ID: 1188315707

View in Genome Browser
Species Human (GRCh38)
Location X:28670581-28670603
Sequence GAGGGTGGTAGAGCTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 335}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188315707 Original CRISPR GAGGGTGGTAGAGCTGTGGC AGG (reversed) Intronic
900242940 1:1625518-1625540 GCGGGTCATGGAGCTGTGGCTGG - Intronic
901404818 1:9038936-9038958 GAGGGTGGCAGGGCTCAGGCGGG + Intronic
901764291 1:11490107-11490129 GAGGGTGGGAGAGATGTCGGGGG + Intronic
901828869 1:11880054-11880076 CAGGGTGCTGGTGCTGTGGCGGG - Intergenic
902226165 1:14997701-14997723 GAGGGTGGAGGAGCAGGGGCTGG + Intronic
903422108 1:23225431-23225453 GGGGATGGCAGAGCTGAGGCCGG + Intergenic
903445114 1:23418080-23418102 GGTGGTGGTAGAGCTGGGGCAGG - Intronic
904418350 1:30376084-30376106 GAGGGAGCCTGAGCTGTGGCTGG - Intergenic
904753199 1:32753953-32753975 GGGCGTGGTCGAGCTGGGGCTGG + Intronic
905225394 1:36475452-36475474 GAGTGTGGTTGAGGTGGGGCAGG + Exonic
905244898 1:36605937-36605959 GAGGGAGGCAGAGATGGGGCAGG + Intergenic
905461714 1:38126576-38126598 CAGGGAAGTAGAGCTGGGGCTGG + Intergenic
905693316 1:39958035-39958057 GTGGGTGTTAGAGCTGGGGTTGG + Intronic
906306550 1:44723726-44723748 GTGGGTGGGAGACTTGTGGCAGG - Intronic
906415697 1:45620119-45620141 GGAGGTGGTAAAGCTGTGGTTGG + Exonic
906940610 1:50252089-50252111 GAGGCTGCTGGAGCTGAGGCTGG + Intergenic
907272884 1:53301008-53301030 GAGGGTGCTCGAGGTGTGGGGGG + Intronic
909394743 1:75156959-75156981 GAGGGTGGGACTGCTGTGACTGG - Exonic
909849367 1:80441074-80441096 GAGGGAGGTAAAGATGTGGAAGG - Intergenic
911047416 1:93639802-93639824 GAGGGAGGGAGACCTGGGGCTGG + Intronic
912509956 1:110182569-110182591 GAGGGCGGGATAGCTGTGGGTGG + Intronic
912756014 1:112325409-112325431 GAAGCTGGTAAAACTGTGGCTGG - Intergenic
913522035 1:119653802-119653824 GAGAGTGGAAGAGCTGAGACAGG + Intergenic
914915116 1:151814869-151814891 GAGGGTGGTAGAGATGAGGGAGG - Intronic
915079021 1:153338582-153338604 GAGTGTGGTAGAGCTGATGCTGG - Intronic
915226604 1:154416535-154416557 GAGGGAGGAGGAGCTGGGGCAGG + Intronic
916442603 1:164842208-164842230 GAGGGTGGTAGAGAAAAGGCAGG + Intronic
916824672 1:168432049-168432071 GTGGGTGGAGGAGCTGTGGGTGG + Intergenic
919572357 1:199264503-199264525 GAGGGTGGAAGAGCTTAGTCAGG + Intergenic
921046993 1:211484859-211484881 GAGGGTGGCACAGAGGTGGCTGG - Intronic
923230679 1:231983552-231983574 GGGGGAGGTAGAGGAGTGGCAGG + Intronic
924575683 1:245278772-245278794 GCGTGTGGCAGAGCTGGGGCTGG - Intronic
1062946509 10:1465768-1465790 GGGGGTGGGAGAGGTGTTGCTGG - Intronic
1067270514 10:44787804-44787826 GAGGAAGGTAGGACTGTGGCTGG - Intergenic
1068149686 10:53116211-53116233 GAGGCTGGTATGGCTGGGGCTGG - Intergenic
1069658251 10:70106193-70106215 GAGGGTGGCAGTGCTGCTGCTGG - Intronic
1069799810 10:71075109-71075131 GGAGGTGGCAGAGCTGGGGCCGG + Intergenic
1070596559 10:77836756-77836778 GAGGGTGACAGTGCAGTGGCAGG + Intronic
1070837445 10:79458773-79458795 GAGGGTGGGGGAGCTTTGGTGGG - Intergenic
1070956097 10:80464600-80464622 AAGGGTGGGAGAGCCATGGCAGG - Intronic
1071490904 10:86135660-86135682 GTGAGTGGAAGAGTTGTGGCAGG - Intronic
1071787984 10:88924418-88924440 AAGGCAGGGAGAGCTGTGGCTGG - Intronic
1072558788 10:96549040-96549062 GAGAGTGGTAAGGCTGTGGCAGG - Intronic
1072745646 10:97937372-97937394 CAGGGTGGTGGTGCAGTGGCGGG - Intronic
1072778535 10:98225950-98225972 CAGGGTGGGAGTGCTGAGGCCGG - Intronic
1075072221 10:119326966-119326988 GAGGGTGGTGGAGGTGGGCCAGG + Intronic
1075810542 10:125221861-125221883 GAGGGTGGGGAGGCTGTGGCTGG - Intergenic
1076146789 10:128128358-128128380 GAGGGTGGAAGAACTGTCTCTGG - Intergenic
1077327726 11:1970945-1970967 GAGGGTGGCAGGGGTGGGGCAGG + Intronic
1078153145 11:8776062-8776084 GAGGGTGGTAGGGCCAGGGCTGG - Intronic
1079467277 11:20742863-20742885 GGAGGTGGAAGAGCTGTGGCAGG + Intronic
1079784489 11:24654612-24654634 GGGGGTGGGAGTGCTGAGGCAGG - Intronic
1083153650 11:60809502-60809524 GTGAGTGGTAGAGCTGGGTCAGG + Intergenic
1083713058 11:64560447-64560469 GAGGCTGGTGGAGCTGGGGGTGG - Intronic
1083729729 11:64646257-64646279 GAGGGAGGGAGAGTTGGGGCTGG - Intronic
1084218904 11:67666047-67666069 GAGGGTGGGAGGGTTGTGGAGGG - Intronic
1084651626 11:70492697-70492719 GAAGGTGGCCGAGCTGTGGAGGG - Intronic
1085444050 11:76589110-76589132 AACGGGGGCAGAGCTGTGGCAGG - Intergenic
1085510097 11:77083818-77083840 GAGGGTGGTACCACTGGGGCTGG + Intronic
1085885050 11:80512051-80512073 GAGGGTGGTAGAGATGTGTATGG + Intergenic
1086772155 11:90779946-90779968 GATGGGTATAGAGCTGTGGCTGG + Intergenic
1089744616 11:120607987-120608009 GAGGGTGGAAAAGCTTTCGCTGG + Intronic
1090397571 11:126429363-126429385 GAGGGTGGCAGGGCAGGGGCAGG - Intronic
1090950820 11:131471765-131471787 GAGGGTGGAAGAGCTGCTCCTGG + Intronic
1091232612 11:133998456-133998478 GAGGGAGGTAGAGCTGCCCCTGG + Intergenic
1202810708 11_KI270721v1_random:26125-26147 GAGGGTGGCAGGGGTGGGGCAGG + Intergenic
1092137792 12:6161702-6161724 CAGGGTGGAACAGCTGGGGCTGG - Intergenic
1092162792 12:6325140-6325162 GAAGGTGGCAGAGCTGAGGTTGG - Intronic
1093302147 12:17471257-17471279 TAGGGTGGGGGAGCTGAGGCTGG - Intergenic
1094462937 12:30717400-30717422 GAGGTTAGCAGAGCTGTGGAGGG + Intronic
1097248001 12:57617144-57617166 GTGGGTGGGAGGGCTGGGGCAGG + Exonic
1098781377 12:74691062-74691084 GAGGTTGGGGGAGCTGAGGCGGG + Intergenic
1099196327 12:79620628-79620650 AAGGGTGATAGAGCTCTAGCAGG + Intronic
1099533502 12:83817450-83817472 GAGAGTGGTAGAGATGGGGCTGG - Intergenic
1100429630 12:94519113-94519135 GAGGGAGCAAGAGCGGTGGCGGG + Intergenic
1102992832 12:117327277-117327299 GAGGGTGGTAGAGGATTGGGAGG + Intronic
1103555112 12:121761583-121761605 GAGGGTGGGATGGCTGTGCCTGG + Intronic
1103920359 12:124396164-124396186 GGGGCTGGTAGGGCTGGGGCGGG + Intronic
1104960593 12:132486887-132486909 GTGGGTGGCACAGCTGAGGCTGG + Intergenic
1107798422 13:44079471-44079493 GTGGTTGGGAAAGCTGTGGCAGG + Intergenic
1110019156 13:70447384-70447406 AAGGGTGGTAGAGATGAAGCAGG + Intergenic
1112585493 13:100715639-100715661 GAGGGCGGTATAGCTGTGGGAGG - Intergenic
1113534070 13:111050288-111050310 GAGGGGTGTGGAGCTGGGGCGGG + Intergenic
1113536342 13:111069335-111069357 GAAGGTGATGGAGCTGTGGGAGG + Intergenic
1113892447 13:113743525-113743547 GAGGGTGGCAGAGCTGGAGCAGG + Intergenic
1114215318 14:20653722-20653744 GGGGGTGGGAGAGCAGTGGAAGG - Intergenic
1118166788 14:63344610-63344632 GAGGCTGATAGAGCTGAGTCGGG - Intergenic
1120261675 14:82193085-82193107 GAGTGTGGGAGAGTTGAGGCTGG - Intergenic
1121273543 14:92652858-92652880 GAAGGTGGTGGAGCTGGCGCAGG + Exonic
1122180631 14:99951688-99951710 CAGGGTGGTAGTGATATGGCTGG - Intergenic
1122491076 14:102116651-102116673 GGAGGAGGTAGAGCTGTGCCTGG + Intronic
1122970315 14:105149790-105149812 GAGGGTGGTAGGGAGGTGGGTGG + Intronic
1123627622 15:22238628-22238650 GAGGGAGGGAGAGCTTGGGCAGG - Intergenic
1124208393 15:27742518-27742540 CACGATGGCAGAGCTGTGGCCGG + Intergenic
1125717268 15:41826486-41826508 CAGGGTGGTGAAGCTGAGGCAGG - Exonic
1127632915 15:60842919-60842941 GGTGGTGGAAGAGCTGGGGCTGG + Intronic
1127774436 15:62254240-62254262 GAGGCTGCTGGAGCTGGGGCGGG - Intergenic
1127865321 15:63027980-63028002 GAGGGTGGCAGAACTGGGGGTGG - Intergenic
1128111543 15:65079322-65079344 GAGGATGGTAGAGCACTGACAGG - Intergenic
1128425815 15:67541743-67541765 GGGGGTGGTAGTGCTGAGGCAGG + Intergenic
1129111673 15:73340686-73340708 GAGAGTGGGAGGGCAGTGGCAGG - Intronic
1129338965 15:74872719-74872741 GCTGGTGGTGGAGCGGTGGCAGG + Intronic
1130014965 15:80179582-80179604 GAGCGAGGGAGAGCTGTGGGCGG - Intronic
1130274122 15:82467720-82467742 GAGGGGGGGAGATCTGTGCCGGG - Intergenic
1130294703 15:82637405-82637427 AAAGGTGTGAGAGCTGTGGCAGG - Intronic
1130466468 15:84195094-84195116 GAGGGGGGGAGATCTGTGCCGGG - Intergenic
1130497796 15:84478442-84478464 GAGGGGGGGAGATCTGTGCCGGG + Intergenic
1130588764 15:85199687-85199709 GAGGGGGGGAGATCTGTGCCGGG - Intergenic
1131059638 15:89396841-89396863 GAGGGTGGTAGTGATGTTGCTGG + Intergenic
1132688408 16:1171758-1171780 GAGGGTGGCAAAGTTGTGGACGG - Intronic
1132763602 16:1523529-1523551 GAGGGCGGTAGAGCTGCTGCTGG - Exonic
1132793817 16:1708372-1708394 GAGTGTGGGAGAGCAGTGGAGGG - Intronic
1132933792 16:2471291-2471313 GAGGGCGGACGAGCTGTGCCAGG - Intergenic
1133447732 16:5876573-5876595 GAGGCTGGTTTAGCTGTAGCAGG - Intergenic
1133650608 16:7809448-7809470 GAAGGTGCTTGAGCTGTGGTGGG + Intergenic
1134080081 16:11319093-11319115 GAGGATGGAGGAGCTGGGGCTGG + Intronic
1135071490 16:19355954-19355976 GAGGGTGGAAGAGTTGGGGAGGG + Intergenic
1135233354 16:20730516-20730538 GAGGGAGGTACAGATGTGGGAGG - Intronic
1136278346 16:29192408-29192430 GAGTGTGGGAGAGCTCAGGCTGG + Intergenic
1136478836 16:30528929-30528951 TACGGTGTCAGAGCTGTGGCTGG - Intronic
1136540679 16:30926194-30926216 GGGGGTGATAGAGCAGGGGCTGG - Intronic
1137709039 16:50553912-50553934 GAGGCTGGGAGAGCTTGGGCTGG + Intronic
1137840699 16:51638263-51638285 GGGGGTGGTAGAGCTGGGAGAGG - Intergenic
1139296798 16:65908335-65908357 GTGGGTGGAAGAGTTGTGGTGGG - Intergenic
1139366919 16:66439196-66439218 GAGGGTGGTGGAGCTCGGCCTGG + Intronic
1139751920 16:69114140-69114162 TAGGGAGGTAGAGCTGGTGCTGG + Intronic
1140127264 16:72128509-72128531 GAGGGAAGTAGAGCTGTAGGTGG + Intronic
1140723175 16:77788972-77788994 GGGGGTGGGAAAGCTGCGGCTGG + Intronic
1141605334 16:85149955-85149977 GACGGGGGCAGAGCTGTGTCTGG + Intergenic
1141681983 16:85550260-85550282 GTGGGTGGCAGAGCTGGGGTTGG - Intergenic
1141721154 16:85756058-85756080 AAGGGAGGCAGAGCTGTGGGGGG - Intergenic
1142071370 16:88092679-88092701 GAAGGTGGAAGAGCTGAGGAGGG + Intronic
1142082725 16:88158442-88158464 GAGGGTGGGAGAGCTCAGGCTGG + Intergenic
1142124534 16:88403595-88403617 GAGGGTGGCAGAGCAGCTGCTGG + Intergenic
1142483599 17:233228-233250 GCGGGGGGTAGAGCAGTGGCTGG - Intronic
1142962187 17:3557869-3557891 GCGGGTGCTGCAGCTGTGGCTGG - Intronic
1144755179 17:17675741-17675763 CACGGTGGCAGAGCTGGGGCAGG + Intergenic
1145046221 17:19618938-19618960 AAGGGTGGTGATGCTGTGGCTGG - Intergenic
1145984775 17:29038106-29038128 GGGGGTGGGAGAGCTGAGCCAGG - Intronic
1147986778 17:44311615-44311637 GTGGGTGGCAGAGCAGGGGCGGG - Intronic
1148787783 17:50153870-50153892 GGGTGTGGGAAAGCTGTGGCAGG - Intergenic
1148800566 17:50222367-50222389 GGGGTGGGGAGAGCTGTGGCTGG - Intergenic
1151681980 17:75627133-75627155 GAGGGTGGTGGAGCTGCTGCTGG - Exonic
1152279099 17:79374965-79374987 GAGGTGGGTAGGGCTGGGGCAGG - Intronic
1152614438 17:81331325-81331347 GAGCGTGGGAGAGCTGGGACGGG - Intergenic
1154383903 18:13876246-13876268 GAGGGTTTGAGAGCTGTTGCAGG + Intergenic
1155414385 18:25581628-25581650 CAGGGAGATAGAGCTTTGGCTGG - Intergenic
1156244204 18:35282646-35282668 GAGGATGGTAGAGTAGTTGCAGG - Intronic
1157275858 18:46310831-46310853 GAGGGTGGCAGAGCTGGGCCTGG + Intergenic
1157785847 18:50481922-50481944 GAGGGTGGTGGAGCTTGGGATGG - Intergenic
1158243217 18:55401537-55401559 GAGGGTGGAAGAGAGGTGGATGG - Intronic
1158494871 18:57945843-57945865 TCTGGTGGTAGAGCTATGGCTGG + Intergenic
1159913792 18:74171306-74171328 GAGCCTCGCAGAGCTGTGGCAGG - Intergenic
1160328788 18:77973770-77973792 GAGGGTGGCACAGCTGTGCGGGG + Intergenic
1160744258 19:703487-703509 GATGGTGTTTGAGCTGGGGCAGG + Intergenic
1161297683 19:3527955-3527977 GTGGCTGGGAGGGCTGTGGCTGG - Intronic
1161299945 19:3537719-3537741 GAGGGTGAAGGAGCTGGGGCAGG + Intronic
1161391860 19:4025291-4025313 GAGGACGGTTGAACTGTGGCAGG + Intronic
1162046097 19:8001389-8001411 GATGGTGGCAGAGAGGTGGCAGG - Intronic
1163364522 19:16868649-16868671 GAGGCTGGAGGAGCTGTGGAGGG + Intronic
1165305121 19:34999000-34999022 GAGTGAGGTACAGCTGGGGCAGG + Intronic
1165423205 19:35732436-35732458 GGGGGTGGTGGAGATGGGGCCGG - Exonic
1166315675 19:41988224-41988246 GAGGGAGGAGGGGCTGTGGCTGG - Intronic
1166882199 19:45936403-45936425 CAGGGTGGGAGGGCTGTGGAAGG + Exonic
1166939745 19:46355538-46355560 GATGGGGGCAGAGATGTGGCGGG + Intronic
1167959584 19:53095189-53095211 GAGGGTGGAACTGCTGTGGGCGG - Intronic
1168236598 19:55067522-55067544 GGGGGTGGAAGGGCTGAGGCGGG + Intronic
925029922 2:642516-642538 GTGGCTGGTGGAGCTGGGGCTGG + Intergenic
925792850 2:7510509-7510531 GAGGGTGGTAGAGACATTGCAGG + Intergenic
925969576 2:9096945-9096967 GAGGGTGGGGGCGCAGTGGCAGG + Intergenic
926226147 2:10968251-10968273 GAGGGGAGGAGAGGTGTGGCCGG + Intergenic
926418667 2:12675714-12675736 GAGGGTGGGAGGGGTGTGGTGGG - Intergenic
926586685 2:14693809-14693831 GAGAGTGGTAGAGTTTTGGGAGG - Intergenic
926744493 2:16139532-16139554 GGGGGTGGTGGATATGTGGCAGG + Intergenic
927445788 2:23160425-23160447 GAAGGAGGAAGAGCTGAGGCAGG + Intergenic
927518714 2:23686775-23686797 GAGGTTTGTAGAGATGGGGCTGG + Intronic
927561454 2:24076827-24076849 GAGGGTGGTGGCGGTGGGGCGGG + Intronic
927561512 2:24076999-24077021 GAGGGTGGTGGAGGTGCGGCGGG + Intronic
929541316 2:42824604-42824626 GCGGGGGGCAGAGATGTGGCTGG + Intergenic
929720346 2:44361746-44361768 GAGGATGAGAGAGCTGTGGCAGG - Intronic
930271420 2:49262174-49262196 GTGGGTGGTAGAAGAGTGGCAGG - Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932186558 2:69701667-69701689 GAGGGTGGGGGAAATGTGGCTGG - Intronic
933878994 2:86649067-86649089 TAGGGAGGTAGAGCTGATGCAGG + Intronic
935535977 2:104295078-104295100 GAGGGTGGTACACCTGTGGAGGG - Intergenic
937152626 2:119696410-119696432 GTTGGTGGTAGGGATGTGGCAGG - Intergenic
937991143 2:127663248-127663270 GAGTGTGGCAGAGCTGGAGCAGG - Intronic
938643376 2:133306139-133306161 GAGGGTGGTAGCATTGGGGCTGG + Intronic
941089209 2:161155204-161155226 GTGGGTGGGAGAGAGGTGGCAGG - Intronic
943296802 2:186150725-186150747 GAGGCTGGTAGAGCAGTTGGGGG - Intergenic
944530678 2:200664931-200664953 GAGGCTTGTCAAGCTGTGGCTGG + Intronic
944532112 2:200677440-200677462 GAAGGAGGCAGAGCTGTGGGAGG - Intergenic
946155959 2:217806778-217806800 GAGGCTGGAAGAGCAGAGGCAGG - Intronic
947611011 2:231525157-231525179 GAGGCTGTGGGAGCTGTGGCGGG + Exonic
948771149 2:240251827-240251849 GAGGGAGGGAGAGCTGGGGCGGG - Intergenic
1168895360 20:1320102-1320124 GAGGGAGGGAGAGCTGGGCCTGG + Intronic
1170400687 20:15979855-15979877 GAGAATGGTTGAGCTGTAGCAGG + Intronic
1170943231 20:20866445-20866467 GTGAGCGGTAGAGCTGGGGCTGG - Intergenic
1170968951 20:21101359-21101381 GAGGGTGGTCGCGGTTTGGCGGG - Intergenic
1171425645 20:25046951-25046973 GAGGCTGGTGGAGCTGTGATGGG + Intronic
1171811689 20:29749930-29749952 GAGCGTGGTGGCGCTGAGGCAGG + Intergenic
1172602831 20:36195599-36195621 GAGGGTGGGAGGGCTGAGGGAGG - Intronic
1173181739 20:40811448-40811470 GGGGGTCATATAGCTGTGGCTGG + Intergenic
1173333110 20:42092078-42092100 GAGGGTGGAAGAGCTGAGAAGGG + Intronic
1175536879 20:59721002-59721024 GATGGAGGTGGTGCTGTGGCTGG + Intronic
1175774469 20:61644423-61644445 CAGGATGGTAGAGCTGTCGAAGG - Intronic
1175889368 20:62309587-62309609 GAGGGTGGTAGGGGGGTGGGAGG + Intronic
1177744017 21:25188649-25188671 GAGGGGTGTCGAGCTCTGGCTGG - Intergenic
1178692686 21:34762809-34762831 GTGGCTGGTGGGGCTGTGGCTGG - Intergenic
1179371220 21:40807718-40807740 GAGAGTGGTCAAGCTCTGGCAGG + Intronic
1180699400 22:17773502-17773524 GAAGGTGGAAGAGCTCTGGGTGG + Intronic
1180784102 22:18537264-18537286 GAGGAGGGTGGCGCTGTGGCTGG + Intergenic
1181127670 22:20711313-20711335 GAGGAGGGTGGCGCTGTGGCTGG + Intronic
1181241003 22:21476616-21476638 GAGGAGGGTGGCGCTGTGGCTGG + Intergenic
1181370761 22:22414930-22414952 GAAAGAGGCAGAGCTGTGGCAGG + Intergenic
1181988755 22:26820699-26820721 GAGGGTGGAAGAGAAATGGCTGG + Intergenic
1182295060 22:29307452-29307474 GAAGGTCGCAGAGCTGTGGGTGG - Intronic
1184687505 22:46103302-46103324 CAGGGCGGCCGAGCTGTGGCTGG - Intronic
949336282 3:2978804-2978826 GAGGATGGCAGAGCTGTCACAGG - Intronic
950172731 3:10850840-10850862 GGGAGTGGTGGGGCTGTGGCAGG + Intronic
950222491 3:11206892-11206914 TAGGGTGGGAGAGCTGAGGAGGG + Intronic
950568445 3:13785700-13785722 GAGGGTGGCAGGGATGTGCCTGG - Intergenic
951854163 3:27176492-27176514 GAGTGTGGCAGAGCTGAGGCTGG - Intronic
953358840 3:42277492-42277514 GAGGGTGGTATAGAGGTGACAGG + Intergenic
953676315 3:45005743-45005765 TAGGGTGGTTGAGTAGTGGCAGG + Intronic
954301126 3:49701379-49701401 GGTGGTGGGAGAGCTGTGGTAGG + Intronic
955207355 3:56908354-56908376 GAGGCTGGTCAAGCTGTGGGTGG - Intronic
955357313 3:58241742-58241764 CAGGGTGGTGGAGGTATGGCAGG + Intronic
955825159 3:62938251-62938273 GGGGGTTGGAGAGCAGTGGCAGG + Intergenic
957264470 3:77944494-77944516 GAGGATGGAAGGGCTATGGCGGG + Intergenic
960968789 3:123124406-123124428 GAGGGTCGCAGGGCTCTGGCTGG + Intronic
961222687 3:125212675-125212697 GAGGGCGGAAGGGCTGTGGGGGG - Intronic
961370143 3:126423817-126423839 GAGGGTGGTGGAGCTGGGGGTGG + Intronic
965179912 3:165388830-165388852 GTTGGTGGAAGAGCTGAGGCAGG - Intergenic
966421505 3:179739065-179739087 GAGGGTGGTATAACAGTTGCGGG - Intronic
968744705 4:2353685-2353707 GAGGCTGGGAGAGCGGGGGCAGG - Intronic
969449895 4:7266971-7266993 GGGGGTGGGGGAGGTGTGGCAGG + Intronic
969607144 4:8207996-8208018 CAGGGTGGTTCAGCAGTGGCGGG + Intronic
970698588 4:18708379-18708401 GAGAGTGCTAGGGATGTGGCTGG - Intergenic
972323865 4:37996782-37996804 GATGGTGACAGGGCTGTGGCTGG + Intronic
979515876 4:121609525-121609547 GAGGGTGGTTCAGATGTAGCAGG - Intergenic
982257876 4:153467227-153467249 GAACGTGGTGGAGCTGTGGCAGG + Exonic
982675970 4:158376194-158376216 CAGGGAGGTAGAGCTGTGAAAGG + Intronic
983537928 4:168878019-168878041 GAGGCTGGACGAGCTGGGGCTGG - Intronic
984003732 4:174283574-174283596 GAGGGTCGTAGTGCTGTTTCTGG - Exonic
985440439 4:189979862-189979884 GAAGCTGGGAGAGCTGTGGAGGG - Intergenic
985780731 5:1869513-1869535 GAGGCTGGGAGTGCAGTGGCCGG + Intergenic
988560279 5:32274666-32274688 GAGGGTGGTCATGCTGTGGAAGG - Intronic
990198012 5:53340810-53340832 GTAAGTGGCAGAGCTGTGGCTGG - Intergenic
990382547 5:55231617-55231639 GGGGGTGGCAGAGCTGAGTCTGG - Exonic
990921112 5:60968846-60968868 GAGGGTAGTAGAGGGGTGGTGGG - Intronic
991478264 5:67047311-67047333 GAGGATGGTAGAGCCATGGCAGG - Intronic
992144842 5:73835540-73835562 GAGGGTGGTGCACCTGTGGAGGG + Intronic
992386764 5:76292134-76292156 GAGGCTGGTATGGCTGGGGCTGG - Intronic
993301619 5:86218465-86218487 GTGGGTGGCAGAGAGGTGGCTGG + Intergenic
994540256 5:101086099-101086121 GAGGGTGGTAGAACTATTACTGG + Intergenic
995106731 5:108383251-108383273 AAGGGTGGAAGAGAAGTGGCAGG + Intergenic
997212512 5:132085804-132085826 GATGGTGGGAGTGCTGTGGCTGG - Intergenic
998675637 5:144404732-144404754 GACTGTGGTAGAGAGGTGGCAGG + Intronic
998962707 5:147505801-147505823 AAGGGTTCTAGAGGTGTGGCAGG + Intronic
999794973 5:154980799-154980821 AAGGGTGGAAGAACTGTGGAAGG + Intergenic
1001742999 5:174069041-174069063 GAGGGTGCTGGTGCTGTGGAAGG + Intronic
1002106418 5:176881438-176881460 GATGGTGCTAGAGGTGTGCCAGG - Exonic
1002718780 5:181245781-181245803 GAGGGTGGCAGAGCTGCCGGAGG + Intronic
1004498896 6:16191383-16191405 GAGGGTTGTGGAACTGTGGATGG + Intergenic
1005522555 6:26613583-26613605 GGGGGTGGCAGAGCTGGGGCTGG - Intergenic
1006109003 6:31733734-31733756 GATGGTGGTGGGGCTGGGGCAGG - Intronic
1006131195 6:31870513-31870535 GGGGGTGCTAGAGAGGTGGCAGG - Intronic
1006320256 6:33315733-33315755 GAGGGTGGGGGTCCTGTGGCAGG - Exonic
1006392659 6:33767801-33767823 GAGGGTGGATGAGCCCTGGCTGG - Intergenic
1006799129 6:36748301-36748323 GAGGGAGGCAGGGCTGTGGGAGG + Intronic
1007079494 6:39088904-39088926 GAGGGTGGTTGAGCTGGGCCAGG + Intergenic
1007255347 6:40524394-40524416 GTGTGTGTTAGAGGTGTGGCGGG - Intronic
1008428259 6:51384246-51384268 GTGGGAGGTAGAGTTGTTGCTGG - Intergenic
1008960730 6:57262875-57262897 GGGGTTGGGAGAGCTGTGGAGGG - Intergenic
1009952724 6:70414494-70414516 GAGGGTGGAAGAGTTTTGGAGGG - Intronic
1012514960 6:100048709-100048731 GAGAGTGGTAGAGATGGTGCAGG + Intergenic
1012852855 6:104467993-104468015 GATGGTGGTGGAGGTGAGGCTGG - Intergenic
1012891671 6:104904018-104904040 AAGGGTGGAAGATCTGTGTCTGG + Intergenic
1013553369 6:111232436-111232458 GAAGGTGGTAGAGCTGTATGGGG - Intergenic
1014147677 6:118016883-118016905 GAGGGTGGTAGAAATTTGGAAGG - Intronic
1014801312 6:125780937-125780959 GAGGCTGAGAGAGCTGTGGGTGG + Intergenic
1014949793 6:127541468-127541490 GAGCCTGGGAAAGCTGTGGCTGG + Intronic
1015667930 6:135652477-135652499 GAGGGGGGCAGAGCTGAGGCAGG - Intergenic
1016841926 6:148533528-148533550 GAGGGTGGAGGGGCTGTGACCGG + Intronic
1017214426 6:151893764-151893786 GAGGCTGCTGGAGCTGAGGCTGG + Intronic
1017724420 6:157267280-157267302 GTGGGTGGCAGTGCAGTGGCTGG - Intergenic
1019167417 6:170107947-170107969 GAGGAAGGTGGACCTGTGGCTGG + Intergenic
1019227305 6:170523909-170523931 GTGGGTGATTGATCTGTGGCAGG + Intergenic
1019314610 7:378783-378805 CAGGCCGGCAGAGCTGTGGCTGG + Intergenic
1019420051 7:946552-946574 GAGGGTGGGAGGGCAGGGGCAGG - Intronic
1019437239 7:1028459-1028481 GGGGGTGGGAGAGCCGGGGCGGG + Intronic
1019701765 7:2477647-2477669 GAGGGTGGGACTGCTGAGGCCGG + Intergenic
1019791091 7:3014373-3014395 GAGGGTGAGAGGGCAGTGGCAGG + Intronic
1020129853 7:5553587-5553609 CAGGGTGTCAGGGCTGTGGCTGG - Intronic
1021838738 7:24705680-24705702 CTGGGAGGCAGAGCTGTGGCTGG - Intronic
1022597041 7:31722670-31722692 GATGGTGGGAGAGCTGTTTCAGG + Intergenic
1023735655 7:43234172-43234194 CAGGGTGGGAGAGGTGTGGGTGG - Intronic
1025024075 7:55501834-55501856 GAGGGTGGTGGAGCAATGGGAGG - Intronic
1026019855 7:66698293-66698315 GGAGGAGGTAGAGCTCTGGCTGG - Intronic
1026664958 7:72334344-72334366 CAGGGTGGGATATCTGTGGCTGG - Intronic
1028343269 7:89748367-89748389 TAGGGTGGGAGAGCTGTTGGGGG + Intergenic
1031316265 7:120261318-120261340 CAGGGTGTTAGAGCTGAGTCTGG + Intergenic
1031468592 7:122143801-122143823 GACAGTGGTGGTGCTGTGGCTGG - Intronic
1031888129 7:127262006-127262028 AGTGGTGGTAGAGCTGAGGCAGG + Intergenic
1032480655 7:132244135-132244157 CTGGGGGGCAGAGCTGTGGCTGG - Intronic
1032541954 7:132710688-132710710 GAGGATGGTAGATCTGTCCCAGG - Intronic
1032994576 7:137430997-137431019 GAGGGTGGTAGACTTGTGTGAGG - Intronic
1033078027 7:138267849-138267871 TCTGGTGGTAGAGCTGGGGCTGG - Intergenic
1033472921 7:141665355-141665377 GAGGGAGGAAGGGCTGTGGAGGG - Intronic
1034101717 7:148456730-148456752 GAGGGTGCTACAGCCCTGGCTGG + Intergenic
1034277090 7:149828793-149828815 GAGGGTGGTAGGGCTGCAGGGGG - Intergenic
1034440110 7:151081958-151081980 GAGGGTGGGAGTGCTGTTCCGGG - Intronic
1034450383 7:151134166-151134188 GAGGGAGGTAGAGTTGGGGGCGG - Intronic
1034667481 7:152831242-152831264 GAGGCTGGTGGAGATGTGGATGG + Intronic
1035051278 7:156000343-156000365 GAGGGGCGTAGAGTCGTGGCTGG - Intergenic
1036806860 8:11840956-11840978 GAGGGTGTTGGGGCTGAGGCAGG + Intergenic
1037074904 8:14702458-14702480 GAGGGGTGCAGAGCTTTGGCTGG - Intronic
1037689333 8:21169606-21169628 GAGGGAGGAAGGGCTGTGGGTGG - Intergenic
1037810330 8:22082797-22082819 GAGGCTGGTAGAGAACTGGCTGG + Intergenic
1038307899 8:26421182-26421204 GAGGGTGGGAGCGGTGTGTCAGG + Intronic
1038433050 8:27515138-27515160 GAGGCGGGAAGTGCTGTGGCAGG + Intronic
1038485157 8:27929872-27929894 GAAGGTGGCAGAGCTCAGGCAGG + Intronic
1038536842 8:28359692-28359714 CAGGGTGGAGGAGGTGTGGCTGG - Exonic
1039895680 8:41715008-41715030 GCGGGTGGCAGAGCTGCTGCTGG - Exonic
1040035173 8:42863011-42863033 AATGGTGGTAGGACTGTGGCTGG + Intronic
1040469344 8:47724394-47724416 GAGGTGGGCAGACCTGTGGCTGG - Intronic
1041500660 8:58535102-58535124 GAGTCTGGAAGAGTTGTGGCAGG - Intergenic
1042430428 8:68700248-68700270 TGGGGAGGTAGAGCTGTGTCTGG + Intronic
1042779563 8:72475880-72475902 GATGGGGGTAAAGCTGTGCCTGG - Intergenic
1046486541 8:114895132-114895154 GAGGGTGGTGGAGGTGGGCCGGG + Intergenic
1046548054 8:115676311-115676333 GAGGGTGGTTGAGGTATGGAGGG + Intronic
1047691178 8:127356264-127356286 GAGCGTGTAAGAGCTGAGGCAGG + Intergenic
1048036262 8:130680213-130680235 GAGGGTGATAGAGAAGTGTCCGG + Intergenic
1049322306 8:142003031-142003053 GAGGCTGGCTGAGCTGGGGCAGG + Intergenic
1049842031 8:144778891-144778913 GTTGGTGGAAGAGCTGAGGCAGG + Intronic
1052936248 9:34095490-34095512 GAGGGTAGCAGTGCTGAGGCAGG - Intronic
1052977435 9:34421628-34421650 GTGGGTTGTAGAGCTGTAGGGGG - Intronic
1053060659 9:35028680-35028702 GAGGTTCTTTGAGCTGTGGCTGG - Intergenic
1053913246 9:42926291-42926313 GAGGGTGGTAGCCCTGTGTGGGG + Intergenic
1056167865 9:83956392-83956414 GAGGGTGGCAGAGCTGCTGCTGG - Exonic
1057337544 9:94166958-94166980 GAGGGCGGGAGAGTCGTGGCTGG + Intergenic
1057717159 9:97503791-97503813 GTGGGTGGCAGAGTTGGGGCTGG - Intronic
1057831276 9:98409136-98409158 GAGGGAGGCAGGGTTGTGGCTGG + Intronic
1059382055 9:113934353-113934375 GTGGGTGGCAGACCTGAGGCTGG - Intronic
1059415032 9:114156941-114156963 GAGGCTGTTAGGGCTGTAGCTGG + Intronic
1060028082 9:120190070-120190092 GAGGCTGGGAGAGCAGCGGCTGG + Intergenic
1060538878 9:124415751-124415773 GGGGGTGGTGGGGCTGTGCCTGG - Intergenic
1060601085 9:124878109-124878131 GAGGAGGGGAGAGCTGTGGAGGG - Intergenic
1060633002 9:125176685-125176707 GATGGTGGTGGAGGGGTGGCTGG + Intronic
1060739830 9:126090950-126090972 GAGGGAGGAAGCGCTGAGGCAGG + Intergenic
1061814675 9:133187566-133187588 GATGGTGCTAGAGCTGTTTCTGG + Intergenic
1061845394 9:133385320-133385342 GGGGGTGAGTGAGCTGTGGCAGG - Intronic
1061935658 9:133856324-133856346 GAGGGTGGCAGGGCTGGGCCAGG + Intronic
1062119754 9:134827903-134827925 GAGGGTGGGAGAGCTCTGGGTGG + Intronic
1185456290 X:312483-312505 CAGGGTGGTAAAGCTCTGGATGG + Intronic
1186694415 X:12014732-12014754 GAGGGAGAGAGAGCTGTGTCTGG + Intergenic
1188315707 X:28670581-28670603 GAGGGTGGTAGAGCTGTGGCAGG - Intronic
1190596687 X:52059321-52059343 GAGGCTGGGAGGGCGGTGGCAGG + Intergenic
1190612137 X:52194752-52194774 GAGGCTGGGAGGGCGGTGGCAGG - Intergenic
1190806633 X:53844147-53844169 GAGAGTAGTAGGGCTGTGGATGG - Intergenic
1194819105 X:98484283-98484305 GAGGGTGGGAGAGGTGTAGTAGG + Intergenic
1196160266 X:112474880-112474902 CAGGGAGGTAGAGAGGTGGCAGG + Intergenic
1200770760 Y:7123229-7123251 GTGGGAAGCAGAGCTGTGGCTGG - Intergenic
1201758415 Y:17514492-17514514 GAAGCTGGGAGAGCTGTGGAGGG - Intergenic
1201843140 Y:18391498-18391520 GAAGCTGGGAGAGCTGTGGAGGG + Intergenic