGAGTGAGGGAGG + Intergenic
918385744 1:184005635-184005657 ACGGAGAGGCAGAGTGTGGATGG - Intronic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918705203 1:187651958-187651980 CAGTAGAAGCTGAGTGTGGAGGG + Intergenic
918864099 1:189872009-189872031 AAACAAAAGCAAAGTGAGAAAGG + Intergenic
919003043 1:191859620-191859642 AAACAGAAGGAGAGAGAGGAAGG - Intergenic
919054000 1:192546127-192546149 GAGCAGATGCAGGCTGAGGAAGG + Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921740608 1:218680575-218680597 TGGCAGAAGCACAGTGAGCATGG + Intergenic
922002460 1:221493880-221493902 GAGCAAGAGCAGAGTGAGCAAGG - Intergenic
922224552 1:223634062-223634084 ATCCAGAAGCAGAGTAAAGATGG + Intronic
922244023 1:223777325-223777347 AAGCAGCAGCAAAGAGAGGTAGG - Intergenic
922464375 1:225836743-225836765 CAGCAGAAGCAGAGAGGAGAAGG + Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
923176982 1:231476221-231476243 ATGCAGAAGCACGGGGAGGAGGG - Intergenic
923295877 1:232594548-232594570 TCCCAGAAGGAGAGTGAGGATGG - Intergenic
923464278 1:234234367-234234389 AAGCCGGAGCCGAGAGAGGAAGG + Intronic
923718608 1:236448252-236448274 CAGCACAGCCAGAGTGAGGAAGG + Intronic
924217836 1:241842817-241842839 AAGCGGAAGCAGAGAGAAGCAGG - Intergenic
924290353 1:242529852-242529874 AAGGAGAAAGAGAGAGAGGAAGG - Intergenic
924597624 1:245461246-245461268 AAGCAGAAGCAGAATCAGTCTGG - Intronic
924680363 1:246224879-246224901 AAACAGAAGCAGAAAAAGGAAGG + Intronic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063532213 10:6844500-6844522 AAGCAGAAGGCCAGTGAAGAAGG + Intergenic
1064076218 10:12270920-12270942 AAGCAGAAGTAGAGAGGGGGTGG - Intergenic
1064609251 10:17080015-17080037 GAGCAGAAGCTGAGGCAGGAAGG - Intronic
1064906081 10:20347544-20347566 AGGCAGAAGCAGAGAGGAGAGGG - Intergenic
1065675822 10:28173148-28173170 AAGGAGAACCAGGGTGAGCAGGG + Intronic
1065734596 10:28740234-28740256 AAGAAGAAAGAGAGAGAGGAAGG - Intergenic
1066211511 10:33243899-33243921 AAGGAGAAGGAGAGTGGAGAAGG + Intronic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067509511 10:46883435-46883457 AGGCAGAATCAGGGAGAGGAAGG - Intergenic
1067652743 10:48168420-48168442 AGGCAGAATCAGGGAGAGGAAGG + Intronic
1067748786 10:48956513-48956535 AGCAAGAAGCAGAGGGAGGAGGG - Intronic
1068129433 10:52879098-52879120 AAGCAGAAGCAAAGAGATGCTGG + Intergenic
1068369755 10:56096726-56096748 AGGCAGCAACAGAGTGAGGGAGG + Intergenic
1068594947 10:58892746-58892768 AAGCAGAAGCACCTTGAGGAAGG - Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069207526 10:65710443-65710465 AAGGAGAGGGAGAGTGATGAGGG + Intergenic
1069251126 10:66268474-66268496 AAGGAGTAGAAGACTGAGGAAGG - Intronic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070167031 10:73906694-73906716 AGGCAGAAAAAGAGTGAGGAAGG + Intergenic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070360947 10:75688620-75688642 AAGCAGAAGCAGGGTTTGGGAGG + Intronic
1070489327 10:76961507-76961529 AAGCAGCAGCAGAGTATGAAAGG + Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070723654 10:78773561-78773583 AATCAGGAGGAGAGTGAGGGAGG - Intergenic
1071018750 10:81028129-81028151 ATGCAGAGGAAGAGTGGGGAGGG - Intergenic
1071341445 10:84652376-84652398 CAGAAGAAGCAGAGTGTGGGAGG - Intergenic
1071396146 10:85225958-85225980 AAGCAGGAGCAGAGAGAGCATGG + Intergenic
1071427963 10:85578578-85578600 AAGGAGAAGCAGAGGGAAGTGGG + Intergenic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1072317356 10:94215676-94215698 AGCCAGCAGCAGAGAGAGGATGG + Intronic
1073748881 10:106501274-106501296 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1074262228 10:111865570-111865592 AAGCAGAGGAGGAGTGAGGTTGG + Intergenic
1075105939 10:119540044-119540066 AAGAAGAAGCCTAGTGAGAAAGG - Intronic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1076742554 10:132494005-132494027 ACGAGGAAGCAGAGTGGGGAGGG - Intergenic
1076866997 10:133172127-133172149 GAACAGAAGCAGTGTGAGGCTGG + Intronic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078414579 11:11155013-11155035 AAGGAGAAGCAGAGAGTGGTGGG + Intergenic
1079599621 11:22295145-22295167 AAGCCCAAACAGAGTGAGGTTGG + Intergenic
1079666632 11:23113919-23113941 AAGTAGAGGCAGAGTGGAGAGGG + Intergenic
1080126165 11:28736471-28736493 AAACAGAGGCAGAGTCATGAAGG + Intergenic
1080421507 11:32115271-32115293 AAGAAGAAGCAAAGAGTGGAAGG - Intergenic
1080844202 11:36012482-36012504 AAGCACAAGAAGAGTGATGCTGG - Intronic
1081028343 11:38044815-38044837 GAGCTCAAGCAGAGTGAGCAGGG - Intergenic
1081161374 11:39754174-39754196 AAGCAGCAGCAGAGTCTGCACGG - Intergenic
1081357293 11:42126730-42126752 AAGCAGATTCAGACTGACGATGG - Intergenic
1081557345 11:44177458-44177480 AAACAGAAGTAAAATGAGGAGGG - Intronic
1081654624 11:44849289-44849311 AAGCAGGACCTGAGTGAGGATGG + Intronic
1082677940 11:56131591-56131613 GAGTAGAAGAAGGGTGAGGAGGG + Intergenic
1082783567 11:57304225-57304247 AAGCAGGAGGAGAGTGGGGCAGG + Intronic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083082031 11:60104026-60104048 AAACAGAAGTAGACTGTGGATGG - Intergenic
1084297088 11:68219622-68219644 AAGAAGAAGAGGAGAGAGGAAGG - Intergenic
1085632688 11:78132383-78132405 AGGCAGAAGGAGAGTCAGGAAGG - Intronic
1085753961 11:79188647-79188669 AAGCAGAAGAGAAGTGAGGATGG + Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086164425 11:83761158-83761180 AAGCAGAATGACAGTGAGAATGG + Intronic
1086177640 11:83911199-83911221 GGGCAGAGGCAGAGAGAGGAAGG + Intronic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1086989700 11:93289419-93289441 TAGCAGAAGCTGAGTAAGTAAGG - Intergenic
1087000549 11:93415622-93415644 AAGCAGAAGTAGAGACTGGAAGG - Intronic
1087344899 11:96959478-96959500 AGCCAAAATCAGAGTGAGGAAGG + Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1087789882 11:102394581-102394603 AAGCCATAGCAAAGTGAGGAGGG + Intergenic
1088279854 11:108124742-108124764 TGGCAAAAGCAGAGTGAGCACGG - Intronic
1088589801 11:111393641-111393663 AAGCAAAACCAGAGTGTTGAAGG + Intronic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1089447366 11:118564224-118564246 AAGGAGAATAACAGTGAGGAAGG - Intronic
1089536307 11:119162478-119162500 AATCAGAAGCAGAATGAGCCTGG - Exonic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089572655 11:119420553-119420575 AGGCTCAAGCAGAGTGGGGAGGG - Intronic
1089646633 11:119884687-119884709 AAGCAGAATGAAAGTGAGGGCGG - Intergenic
1090163293 11:124518068-124518090 AAGCAGAAGCAGAGGGTGTCTGG - Intergenic
1090207061 11:124891289-124891311 AAAAAGAAGCAGGGTAAGGAGGG - Exonic
1090432692 11:126659667-126659689 GATCAGAAGCAGAGTCAGAATGG + Intronic
1090591382 11:128273841-128273863 AAAGATAAGCAGAGTGAGGGTGG - Intergenic
1090908205 11:131095842-131095864 ACGAGGAAGGAGAGTGAGGAGGG - Intergenic
1091057145 11:132429930-132429952 AGCTAGAAGCAGACTGAGGAAGG + Intronic
1091061591 11:132468099-132468121 AAGCAGAAAGAGAGGGAGGCTGG - Intronic
1091109039 11:132948278-132948300 AGGCAGAAGGAGTGAGAGGAAGG + Intronic
1091169196 11:133505483-133505505 AAGAGGAAGCAGATTGAGGGAGG - Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091451758 12:576409-576431 AAACGGAAGCAGAGTGTGTAGGG + Intronic
1091494872 12:963853-963875 CAGCAGAACTAGAGTGACGAGGG + Intronic
1091750924 12:3020812-3020834 AAGCAGAAACAGAGGGAGAGGGG - Intronic
1091822810 12:3489341-3489363 AAGCAGAAGCAGTGTTGGGTGGG + Intronic
1091920640 12:4302107-4302129 ATACAGAAGCAGTGTGAGCAGGG + Exonic
1092028215 12:5261057-5261079 AAGCAGAAGTGGAGAGAAGAGGG + Intergenic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092395539 12:8122367-8122389 GAGTGCAAGCAGAGTGAGGAGGG + Intergenic
1092519236 12:9250314-9250336 CAGCTGAAGCAGTGTGAAGAGGG + Intergenic
1093176452 12:15918317-15918339 AAGCGCAAGCAGGGTAAGGAGGG - Intronic
1093312632 12:17609178-17609200 TAGCTTAAGCAGACTGAGGAGGG + Intergenic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1094619249 12:32064558-32064580 AAGAAGAAGGAGAGGGAAGAAGG + Intergenic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096230344 12:49893309-49893331 CAGCAGGAGCAGAGTGTGGCAGG - Intronic
1096298217 12:50401665-50401687 AAGCAGCAGCTGCGTGATGAAGG + Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096670610 12:53196284-53196306 AAGCTGACTCAGAGTGAGGCTGG - Intronic
1096752355 12:53769139-53769161 AATCAGAAGCAGACTGTGGGGGG - Intergenic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1097542263 12:60955965-60955987 AAGCCGACCCAGTGTGAGGAGGG + Intergenic
1097800928 12:63913051-63913073 AAGAAGAGGCAGATCGAGGAGGG - Intronic
1098041958 12:66361724-66361746 AAGCAGAGGCTGAGTCAGGAGGG - Intronic
1098170890 12:67746076-67746098 AAACAGGAGGAGTGTGAGGAAGG - Intergenic
1098346844 12:69514418-69514440 GAGCAGAAGCAGAGAGCAGAAGG - Intronic
1098446011 12:70566233-70566255 AATCAGAAACAGAGTGTGGTGGG + Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099051257 12:77783983-77784005 AGGGAGAAGCAGAGTCATGATGG - Intergenic
1099060233 12:77899226-77899248 AAGCAGCAGCAGAGTTTGAAAGG + Intronic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1099732619 12:86525262-86525284 AGGCAGTAGGAGAGAGAGGATGG - Intronic
1100393208 12:94162354-94162376 GAGCAGAAGCAGAGTGCAGGAGG + Intronic
1100471365 12:94896319-94896341 AAGCAGAACCAGAATAGGGAAGG + Intergenic
1100501977 12:95183160-95183182 CAGCAGAAGCATAGTGGGAAGGG - Intronic
1100642357 12:96494165-96494187 TAGCAGAAGCAGAGTGAAAGAGG + Intronic
1100702306 12:97161470-97161492 GGGCTGAAGCAGGGTGAGGAGGG + Intergenic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101201198 12:102438190-102438212 AAGCTGAGGCAAAGTCAGGAAGG + Intronic
1101363505 12:104049983-104050005 CAGCCGAAGCAGCGTGAGGGCGG - Exonic
1101535555 12:105613147-105613169 AGGCAGCAGGAGAGAGAGGAAGG - Intergenic
1101829198 12:108243908-108243930 AACCAAAAGCAGAGTGGGGGTGG - Intronic
1102015135 12:109643223-109643245 AAGCTGAGGGAGAGTGAGTAAGG - Intergenic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102252012 12:111393950-111393972 AAGCAGAAGTAGAAAGCGGAGGG - Intergenic
1102378906 12:112446555-112446577 TAGCAGAAGAGGAGTAAGGAGGG + Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102623143 12:114212911-114212933 AAGCAGAATTGGAGAGAGGAAGG + Intergenic
1102803232 12:115755932-115755954 AAAAACAAGTAGAGTGAGGAAGG - Intergenic
1103104385 12:118210192-118210214 AAGAAGAAAAAGAGGGAGGAAGG - Intronic
1103219475 12:119231884-119231906 AAGGAGAAGGAGGGGGAGGAGGG - Intergenic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1103954528 12:124568712-124568734 AAGCAGAAGAGGAGGGAGGGAGG - Intergenic
1104285058 12:127417657-127417679 AAGCAGAAGGAAAGTCAGGAAGG - Intergenic
1104426584 12:128682975-128682997 AGGCAGACGCACAGGGAGGACGG - Intronic
1104428372 12:128696364-128696386 AAGGAGAATCAGAGGTAGGATGG - Intronic
1104644484 12:130487085-130487107 TGGCAAAAGCACAGTGAGGAAGG - Intronic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1104863515 12:131938642-131938664 AACCAAGAGCAGAGTGAGGAAGG - Intronic
1105050903 12:133049852-133049874 AAGCGGAAGTTGAGGGAGGAAGG - Intronic
1105284446 13:18993116-18993138 AAGCAGAAGGAAAGGAAGGAAGG + Intergenic
1106139251 13:26997830-26997852 AAACAGAAGCAGATGGAGGCTGG - Intergenic
1107559104 13:41544579-41544601 AAGCAAAACTTGAGTGAGGATGG + Intergenic
1107655509 13:42588960-42588982 ATGCAGAAGCTAAGTGAGAATGG - Intronic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1108556836 13:51601720-51601742 AGGAAGAGGCAGAGTGGGGAAGG + Intronic
1108717062 13:53091566-53091588 GAGGAGAAGCAAAGTGGGGAGGG + Intergenic
1109306319 13:60645861-60645883 AAGGAGACTCAGAGTGAGGGAGG - Intergenic
1109476909 13:62891404-62891426 AAGGAGAGGCAGAGAGAGGGAGG - Intergenic
1109587190 13:64421889-64421911 AAGCAGATGAAGAGTCAGAAAGG + Intergenic
1109985120 13:69970777-69970799 AAACAGAAGCAGGCAGAGGAAGG - Intronic
1110180183 13:72607390-72607412 AATCCGAAGCAGAGAAAGGATGG + Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111233782 13:85380891-85380913 AAGCAGCAGCAGGGTTTGGAAGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1112355635 13:98672741-98672763 AAGCAGAAACAAAGAGAGTAGGG - Intergenic
1113222025 13:108115870-108115892 AACCAGAAGCAGAGATAAGATGG + Intergenic
1113265916 13:108617889-108617911 AAGAAGAAGCAGAGTGGAAAAGG - Intronic
1113561782 13:111287182-111287204 AAGGAGAAGGACAGTCAGGATGG - Intronic
1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG + Intronic
1113942916 13:114027938-114027960 AAGCAGAGGCGGCGTCAGGAGGG + Intronic
1114650619 14:24282219-24282241 AAGCAGAAGCAGCATGATGCAGG + Intergenic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1115013119 14:28574424-28574446 AAGGAGAGGCAGAGAGATGAGGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1116543938 14:46138699-46138721 AAGCAAAAGCAGATTGAGGTTGG + Intergenic
1116654390 14:47632791-47632813 AATCAGAAGGAGAGAGAGGTTGG - Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1118710394 14:68514082-68514104 AGTCAGTAGCAGAGCGAGGATGG - Intronic
1118742837 14:68753028-68753050 ACCCTGAAGCAGAGTGAGGCTGG - Intergenic
1118766759 14:68915240-68915262 AAGAAGGAGCAGGGGGAGGAGGG - Intronic
1118849290 14:69572223-69572245 AACCTGAAGCAACGTGAGGAAGG - Exonic
1118877632 14:69798156-69798178 GAGCAGAAGCAGAGAGAGGTGGG + Intergenic
1118994495 14:70823519-70823541 AAGCAGAAGCTGAGACAGGGAGG - Intergenic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119320386 14:73726820-73726842 AAGCAGAGGCAAGGTGAGGAGGG - Exonic
1120072520 14:80120057-80120079 AAAGAGAAGCAGAGTCAGGTGGG - Intergenic
1120655856 14:87189132-87189154 AAGCAGAAGGAGAATTTGGATGG - Intergenic
1120814604 14:88842050-88842072 AGGCAGAAGGAGAGGGAGAAAGG + Intronic
1121418773 14:93797813-93797835 ACGCAGAAGCTGTGGGAGGAAGG + Intergenic
1121456404 14:94041542-94041564 AAGAAGATGCAGGCTGAGGAGGG - Intronic
1121599868 14:95195404-95195426 AAACAGAGGCAGGGGGAGGAGGG - Intronic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1122011671 14:98754345-98754367 AAGTAGAAACAGAGGGTGGAAGG + Intergenic
1122088369 14:99322327-99322349 AACCAGAAGGAGAGGGGGGACGG + Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123115279 14:105891637-105891659 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123117449 14:105901080-105901102 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123685616 15:22795022-22795044 AGGGAGCCGCAGAGTGAGGATGG + Intronic
1124203381 15:27697484-27697506 GAACAGAAGCCCAGTGAGGACGG + Intergenic
1124367190 15:29080465-29080487 CAGCAGAGGCATTGTGAGGAAGG + Intronic
1124651247 15:31475953-31475975 AAGCAAACACAGGGTGAGGATGG + Exonic
1125072443 15:35571941-35571963 GAGCAAAGACAGAGTGAGGAAGG - Intergenic
1125261033 15:37824948-37824970 AAGTAGAAGCTGAGTCATGAGGG - Intergenic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1125916657 15:43493542-43493564 AAGAAGAAGCGGCTTGAGGATGG + Intronic
1125989693 15:44094272-44094294 AAGCAGAGGGAGAGGGAGCATGG + Intronic
1126076094 15:44911250-44911272 AAGGAAAAGAAGAGAGAGGAAGG + Intergenic
1126276719 15:46892606-46892628 AATCAGAAACAGGGTGGGGAAGG + Intergenic
1126326255 15:47480647-47480669 TGGCAGAAGCAGGGTGTGGAGGG - Intronic
1126334464 15:47571074-47571096 AGGCAGGAGAAGAGTGGGGAGGG - Intronic
1126355959 15:47796220-47796242 AGTCAGAAGAAGAGGGAGGAAGG - Intergenic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126689720 15:51279970-51279992 AAGGAGAAACAGAGAGAGAAGGG + Intronic
1126885336 15:53142803-53142825 GAGCAGAAGCAGTGTAAGAAGGG - Intergenic
1127129177 15:55844177-55844199 AAGGAGAAGAAGGGAGAGGAAGG + Intronic
1127714913 15:61640592-61640614 GAGCAGAGACTGAGTGAGGAAGG + Intergenic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1127997599 15:64162756-64162778 AGACAGAAGCCGAGGGAGGAGGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128439201 15:67688184-67688206 GAGCTGAAGCAGAGTGGGCATGG + Intronic
1128586277 15:68853002-68853024 GAGCCCGAGCAGAGTGAGGAGGG + Intronic
1128674592 15:69599409-69599431 ACACTGAAGGAGAGTGAGGAAGG + Intergenic
1128740145 15:70078187-70078209 AAAAATAAGCAGAGTGAGGAAGG - Intronic
1128796468 15:70470120-70470142 ATGCAGGAGCTGAGGGAGGATGG - Intergenic
1128805245 15:70526137-70526159 AGGCAGAAGCAGAATGAGTTGGG - Intergenic
1129600446 15:76995340-76995362 AATCAGCAGCAAAATGAGGAAGG - Exonic
1129656850 15:77530094-77530116 AACCAGAAGCAGAGTGGGAGTGG - Intergenic
1129781970 15:78278255-78278277 AAGCAGAAGCATGGGGAGTAGGG + Intronic
1130042537 15:80417506-80417528 GAGAAGAAGCAGAGGGGGGATGG - Intronic
1130898353 15:88188202-88188224 AATCAGAAACAGAGAGTGGAGGG + Intronic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131670384 15:94613653-94613675 AGGCAGAACCAGAGTGAGAAAGG - Intergenic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1132057798 15:98665339-98665361 AGGCAGATGCAGAGTCAGGAGGG - Intronic
1132318148 15:100905412-100905434 AAGAACATGCAGAGGGAGGATGG + Intronic
1133366613 16:5215374-5215396 TAGAAGACGCAGGGTGAGGAAGG - Intergenic
1133470338 16:6069067-6069089 AAGCAGAAAGAGAGGAAGGAAGG + Intronic
1133867068 16:9654255-9654277 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1135892127 16:26366665-26366687 AAGCAGAGGGAGAGGGAGGAGGG + Intergenic
1136080411 16:27848882-27848904 ATGCTGTAGCAGAGTGAGCAAGG + Intronic
1136511227 16:30739255-30739277 AAGCAGAAGGAATGCGAGGACGG + Exonic
1136619883 16:31421541-31421563 AAACAGAAGCATAGAGAGAAGGG + Intronic
1136657617 16:31719982-31720004 AAACAGAAGAAGAGAGAGAAAGG + Intronic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137386499 16:48047483-48047505 AAGCAGGAGGAGGGAGAGGAAGG + Intergenic
1137504494 16:49041327-49041349 GAGCAGAAGCCCAGGGAGGAAGG + Intergenic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137844580 16:51674641-51674663 AATCAGAAGGAGAGTGAGTGAGG + Intergenic
1138274987 16:55727905-55727927 AAGACCAAGCAGAGTGAGAAGGG - Intergenic
1138280174 16:55767153-55767175 AAGACCAAGCAGAGTGAGAAGGG - Intergenic
1138288316 16:55826485-55826507 AAGACCAAGCAGAGTGAGAAGGG + Intronic
1138337849 16:56267138-56267160 AGGTAGAAGAAGAGGGAGGAGGG + Intronic
1138525464 16:57603575-57603597 AAGCTGAAGAAGTGTGAGAAGGG + Intergenic
1138828560 16:60351369-60351391 CAGCAGTGGCAGGGTGAGGATGG + Intergenic
1139282822 16:65784810-65784832 AGGCAGAAGCAGAGTGGAAAGGG + Intergenic
1139521924 16:67488033-67488055 ATGCTGCAGAAGAGTGAGGATGG + Intergenic
1139548691 16:67661665-67661687 GTGCAGAAGCGGGGTGAGGAGGG + Exonic
1140683040 16:77404044-77404066 AAGCAGAGGAAAAGGGAGGAAGG - Intronic
1141527065 16:84618324-84618346 AAGGAGAAGGAGAGAGAAGAGGG - Intergenic
1141842274 16:86580836-86580858 AAGCAGATGCAGAGAGAGAGAGG + Exonic
1141927092 16:87177096-87177118 GAGCAGGACCAGAGTGAGCAGGG - Intronic
1142255937 16:89013996-89014018 AGGCAGAGAAAGAGTGAGGAAGG + Intergenic
1142721137 17:1776691-1776713 AAGCTGAAGCTGAGTTATGAAGG + Exonic
1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG + Intergenic
1143174138 17:4947175-4947197 AAGCAGAAGCGGAGAGGGGAAGG + Intronic
1143341342 17:6213750-6213772 AAGCAGAAGAAGACTGGGCACGG - Intergenic
1143423119 17:6811745-6811767 AAGCTGAAACAGAGAGGGGAAGG - Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143805724 17:9424519-9424541 AACCAGAGGCAGGGGGAGGAAGG - Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1143964522 17:10747482-10747504 AAGCAGCAGCAGAGGGAGCGAGG - Intergenic
1144065761 17:11622764-11622786 AAGCAGCAGCAGCCTGAGAAAGG - Intronic
1144091420 17:11860345-11860367 AAGCAGAATAAGAGAGAGAAAGG - Intronic
1144118422 17:12125017-12125039 AAGCTGAAGCTGAGGGAAGAGGG - Intronic
1144133305 17:12268438-12268460 TGCCAGAAGCAGAGTGAAGATGG - Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144673582 17:17146731-17146753 AAGCAGGAAGGGAGTGAGGATGG - Intronic
1145302418 17:21649896-21649918 AGGAAGAAGCAGAGGGAGGGAGG - Intergenic
1145347902 17:22053416-22053438 AGGAAGAAGCAGAGGGAGGGAGG + Intergenic
1145415691 17:22711966-22711988 AGGAAGAAGCAGAGGGAGGGAGG - Intergenic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1146496572 17:33327964-33327986 AAGCCAAAGAAGACTGAGGATGG + Intronic
1146597343 17:34181713-34181735 AAGAAGAAGAAGAGAGAGAAAGG + Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1147203843 17:38822763-38822785 AAGAAGAAGCCAAGTGAGAAAGG + Intronic
1148128509 17:45248712-45248734 AAGGTGAAGGAGGGTGAGGAGGG + Intergenic
1148357563 17:46985848-46985870 GAGCAGAAGAAGACAGAGGAGGG - Intronic
1148554363 17:48569437-48569459 AAGCAGAAGCAGGAGGAGAAGGG - Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148778441 17:50108790-50108812 ACACAGAAGCTGAGTGAGCAGGG - Intronic
1149239052 17:54627120-54627142 CAGCAGCCGCAGAGTGAGGGTGG - Intergenic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150578608 17:66452418-66452440 GGGAAGAAGCAGGGTGAGGAGGG + Intronic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1150973363 17:70056100-70056122 AAACAGAATCAGACTGAGGAAGG + Intronic
1150997549 17:70336263-70336285 AGGCAGCATCAGAGTGAGGCAGG - Intergenic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1151768584 17:76145167-76145189 AGGCAGCAGCTGAGTGAGGATGG + Exonic
1152266277 17:79296837-79296859 AAGCAGGAGGAGGGGGAGGAGGG - Intronic
1152460774 17:80441316-80441338 AAGCTGAAGAGGAGTGAGGCTGG - Intergenic
1153010249 18:532178-532200 CAGCAGAAGCAGCGTGGGGTGGG + Intergenic
1154406897 18:14100656-14100678 AATCAGAATCAGAGTGGGTATGG + Intronic
1154957757 18:21276065-21276087 AAACAGAATGAGAATGAGGAAGG - Intronic
1155681114 18:28488128-28488150 AAGCAGAGGGAGAGAGATGATGG - Intergenic
1155807415 18:30189483-30189505 CAGCAGAAGCAGTGTTAAGAGGG - Intergenic
1155873406 18:31054888-31054910 AATCAGGAGTAAAGTGAGGAAGG + Intergenic
1156111726 18:33735668-33735690 AGGCAAAAGCAGAGGGAAGAAGG - Intronic
1156406318 18:36786080-36786102 AAGGTGAAGCAGAGACAGGAAGG + Intronic
1156451844 18:37270959-37270981 AAGCAGAACAAAGGTGAGGAAGG + Intronic
1156622890 18:38873711-38873733 AATCCGGAGCAGTGTGAGGAGGG + Intergenic
1156631536 18:38975295-38975317 AAGGAAAAGGAGAGTGTGGAAGG - Intergenic
1156683192 18:39616141-39616163 AAGCAGAAGAAGAGAGAGAAGGG + Intergenic
1157174238 18:45436760-45436782 AAGCAGAAGCTGAGTAAGGATGG + Intronic
1157175019 18:45443702-45443724 AATGAGAGGCAGAGAGAGGAGGG + Intronic
1157210804 18:45740385-45740407 ACGCTGAATCAGACTGAGGAGGG - Intronic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1157454040 18:47810355-47810377 GAGCAGAGGCACAGTGGGGATGG - Exonic
1157481040 18:48053978-48054000 GCGCAGAGGCTGAGTGAGGATGG + Intronic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157543883 18:48534201-48534223 AAGCAGAAGAAGTGAGTGGAGGG - Intergenic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1157901704 18:51524287-51524309 AGGCAGAAGGAGAGTGAGCTAGG + Intergenic
1158116618 18:54003389-54003411 AAGCAGAAGTAGAGTGTGTGTGG - Intergenic
1158679841 18:59557347-59557369 AAGCAGAAACTGAGTGATGAGGG - Intronic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1158907329 18:62026689-62026711 TAGCAGAGGCAGAGTCAGGAAGG - Intergenic
1159300976 18:66567274-66567296 AGCAAGAAGCAGAGGGAGGAAGG + Intronic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1160004791 18:75061787-75061809 GAGCAGGACGAGAGTGAGGAGGG - Intronic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1161096428 19:2394528-2394550 GAGTAGAAACAGAGTGAGGTTGG + Intronic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161248602 19:3268794-3268816 AAGCAGATGGAGAGAGAGCACGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161390640 19:4018685-4018707 AAGGAGCAGCAGAGTGATGTAGG + Intronic
1161480139 19:4506234-4506256 AGGCTGGAGCCGAGTGAGGAGGG - Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161684804 19:5697487-5697509 AGGCTGAGGCAGAGGGAGGAGGG + Intronic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161815691 19:6498543-6498565 CGGCTGAAGCAGAGTGAGGGAGG - Intronic
1162933474 19:13968766-13968788 TCGCAGAAGCAGAGGTAGGAAGG - Exonic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163166393 19:15500917-15500939 AAGCTGCAGCAGAGTGAGTGAGG - Intergenic
1163350755 19:16775371-16775393 AAGCAAAAGCAGAGGCAAGAGGG + Intronic
1164211927 19:23106145-23106167 AAGCAGAAGGAGAAGGAGAAGGG + Intronic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164718639 19:30415046-30415068 AAGCAGAAGCAGGAAGAAGAAGG - Intronic
1164743574 19:30594725-30594747 AAACAGGAGAAGAGTGGGGAGGG - Intronic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165421310 19:35723327-35723349 AGGCAGAAGAGGAGTGAGGTAGG - Intronic
1165482528 19:36073173-36073195 AAGCAGAGGAAGAGGGAAGAGGG + Intronic
1165952804 19:39483531-39483553 AACCAGAAGGGGAGAGAGGAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167307338 19:48716695-48716717 AATCAGGAGCAGAGTAAGTATGG - Exonic
1168215590 19:54923028-54923050 GAGCAGAACCAGCGTGAGGCAGG + Intergenic
1168422712 19:56215564-56215586 AACCAGGAGCTCAGTGAGGATGG - Intergenic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
924959996 2:26271-26293 AGGCAGAAGGAGAGAGGGGAAGG + Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925274763 2:2640986-2641008 GAGCAGAAGCAGAGGCAGAAGGG + Intergenic
925384081 2:3449887-3449909 AAGGAAAGGCCGAGTGAGGATGG + Intronic
925476340 2:4220952-4220974 AACCAGCAGCAGAGTATGGAAGG - Intergenic
925596021 2:5556148-5556170 AAGCGGAAGGAGTGTGAGGGAGG + Intergenic
925613046 2:5719127-5719149 AAGAAGAAGGACAGTGAAGAAGG + Intergenic
925847900 2:8050462-8050484 AAGCCCAAGCAGGCTGAGGAGGG - Intergenic
925860070 2:8166080-8166102 AAGCAGACGCAGAGAGGAGAGGG - Intergenic
926097411 2:10091208-10091230 AAGCAGAAGAAAAATGAGAAGGG + Intergenic
926244421 2:11112768-11112790 CAGCAAAAGTACAGTGAGGAAGG + Intergenic
926462420 2:13148154-13148176 GAGAAAAAGCATAGTGAGGATGG - Intergenic
926877471 2:17497814-17497836 AAGCAGAAGCAGAGTGTTGTAGG - Intergenic
927445904 2:23161373-23161395 AAGCTGAAGAACAGAGAGGATGG + Intergenic
927550014 2:23990073-23990095 AAGCCCAAGCAGTGTGAGGAAGG - Intronic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
927667896 2:25044811-25044833 GGGCAGAGGCAGGGTGAGGAGGG - Intronic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
928285671 2:29988080-29988102 CAGCAGTAGGGGAGTGAGGAAGG - Intergenic
928593064 2:32836908-32836930 AAGCACAAGAAGAGAGAGAAGGG - Intergenic
929497028 2:42454061-42454083 AATCAGAACCACAATGAGGATGG + Intronic
929898422 2:45981460-45981482 AAGCAGAAGGAGAGAGAAGATGG - Intronic
930583257 2:53238249-53238271 AAGCAGCAGCAGAGTTTGAAAGG + Intergenic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
931522910 2:63119002-63119024 AAGCTGAAGAAGAATGAGGCTGG - Intergenic
931809486 2:65840960-65840982 AAGAAGAAGCAGAGAGTAGAGGG - Intergenic
931895265 2:66721756-66721778 AAGGAGAAGAAGAGAGATGAGGG - Intergenic
931945040 2:67297030-67297052 AAGCAGAGGTAGAGTGGGGCTGG + Intergenic
932175820 2:69600703-69600725 AAGCAGCAGCAGAGTTTGGGAGG + Intronic
932688186 2:73891354-73891376 AAGACGAAGCAGAGTCAGGAAGG + Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932894174 2:75622636-75622658 AAGAAGAGACAGAGTGAGGGAGG + Intergenic
932985000 2:76715295-76715317 AAGAAGAAGAAGGGTAAGGAAGG + Intergenic
933336078 2:80961419-80961441 AAGCTAAAGCAGTGTTAGGAGGG - Intergenic
934155460 2:89195839-89195861 AAGCAGTAGGAGAATGGGGAAGG - Intergenic
934211863 2:89986919-89986941 AAGCAGTAGGAGAATGGGGAAGG + Intergenic
935098533 2:99970304-99970326 AAGCAGAAGGGGAGAAAGGATGG - Intronic
935363961 2:102270259-102270281 AGGCAGGAGCAGAGAGAGGGAGG - Intergenic
935417235 2:102831766-102831788 AAGAAAAAGAAGAGTGATGAAGG + Intronic
935494485 2:103762842-103762864 ACACAGTAGCAGTGTGAGGAGGG + Intergenic
935803125 2:106718624-106718646 AAGCTGAAGCAGTGTTAAGAGGG - Intergenic
935803229 2:106719948-106719970 AAGCTGAAGCAGTGTTAAGAGGG - Intergenic
936073465 2:109386575-109386597 AAGCAGAAACACAGAGAGGTGGG - Intronic
936703705 2:115044301-115044323 AAGGAGAAACAGAGAGAGAAGGG + Intronic
936958679 2:118049891-118049913 AAGCAGAAAGAGAATGAGTATGG - Intergenic
937073231 2:119081669-119081691 AATCAAAACCACAGTGAGGATGG - Intergenic
937270711 2:120649829-120649851 AGGCCCAAGCAGGGTGAGGAGGG - Intergenic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937783670 2:125869842-125869864 TGGCAGGAGCACAGTGAGGAAGG - Intergenic
938980548 2:136522233-136522255 AAGGAGAAGCACAGTGAGAAGGG - Intergenic
939014467 2:136886107-136886129 ATGCAGGAGCAGAGTGAACATGG + Intronic
939250150 2:139672267-139672289 AAGGATAAGCAGAGTTAGGGTGG + Intergenic
939434169 2:142152652-142152674 AAGAAGAAGCGAAGGGAGGAAGG - Intergenic
939438360 2:142208267-142208289 AAGGACAAGAAGAGTGAGAAAGG - Intergenic
939642706 2:144660181-144660203 AAGCAGCACAAGAGAGAGGAAGG - Intergenic
940032152 2:149274868-149274890 AATTAGACGCAGAGAGAGGAAGG + Intergenic
940450741 2:153833243-153833265 AAGCACAAGCATAGTGATGGTGG + Intergenic
941350305 2:164424348-164424370 AAGAAGGAACAGAGGGAGGAAGG + Intergenic
941920987 2:170850524-170850546 AGGTAGAAGCAGACTAAGGAGGG + Intronic
942202711 2:173587979-173588001 AAATAGAAGCAGAGTGAGAGAGG + Intergenic
943060950 2:183040775-183040797 AAGGAGGAGGAGAGGGAGGAGGG + Intergenic
943685474 2:190813226-190813248 CAACAGCAGGAGAGTGAGGATGG + Intergenic
944344634 2:198647388-198647410 AAACAGAAGCCGAGTGGGAAGGG + Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
944812476 2:203341161-203341183 AAGCAAAGGGAGAGTGAGCAAGG - Intronic
944876593 2:203968789-203968811 GAGCAGAGGCAGAGAGAGGAGGG - Intergenic
945705146 2:213221367-213221389 AAGCAGTAGAACAGAGAGGAAGG + Intergenic
946063414 2:216965746-216965768 AATCAGAGACAGAGAGAGGAAGG + Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
947231194 2:227888389-227888411 AAGCAGAAGCAGGATCAGGCGGG + Intronic
948721868 2:239905783-239905805 AAGAAGAAGCGGGGAGAGGAGGG + Intronic
1168915525 20:1482554-1482576 AAGGAGAAAGAGAGAGAGGAAGG - Intronic
1168977427 20:1978007-1978029 TAGAAAATGCAGAGTGAGGAAGG - Intergenic
1169336602 20:4761903-4761925 AAGCACAAGCATAGTGATGCTGG + Intergenic
1169696001 20:8387220-8387242 AAGATTAAGCTGAGTGAGGAAGG - Intronic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170207550 20:13814869-13814891 TTGCAGAAGCAGTGTGAGGGTGG - Intronic
1170345745 20:15384917-15384939 AAGCAGAGCCAGATTAAGGAGGG - Intronic
1170524208 20:17221444-17221466 AAGCAGTGGCAGACTGAGGATGG + Intergenic
1170786377 20:19471143-19471165 AAGAAGAAGCAGAGTAAGAGGGG + Intronic
1170876889 20:20258453-20258475 AAGCTGAAGCACAGCGAGGGAGG + Intronic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172887664 20:38241904-38241926 AAGAAGAGGCAGTGTGAGTAGGG + Exonic
1173313060 20:41917655-41917677 AAGGAGAGGCAGAGGGAGAAGGG + Intergenic
1174115324 20:48222998-48223020 AAGCAGGAGGTCAGTGAGGAGGG + Intergenic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174597601 20:51696499-51696521 AAGCAGAAAGCGAGAGAGGAGGG - Intronic
1174716812 20:52767584-52767606 AAGGAGAACTAAAGTGAGGATGG - Intergenic
1174950306 20:55035236-55035258 AAGCAGAAGGTGATTGTGGAAGG + Intergenic
1175319343 20:58074399-58074421 AAGCAGAAAGAGAGGGAGGAGGG + Intergenic
1175376851 20:58533648-58533670 AAACATCAGCAAAGTGAGGAGGG + Intergenic
1175498893 20:59435408-59435430 AAACAGCAGCAGGATGAGGAGGG + Intergenic
1176511308 21:7750661-7750683 AAGAAGAGGCAGTGAGAGGATGG + Intronic
1176901611 21:14449053-14449075 CAGTAGGGGCAGAGTGAGGAGGG - Intergenic
1177418847 21:20828741-20828763 AAACAGAAGCAAAGTTAGGAAGG + Intergenic
1177861534 21:26460237-26460259 AAGAAAAAGGAGAGTGAAGATGG - Intergenic
1178154730 21:29838499-29838521 GAGCAGCAGAAGAGTGAGTAGGG - Intronic
1178465541 21:32844126-32844148 AGGCAAAAGCAGACTGGGGATGG - Intergenic
1178645422 21:34381190-34381212 AAGAAGAGGCAGTGAGAGGATGG + Intronic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1179339176 21:40488250-40488272 AAGCAGAAACTCAGAGAGGAAGG - Intronic
1179598825 21:42461906-42461928 CATCAGAGGCAGGGTGAGGAGGG + Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180847732 22:18993417-18993439 AAGCAGGAGAAGAATGAGGCTGG - Intergenic
1180987471 22:19913299-19913321 CAGCTGAAGCTGAGTGAGAATGG + Intronic
1181313002 22:21955650-21955672 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1181346109 22:22221722-22221744 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181573056 22:23778263-23778285 AAGCAGAAGCTCAGAGAGGTTGG - Intronic
1181677025 22:24461808-24461830 AAACAAAAGCCCAGTGAGGAGGG + Intergenic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1181776101 22:25161113-25161135 AAGGAGAAGGAAAGTTAGGAAGG - Intronic
1182043829 22:27259126-27259148 AAGCAGCAACAGAGAGAGAAGGG - Intergenic
1182158992 22:28103165-28103187 AGGCAGAAGCAGAGAGAAGCTGG - Intronic
1182497376 22:30719188-30719210 AAAGAGAAGGGGAGTGAGGAGGG - Intronic
1182774642 22:32821834-32821856 AATCAGAAGCAGGGAGTGGAAGG - Intronic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1184047757 22:41982083-41982105 AAGCAGGATCAGAGTGGTGAAGG - Intronic
1184378984 22:44133208-44133230 AGGCAGAAGCAGAGGCATGAGGG + Intronic
1184494079 22:44827154-44827176 CAGCAGAAGCAGAGGCCGGAGGG + Intronic
1184653640 22:45930638-45930660 AGGCAGGAGCAGCCTGAGGAAGG - Intronic
1184732710 22:46379645-46379667 AAGCAGGAGAAGAATGAGGCTGG + Intronic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949611417 3:5707581-5707603 AAGGAGAAGCAGAGAGAGAGAGG - Intergenic
949934177 3:9103850-9103872 ATCCAGAAGCTGAGTGTGGAAGG - Intronic
950170532 3:10835824-10835846 AAGCAGAAACAGGGTTGGGAGGG + Intronic
950627744 3:14260529-14260551 GAGCAGGAGCAGAGAGAGAAGGG + Intergenic
950630968 3:14281747-14281769 AAGCAGGAGCAAATTGGGGAGGG - Intergenic
950644334 3:14368169-14368191 AGGCCTCAGCAGAGTGAGGAGGG - Intergenic
950659778 3:14460056-14460078 AAACTGAGGCAGAGTGAAGAAGG - Intronic
950769945 3:15303314-15303336 AAGCCGAAGCAGGCTGAGGAAGG + Intronic
950989860 3:17421968-17421990 AAGTAGAAGAGGAGGGAGGAAGG - Intronic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
952383152 3:32819582-32819604 AAGCAGCCGCAGAGAGAGAAGGG - Intronic
952847009 3:37696234-37696256 AAGCACCAGCAGAGTCAGCAGGG + Intronic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953169613 3:40495425-40495447 AAGAAGGAGAGGAGTGAGGAGGG - Intergenic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
953910719 3:46891584-46891606 AAGAAGAAGGATAGTGGGGAGGG + Intronic
954137914 3:48590616-48590638 AACCAGGACCAGAGTGAGGCAGG + Intronic
954299449 3:49691666-49691688 AGGAAGAAGCAGAGTACGGAAGG - Intronic
954799669 3:53179978-53180000 AAGCAGAAGCTCAGAGAGGCTGG - Intronic
955703123 3:61701913-61701935 AAGAGGAAGGAGAGGGAGGAAGG + Intronic
957117534 3:76045816-76045838 AAGAAGAGGAAGAGAGAGGAAGG - Intronic
957302295 3:78407945-78407967 AACCAGAAGCGAGGTGAGGAGGG - Intergenic
957386704 3:79505302-79505324 AAGAGGAAGCAGGTTGAGGAAGG + Intronic
957699636 3:83691969-83691991 CAGCAAAAGCAGTGTTAGGAGGG + Intergenic
957757029 3:84503484-84503506 AAGAAGAAGCAGAGTGAAGGTGG - Intergenic
957792777 3:84960566-84960588 AAGAAGCGGCAGAGAGAGGATGG - Intronic
957953842 3:87158796-87158818 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
958055040 3:88399421-88399443 ATGCAGGAGCAGAGTGAGTGAGG - Intergenic
958795310 3:98700842-98700864 AGTCTGAAGCAGACTGAGGAAGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959481516 3:106878448-106878470 AGGAAGAAGAAGAGGGAGGAAGG - Intergenic
959993049 3:112649697-112649719 AGGCAGATCCAGAGTGAAGAGGG - Intergenic
960294591 3:115927635-115927657 TGGCCGAAGCAGAGTGAGCAAGG - Intronic
960389773 3:117063442-117063464 AAACAGAAGCCCAGAGAGGAGGG - Intronic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
962354086 3:134678756-134678778 TAGCAGCAGCACAGTGAGGTGGG - Intronic
962417168 3:135193572-135193594 AAGCAGAAGCTGAGAGCAGAGGG + Intronic
962621665 3:137186310-137186332 AAGGAGAAGGAGAGGGAGGTAGG + Intergenic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
964108105 3:153060453-153060475 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
964245040 3:154642094-154642116 AAGCTGTAGCTAAGTGAGGAGGG - Intergenic
964367332 3:155964197-155964219 AAGGAATGGCAGAGTGAGGAAGG - Intergenic
965158031 3:165089524-165089546 GAGCAGGAGCAGAGAGAAGAAGG + Intergenic
965264904 3:166531061-166531083 AAGGAGAATTAGAGTGAAGAGGG + Intergenic
965830691 3:172784714-172784736 AAGCAAAACCAGAATGTGGACGG + Exonic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966565499 3:181376263-181376285 TAGCAAAAGCAGACTGAGAAAGG + Intergenic
966863552 3:184243814-184243836 CAGCAGGAGCAGGGTGAGGTGGG + Exonic
967818589 3:193819296-193819318 AAAGAGAAGCCGAGTGAGGCTGG - Intergenic
967826962 3:193884746-193884768 AAGCAGCAGCAGAGTCAGCTGGG + Intergenic
968391398 4:195982-196004 AAAGAGAAGCAGAGAGAGAAAGG - Intergenic
968839276 4:2989964-2989986 AGGCCAAAGCAGAGAGAGGAAGG - Intronic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
969560771 4:7946397-7946419 AAGCAGGAGCAGAAGGATGAGGG + Intergenic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
969963345 4:10969541-10969563 AAAGAGAAGGAGAGAGAGGAAGG - Intergenic
970501222 4:16679294-16679316 AAGGAGGAGGAGAGGGAGGAAGG + Intronic
971165935 4:24183680-24183702 AGGAAAGAGCAGAGTGAGGAAGG - Intergenic
971261964 4:25065474-25065496 AGGCAGCAGCAGGGTGTGGAGGG - Intergenic
971353620 4:25874504-25874526 AAGCAGAAGGAAAATAAGGAGGG + Intronic
971483400 4:27134541-27134563 AAGGAGAGGCAGAGAGAGAAAGG + Intergenic
971507879 4:27386257-27386279 TAGCTGAAGCAGAGTGAATAGGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972544896 4:40071172-40071194 AAGGAGAGGCAGAGTAGGGAAGG - Intronic
972794868 4:42405347-42405369 ATCCAGAAGAAGAGTGAGGCTGG + Intergenic
972952503 4:44344925-44344947 AAGCTGAAGAACAGTGAGGAGGG - Intronic
973019860 4:45189104-45189126 AATGAGAAGCAGAGTGTGGTTGG - Intergenic
973339911 4:48993416-48993438 TAACAGGATCAGAGTGAGGAGGG - Intronic
973544080 4:51962787-51962809 AAGAAGAAGAAGAATGAGAAAGG - Intergenic
973911515 4:55586112-55586134 CAGCAGAAGCAGATTTAAGAGGG - Intronic
973962683 4:56127522-56127544 AGGCAGAAGAAGAGAGAAGAAGG - Intergenic
975185523 4:71397792-71397814 AAGGAGAAGCAGTGTGTGAAGGG + Intronic
975202471 4:71607759-71607781 AAGCCCAAGCAGCATGAGGAGGG - Intergenic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
975365937 4:73527562-73527584 AAACAGAAGGAGAGAGAGTAGGG + Intergenic
975723486 4:77270279-77270301 AAGCAGGACCAGGGAGAGGAAGG + Intronic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976718765 4:88150416-88150438 AGGCTGAAGCAGAGTGAGGGAGG + Intronic
976818160 4:89174511-89174533 AAGAAGGGGCAGAGTGAGGATGG - Intergenic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
977578663 4:98701336-98701358 AAGCAGCAGCAGAGTGCGAGGGG - Intergenic
978247738 4:106595292-106595314 CAGAAGAAGCAGAGTGAATAGGG - Intergenic
978523293 4:109638722-109638744 AAGCAGTGGCAGAGTTTGGAGGG - Intronic
978577241 4:110199254-110199276 GAACAGAGGCAGAGTGGGGAAGG + Intergenic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
979288183 4:118950407-118950429 AAGCAGAAGCAGAGAGCAGAAGG + Intronic
979541802 4:121892075-121892097 AAGCAGGAGCTGGGAGAGGAAGG + Intronic
979562563 4:122116908-122116930 CAATGGAAGCAGAGTGAGGAAGG + Intergenic
979916245 4:126437654-126437676 AAGAAGAAACAGAGTGAAAAGGG - Intergenic
980328290 4:131377017-131377039 ACGCACAAACAAAGTGAGGAAGG - Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982900916 4:161002527-161002549 ATCCAGGTGCAGAGTGAGGAGGG + Intergenic
983739762 4:171114886-171114908 AGGGAGAAGCAGAGTGGGAATGG - Intergenic
984535741 4:180973157-180973179 AAGCAGAAGCTAAGTGAAGAGGG + Intergenic
984617284 4:181913200-181913222 ACGCAGAAGCCGAGACAGGAAGG + Intergenic
984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG + Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984781212 4:183527405-183527427 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
984797461 4:183676635-183676657 AAGGAGAAGCATGGTGAGAAAGG - Intronic
985045524 4:185936811-185936833 GAGCAGAAGCTGAGTGTGGGAGG - Intronic
985619043 5:944045-944067 AAGCAGACACAGAGAGAGGGAGG + Intergenic
985718261 5:1475120-1475142 AGGATGAAGCAGAGTGAGGCGGG + Intronic
985981983 5:3477665-3477687 AAACAGAAGCTGAGAAAGGATGG + Intergenic
986089889 5:4493604-4493626 AGGCAGGAGGAGAGAGAGGAAGG - Intergenic
986995780 5:13605526-13605548 AAGAAGAATGAGAGTAAGGAGGG + Intergenic
987088905 5:14493707-14493729 AGCCAGAAGCTTAGTGAGGAAGG + Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
988425451 5:31058380-31058402 AAGAAGAAGCAGAGTTATAATGG + Intergenic
988427375 5:31079146-31079168 AACCAGAAGCAGATGGAGGGAGG - Intergenic
988635008 5:32973712-32973734 AAGCAAAAACTGAGTGGGGAGGG - Intergenic
988717607 5:33843393-33843415 GAGCCCAAGCAGGGTGAGGAGGG + Intronic
989654444 5:43731112-43731134 AAGAAGAAGAAGAGAGAGGGAGG - Intergenic
989686241 5:44090457-44090479 AAGAAGAAGAATAGTGGGGAGGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990334411 5:54757894-54757916 GAGCAGAAGCAGAGCAAAGATGG + Intergenic
991799209 5:70341547-70341569 AGGCAGAAGCAGAGTAACAAGGG - Intergenic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992560245 5:77944886-77944908 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
992992356 5:82297261-82297283 TAGCGGAAGCAGAGAGAGAAGGG + Intronic
993522031 5:88914918-88914940 AGGCAGAAGCAGAGGAGGGAAGG - Intergenic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
994187466 5:96831193-96831215 GAGCAGGAGAAGAGAGAGGAGGG + Intronic
994285626 5:97962196-97962218 AAGCTGAAGCAGAGTAAGGCAGG - Intergenic
994302719 5:98165073-98165095 AAGCAGAAGCAGAAGGGGAAGGG - Intergenic
994926804 5:106126507-106126529 AAACAGAAGCTGGGTTAGGAAGG - Intergenic
996030669 5:118700929-118700951 AAGCAGCAGCAGATCTAGGATGG - Intergenic
996246274 5:121267370-121267392 AAGTAGAAGCAGATTTGGGAGGG - Intergenic
996488031 5:124059449-124059471 AAGCATGAGAAGAGTGAGGGAGG + Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997286548 5:132683218-132683240 AAGCAGAAGAAAAGAGAGGTGGG + Intergenic
998481880 5:142469741-142469763 ACACAAAAGCAGAGTGAGAAAGG - Intergenic
998953581 5:147415664-147415686 AAGAAGAAGCTAAGAGAGGAGGG + Intronic
999094524 5:148966135-148966157 AAGCAGAAGACTAGTGAGGCAGG - Intronic
999279278 5:150354356-150354378 AAGCAGGAACAAAGAGAGGATGG - Intergenic
999432729 5:151538105-151538127 AAAGAGAAGCAGAGAGAGGGAGG + Intronic
999809962 5:155118252-155118274 AAGAAAAAGCAGAGGAAGGAGGG + Intergenic
999812339 5:155139643-155139665 AAGCAGAGGAAGGGTGAGCAGGG + Intergenic
1000024422 5:157346491-157346513 AAACAGAGGCAGAGAGTGGAAGG + Intronic
1000250993 5:159495398-159495420 AAGCAGAAGAATAGGGAGGGAGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000325001 5:160165428-160165450 CAGCAGAAGAGCAGTGAGGAAGG + Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1000548714 5:162633252-162633274 GAGCAGAGGAAGAGTGAGAAAGG + Intergenic
1000575978 5:162975782-162975804 AAGCAGAAGCAAGGTGGAGAAGG - Intergenic
1000676579 5:164129529-164129551 AAGCAGGAGAACAGTTAGGAGGG - Intergenic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001655564 5:173346191-173346213 AAGCAGAAGGGGAGTGAAGGGGG + Intergenic
1001744648 5:174082992-174083014 AAGCAGAGGAAGCCTGAGGAAGG - Intronic
1001917181 5:175571590-175571612 ATGCAGGAGCAGGGAGAGGAAGG - Intergenic
1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG + Intergenic
1002099519 5:176850516-176850538 AGGCAGAAGGAGAGTCGGGATGG + Intronic
1002130925 5:177081230-177081252 AAGAAGAGGAAGAGTAAGGAAGG + Intergenic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1002667708 5:180838208-180838230 GAGCCCAAGCAGGGTGAGGAGGG + Intergenic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004288292 6:14343204-14343226 AAGCAGATTCAGAGGGAGCACGG + Intergenic
1004290074 6:14358745-14358767 AAACAGAAACAGAGAAAGGAAGG - Intergenic
1004370536 6:15048625-15048647 AAGCTGCAGTAGAGTGGGGACGG + Intergenic
1004813067 6:19281074-19281096 AATCAAAGGGAGAGTGAGGAAGG + Intergenic
1005141701 6:22639306-22639328 AAGCAGAAGCAATGTGATGAGGG - Intergenic
1005168686 6:22956178-22956200 TAGCAGAAGCTGGGGGAGGAGGG + Intergenic
1006053990 6:31367186-31367208 AAGCAAAAGAAGCGTGAGGTTGG + Intergenic
1006117001 6:31780825-31780847 AAGCAGGAGCACAGCGTGGATGG - Intronic
1006258667 6:32850980-32851002 AAGCAGAGGCAGGGTGATCAGGG + Exonic
1006362526 6:33594791-33594813 AGGCAGATGCAGTGAGAGGATGG - Intergenic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1006563194 6:34931532-34931554 AAGCAGAAGGGGAGAGAGTAGGG - Intronic
1006665145 6:35688445-35688467 AAACAAAAGCCCAGTGAGGACGG + Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007380655 6:41488303-41488325 AGCCAGAAGGAGACTGAGGAGGG - Intergenic
1007389376 6:41541457-41541479 AAGGAGAGGCACAGTGGGGAGGG + Intergenic
1007547942 6:42708453-42708475 AAGCTGGAGCAGTGTGAGGGGGG + Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1008085151 6:47236597-47236619 AAGCAGCAGCAGGGTGTGGGTGG - Intronic
1008537595 6:52518577-52518599 AGGCAGGAGAAGAGAGAGGAAGG + Intronic
1008663664 6:53695158-53695180 AGGCCAAAGCAGGGTGAGGAGGG + Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1009004412 6:57765185-57765207 AAGAAGATGAAGAGTGATGATGG + Intergenic
1009345308 6:62607679-62607701 AAGCTGAAGCAGTGTGGAGATGG - Intergenic
1009349054 6:62651941-62651963 AAGAAAAAGCAGAGAGAAGAGGG - Intergenic
1010181909 6:73096394-73096416 AAGCAGAATGAGAGAGAGCATGG + Intronic
1011423829 6:87203925-87203947 AAGCCTAAGCAGAGTGAGGAGGG + Intronic
1011850726 6:91625102-91625124 AGACAGAAGCAGAGTAAAGAGGG - Intergenic
1011888331 6:92125839-92125861 AAGCAAAACCAGGGTGAAGAGGG - Intergenic
1012727511 6:102833846-102833868 AAGCAGAAGCAGCGTGCTGTTGG + Intergenic
1012806168 6:103896025-103896047 AGGCAGAAGAAGAGAGAGAATGG + Intergenic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1013774183 6:113660849-113660871 AAGCTGGAGCAGATTGAGTATGG + Intergenic
1014286783 6:119508012-119508034 AAGCAGAAGCAAAGTAGAGATGG - Intergenic
1014353395 6:120372853-120372875 AAGCAGACTTAGAGTGAAGAAGG - Intergenic
1014620837 6:123665160-123665182 AAGCAGAAGCAGGGTTGGGGTGG - Intergenic
1014730273 6:125024229-125024251 AAGCAGAAGAAAAGTCGGGAGGG + Intronic
1014743099 6:125169010-125169032 AAGCAGGGGTAGAGAGAGGAAGG - Intronic
1015398204 6:132758945-132758967 AAGGAGAAGTAGGGGGAGGATGG - Intronic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015638297 6:135302761-135302783 AGGCAGAAGCAGGGGGAAGAAGG + Intronic
1016340866 6:143060632-143060654 ACGCAGGAGCAGAATGACGAAGG + Intronic
1016554345 6:145318774-145318796 AAGGAGAAACTGAGTAAGGAAGG + Intergenic
1016792364 6:148079160-148079182 AGGTAGAAGGGGAGTGAGGAAGG + Intergenic
1016919577 6:149278726-149278748 AAGGAGAAGTAGAGGAAGGAAGG + Intronic
1017075681 6:150615632-150615654 GAGAAGAATCAGACTGAGGAGGG + Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017625625 6:156345515-156345537 AAGGAGAGGGAGAGAGAGGAAGG + Intergenic
1017669517 6:156756648-156756670 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1018579145 6:165292694-165292716 AAGGAGAAGCAGAGTCAGCCTGG + Intronic
1018783663 6:167091745-167091767 AAGCAGCATCAGAGCCAGGAAGG + Intergenic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020414096 7:7925939-7925961 AAGCAGGAGCAGAGAGGGAATGG - Intronic
1020660457 7:10974665-10974687 GTGCAGAAGCAGGGTGGGGAGGG - Intronic
1021067721 7:16197577-16197599 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021067882 7:16198794-16198816 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021352287 7:19609928-19609950 AAGAAGGAACAGAGGGAGGAAGG - Intergenic
1021636397 7:22698399-22698421 AACCAGAAACAGAGTCAGGCTGG - Intergenic
1021937000 7:25640796-25640818 AAGCAGCTGAAGAATGAGGAAGG - Intergenic
1022108832 7:27215376-27215398 AAGGAGGAGGAGAGTGAAGAAGG - Intergenic
1022134999 7:27438764-27438786 AAGCTGAAGCAGAGAGATGCTGG + Intergenic
1022522537 7:31017411-31017433 AACCAGAAGCAGAGTGGGTGGGG - Intergenic
1022530230 7:31062404-31062426 AAGATGAAGTAGAGTGAGGTAGG + Intronic
1024047530 7:45595371-45595393 AGGCAGAAGGAGAGGGAGAACGG - Intronic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024603403 7:51006561-51006583 AGGCAGGAGAAGAGAGAGGATGG + Intergenic
1026093802 7:67324396-67324418 AGGCAGAAGCAGAGGAGGGAAGG + Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026545174 7:71316141-71316163 GAGCAGGAGCAAAGGGAGGAAGG + Intronic
1027587545 7:80076642-80076664 AAACCCAAGCAGAGTGAGGAGGG + Intergenic
1027631614 7:80613063-80613085 AAGTAGTAGTAGAGAGAGGAGGG + Intronic
1027707136 7:81549124-81549146 ACGCACAAACAGAGCGAGGAAGG - Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028210568 7:88069196-88069218 AAGGAGAAACATAGGGAGGAAGG - Intronic
1028427451 7:90706266-90706288 AAGCAGAAGTAAAGAGAGCAGGG - Intronic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029449240 7:100631757-100631779 AGGAGGAAGCAGAGAGAGGAAGG - Intronic
1029702377 7:102255690-102255712 AATCAGAAGCACAGTGTGTACGG + Exonic
1029856755 7:103525131-103525153 AGGCAGAAAGAGAGAGAGGAAGG - Intronic
1030021203 7:105276952-105276974 CAGGAGAAGTAGAGTTAGGATGG - Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030844586 7:114393408-114393430 GAGCCCAAGCAGAGTAAGGAAGG + Intronic
1031651444 7:124295589-124295611 AATCAGAAGCAGAGGGACCATGG + Intergenic
1031868051 7:127061610-127061632 AAGCATCAGCAGGGGGAGGAAGG - Intronic
1031894765 7:127336444-127336466 TAGCAGAAGCAGAGGCTGGAGGG - Intergenic
1032015711 7:128379246-128379268 AACAAGAAGCAGAGTGGTGAGGG + Intergenic
1032427590 7:131833946-131833968 GAGCAGAAGCCGACTGTGGAAGG + Intergenic
1032509505 7:132460784-132460806 AAACAAAAGCAGAGGGGGGATGG + Intronic
1032952247 7:136928127-136928149 AAAAAGAAGCAGAGGAAGGAGGG + Intronic
1033189001 7:139259303-139259325 AAGCGGAAGCGGAAAGAGGAAGG + Exonic
1033623791 7:143088442-143088464 GAGCTGAAGCAGGGTGAGGCAGG + Intergenic
1033801587 7:144908388-144908410 AAGGTGAAGCAGAGAGAGAAAGG + Intergenic
1034331527 7:150287319-150287341 AAGGAAAAGCAGAGTCAGGTGGG + Intronic
1034354421 7:150441866-150441888 AAGCAGAAGGAGAAGGAGAAGGG - Intergenic
1034666516 7:152822542-152822564 AAGGAAAAGCAGAGTCAGGTGGG - Intronic
1034679203 7:152915798-152915820 AAGGAGAAGGAGGGTGAGAAGGG - Intergenic
1034712194 7:153203515-153203537 GGGCAGAAGCAGAGGGAGCAAGG + Intergenic
1034889501 7:154827613-154827635 AAGCCCAAGCAGAGTGAGGAGGG + Intronic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1034950047 7:155290880-155290902 CAGGAGAAGCCGTGTGAGGACGG - Intergenic
1035224404 7:157425491-157425513 AAGCAGAGGCAGAGGGCAGAGGG + Intergenic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1036497510 8:9282889-9282911 AAGCATCAGCAAAGTGAGCAGGG + Intergenic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037044223 8:14277040-14277062 TAGCACAAACAAAGTGAGGAAGG - Intronic
1037053796 8:14410217-14410239 AGGCAGAAGGAAAGGGAGGAGGG - Intronic
1037624959 8:20598580-20598602 AACCTTAAGCAGAGTGAGGAGGG - Intergenic
1037816182 8:22113385-22113407 AAGAAGAAGGACAGAGAGGAGGG + Intergenic
1038138243 8:24814068-24814090 AAGTAGAAGGAGAGACAGGAAGG - Intergenic
1038493731 8:27987503-27987525 AAGCTGAACCTGTGTGAGGATGG - Exonic
1039337175 8:36603893-36603915 AAGAAGTAGCAGTGTTAGGAAGG - Intergenic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039566143 8:38553875-38553897 AAGCAGGAACAGAGGGAGGGGGG + Intergenic
1039580002 8:38657727-38657749 CAGCTCAAGCAGAGTGAGAATGG - Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039934339 8:42027927-42027949 TAGCAAAAGCAGAGTTAAGAGGG - Intronic
1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG + Intergenic
1040639182 8:49312407-49312429 AAGAAGAAGTAGAGAGAGAAAGG + Intergenic
1040719301 8:50297793-50297815 AAGCAAAACCAGAGAGAAGAGGG + Intronic
1042675786 8:71320052-71320074 AAGAACTAGCAGAGTGAGGATGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043420268 8:80090428-80090450 AAGAGGAAGCACAGTGGGGATGG + Intronic
1043500112 8:80845182-80845204 AATCAGTATAAGAGTGAGGAAGG - Intronic
1043930569 8:86086114-86086136 GAGCAGAAAGAGAGGGAGGAGGG + Intronic
1043973798 8:86563102-86563124 AAACAGAACAAGAGTGAGCAAGG + Intronic
1044506045 8:93020733-93020755 AATCAGATGCTGACTGAGGAGGG + Intergenic
1044644228 8:94421066-94421088 AAGCAGAGGCAGTGTGGGGGTGG - Intronic
1044726170 8:95196012-95196034 AAGTAGAAGCAGAGTCCGGGCGG - Intergenic
1045282204 8:100758800-100758822 AACCTGAAGCATTGTGAGGAAGG - Intergenic
1045457495 8:102395932-102395954 AAGCAAAAGCACATTGATGATGG - Intronic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046918919 8:119706859-119706881 AAGAAGAAAGAGAGAGAGGAAGG - Intergenic
1047120885 8:121903303-121903325 AAGCAGAAGATCATTGAGGATGG + Intergenic
1047437010 8:124843113-124843135 AAGCTAAAGCAAAGTGAGGGAGG - Intergenic
1047448752 8:124943643-124943665 AAGCAGAAAGAGAGAGAGAAAGG - Intergenic
1048182891 8:132212749-132212771 GAGGTGAAGCAGAGTGAGGCGGG - Intronic
1048317697 8:133374527-133374549 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048317703 8:133374578-133374600 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048384650 8:133900901-133900923 GAGCCTAAGCAGAGTGAGGAGGG - Intergenic
1048427127 8:134333099-134333121 ATGCAGATGAAGAGTCAGGAAGG + Intergenic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048852224 8:138656186-138656208 AAACAGAAGGAGAGTAGGGATGG - Intronic
1048941464 8:139404138-139404160 GTGCAGAAGCAGAGTGATGTGGG + Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049062579 8:140287363-140287385 GAGACGAAGCAGAGGGAGGAGGG + Intronic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049664261 8:143836013-143836035 CACCAGAAGCAGAGTGAGCTGGG + Exonic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1050538467 9:6649984-6650006 AGCCAAAAGCAGATTGAGGAGGG + Intergenic
1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG + Intergenic
1050951762 9:11605358-11605380 AAGCAGAAGCAGAGATAAGATGG - Intergenic
1051729920 9:20130545-20130567 TAGCTGAAGCAGAATTAGGAAGG + Intergenic
1052259652 9:26499272-26499294 AAAAAGAAGTAGAGTGAGGTTGG + Intergenic
1052292032 9:26852975-26852997 AGGCAGGAGCAGAGAGAGCAAGG + Intronic
1052369583 9:27648459-27648481 AAGCTAAAGCAGTGTTAGGAGGG + Intergenic
1052606637 9:30712371-30712393 AAGCAAAATAAGAGAGAGGAAGG + Intergenic
1053116521 9:35509051-35509073 AATCAGAATCAGAATGAGGCTGG + Intronic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053569322 9:39288023-39288045 AAGCAGCAGCACCTTGAGGACGG + Exonic
1053835279 9:42129053-42129075 AAGCAGCAGCACCTTGAGGACGG + Exonic
1054090954 9:60847007-60847029 AAGCAGCAGCACCTTGAGGACGG + Intergenic
1054112365 9:61122563-61122585 AAGCAGCAGCACCTTGAGGACGG + Intergenic
1054127820 9:61330987-61331009 AAGCAGCAGCACCTTGAGGACGG - Intergenic
1054595345 9:67059578-67059600 AAGCAGCAGCACCTTGAGGACGG - Intergenic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056336102 9:85570837-85570859 GAGCCTAAGCAGGGTGAGGAAGG + Intronic
1056463057 9:86826647-86826669 GGGCAGAAGAAGAGAGAGGAAGG - Intergenic
1056548887 9:87635385-87635407 AAGCAGAATGCGAGTGAGGTGGG + Intronic
1056685411 9:88754923-88754945 AAGCAGGAGTAATGTGAGGATGG - Intergenic
1056711379 9:88994514-88994536 AAGCAGCAGCAGAATGGAGAAGG + Exonic
1056789915 9:89618593-89618615 CAGGAGAAGCGGTGTGAGGAGGG - Intergenic
1056815052 9:89795114-89795136 GAGCAGGAGCAGAGCCAGGACGG - Intergenic
1056844424 9:90025065-90025087 AAGCAGAAGCCGTGTCAGGAGGG + Intergenic
1057108743 9:92446843-92446865 AAACAGAAAGAGAGTGAGGGAGG + Intronic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057241044 9:93409556-93409578 CAGCAGGAGGAAAGTGAGGATGG - Intergenic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1057445643 9:95112585-95112607 AGGCTGTACCAGAGTGAGGAGGG + Intronic
1057447141 9:95124546-95124568 AACTAGAAGGGGAGTGAGGAAGG - Intronic
1057743612 9:97733972-97733994 TGGCAGAGGCAGAGGGAGGAGGG + Intergenic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1058138493 9:101334071-101334093 GAGCAAAAGCTGAGTGATGATGG - Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058957707 9:109964375-109964397 AGGCAGAGGCAGAGGCAGGAAGG + Intronic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059080842 9:111247958-111247980 AAGCACAAGCATAGTGACAATGG + Intergenic
1059150254 9:111943062-111943084 GAGCAGAAGAAGGGTGAGGCTGG - Intergenic
1059371521 9:113843400-113843422 ATGCGGAAGGAGAGGGAGGAAGG - Intergenic
1059636077 9:116171883-116171905 AAGCAGAAGCTGATTGAAGAAGG + Intronic
1059678180 9:116560462-116560484 AACAAGAAGAAGAGGGAGGAAGG - Intronic
1059740133 9:117141977-117141999 AAGCAGGATCAGGGTGAGGTTGG + Intronic
1059741498 9:117155030-117155052 GAGCAAAAGAAGAGTGTGGAGGG + Intronic
1060048358 9:120358859-120358881 AAGCAGATGCAGGGAGAGAAAGG + Intergenic
1060214884 9:121732779-121732801 AAGCAGAAGCACAGAAAGGTTGG - Intronic
1060970883 9:127737192-127737214 CAGCAGCAGCAGAGTGGGAAAGG - Intergenic
1061561608 9:131407786-131407808 AAGCTGTGGTAGAGTGAGGAGGG + Intronic
1061865656 9:133490746-133490768 AAGGAGAAGCAGGGAGAAGAAGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1185432778 X:19150-19172 GAGCAGACGGAGAGTGACGAAGG + Intergenic
1185480223 X:440743-440765 CAGCAGCAGCAGCCTGAGGAAGG - Intergenic
1186069960 X:5808802-5808824 AAGCAGCAGGAGAGGGAGGGAGG - Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186250419 X:7660162-7660184 AAGCAGGGGGAGAGGGAGGAAGG + Intergenic
1186395304 X:9202348-9202370 AAGCTCAAGCTTAGTGAGGAAGG + Intergenic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1187270335 X:17774990-17775012 GAGCAGAAGAGGTGTGAGGATGG - Intergenic
1187320173 X:18230718-18230740 GAGCAGAAGAGGTGTGAGGATGG + Intergenic
1188039769 X:25358216-25358238 ATGAAGAGGCAGAGTGAGCAAGG - Intergenic
1188168846 X:26895618-26895640 CAGCAAAAGCAGTGTGAAGAGGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188666702 X:32831581-32831603 GAGCAGAAGGAGAGAGAGAAGGG + Intronic
1189178736 X:38983117-38983139 AAGGAGGAGGAGAGTGAAGAGGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189290544 X:39882331-39882353 AGGATGAAGCAGAGTGGGGAGGG + Intergenic
1189367202 X:40397937-40397959 AATCAGAAGCAGACAGAAGAGGG - Intergenic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1190221812 X:48516747-48516769 GAGCAGAGGTAGGGTGAGGAGGG + Intronic
1191947209 X:66547872-66547894 GAGCAGAAGCTCTGTGAGGAGGG + Intergenic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192430949 X:71111259-71111281 AAGAAGAAGTAGCGTGAGGCAGG + Intronic
1192537899 X:71944150-71944172 TGACAGAAGCAGAGTGAGGTGGG - Intergenic
1192668488 X:73113533-73113555 AAGCAGCAGCAGAGTTTGGGAGG - Intergenic
1193236484 X:79113624-79113646 AAGCAGAAGCAGGCTGAAGGTGG + Intergenic
1194265775 X:91752050-91752072 AAGCAGAAACACAGTGATCAGGG - Intergenic
1194737214 X:97526803-97526825 AAGCAGAAGCAGAGTGGGTGTGG - Intronic
1194988728 X:100521349-100521371 AAGAAGAGGGAGAGTGAGGGAGG + Intergenic
1195006686 X:100692096-100692118 AAGCAGGAGTAGATTGAGGCAGG - Intronic
1195013041 X:100752098-100752120 GAGCCCAAGCAGAGTGAGGAAGG + Intergenic
1195085235 X:101407581-101407603 AAGCAGCAGCAGAGTCGGGTGGG + Intronic
1196039828 X:111190194-111190216 AAACACAAGCAGAGTGAGGAGGG + Intronic
1197196738 X:123709952-123709974 AAGGAGAAGCAGTGTGTGCAAGG + Intronic
1197441984 X:126502737-126502759 AAGCAGTAGCAGGTTGAGGATGG + Intergenic
1197820773 X:130538839-130538861 AAGCCTAAACAAAGTGAGGAGGG + Intergenic
1198338035 X:135687697-135687719 AAGCAGAAGGAGAGGAATGATGG + Intergenic
1198741130 X:139844311-139844333 AAGGAGTAGCAGAGAGTGGAGGG + Intronic
1199538707 X:148933249-148933271 CAGCTGAAGCAGAGTAAGCAAGG + Intronic
1199675146 X:150182322-150182344 AGCCAGAGGCAGAGTGAGGAAGG + Intergenic
1199745891 X:150771768-150771790 AAGCAAAAGGAAAGTGAGGAAGG + Intronic
1200250103 X:154548217-154548239 TAGCTGGAGCAGAGTGAGGGAGG + Intronic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201730081 Y:17193246-17193268 AAGAAGAAGCAGAGTGTGAAGGG + Intergenic