ID: 1188316313

View in Genome Browser
Species Human (GRCh38)
Location X:28678143-28678165
Sequence GCCGGATGAAGGAGTTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188316306_1188316313 16 Left 1188316306 X:28678104-28678126 CCAGGCTTCTGCCTCAAATAAGC 0: 1
1: 1
2: 2
3: 20
4: 177
Right 1188316313 X:28678143-28678165 GCCGGATGAAGGAGTTTGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 100
1188316311_1188316313 -6 Left 1188316311 X:28678126-28678148 CCATCTTAGTTTTTTGGGCCGGA 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1188316313 X:28678143-28678165 GCCGGATGAAGGAGTTTGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 100
1188316307_1188316313 5 Left 1188316307 X:28678115-28678137 CCTCAAATAAGCCATCTTAGTTT 0: 1
1: 0
2: 1
3: 26
4: 249
Right 1188316313 X:28678143-28678165 GCCGGATGAAGGAGTTTGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188316313 Original CRISPR GCCGGATGAAGGAGTTTGAG AGG Intronic
900515442 1:3079712-3079734 GCCAGATGAAGGGGTATGTGAGG - Intronic
902374184 1:16022615-16022637 GCCTGATGGAGGAGTTGGTGGGG + Exonic
902379132 1:16044488-16044510 GCCTGATGGAGGAGTTTGTGGGG + Exonic
902719322 1:18293525-18293547 GGGGGATGAAGGAGTTTGTGCGG - Intronic
903014743 1:20354507-20354529 GCGAGATGAAGGAGGTGGAGTGG + Intronic
904214986 1:28912335-28912357 GCAGGATAAGGGTGTTTGAGTGG + Intronic
905208893 1:36359732-36359754 GCCAGACAAAGGAGTTTGGGTGG - Intronic
908433764 1:64084739-64084761 GTCTGTTGAAGGAGTTTGGGGGG - Intronic
912414991 1:109502054-109502076 GCCTGATGAAGGGGCTTGACTGG + Intronic
915063364 1:153204892-153204914 GCAGGATGAAGGAGACTGCGAGG - Exonic
920432901 1:205929993-205930015 CCCGGATGAAGGACTCGGAGAGG + Exonic
922510291 1:226160474-226160496 GCTGTATGTAGGAGTTTGTGAGG - Intronic
1069719835 10:70542381-70542403 GCAAGATGAAGGAGTTAGATGGG - Intronic
1071565604 10:86669910-86669932 GCTGGAGGAAGGGGTTGGAGGGG + Intronic
1074848244 10:117417896-117417918 GCTGGATGAAGCTGTTTGAATGG + Intergenic
1074891046 10:117736870-117736892 GCGGAATGAGGGAGTCTGAGGGG + Intergenic
1076126266 10:127976457-127976479 GGGGGAGGAGGGAGTTTGAGAGG + Intronic
1076450181 10:130551776-130551798 ACAGGATGATGGAGTCTGAGAGG + Intergenic
1080551973 11:33380168-33380190 GCCGGCTGAAGGGCTCTGAGCGG + Intergenic
1082791828 11:57350827-57350849 GCCGGGTGAAGGAGTATTTGGGG - Exonic
1083126057 11:60566888-60566910 GCCTCATGGATGAGTTTGAGAGG + Intergenic
1083671441 11:64302125-64302147 CTCTGATGAAGTAGTTTGAGGGG - Intronic
1086112944 11:83218706-83218728 GCTGGATGAAGGAGAGTCAGTGG + Intronic
1088694436 11:112354908-112354930 GCAGGGTGAAGGAGGATGAGAGG - Intergenic
1089735455 11:120547518-120547540 GAGGGAGGAAGGTGTTTGAGGGG + Intronic
1094488914 12:30946526-30946548 GCAGGCTGATGGAGTTTGATTGG - Intronic
1096639289 12:52981384-52981406 GCAGCATGAAGGAGGATGAGAGG - Intergenic
1097257346 12:57689304-57689326 GAAGGATGATGGAGTTTGAGGGG + Intergenic
1097512758 12:60564743-60564765 CCCTGATGAAGCACTTTGAGAGG - Intergenic
1101345395 12:103881516-103881538 GCAGGATGAAAGAGAGTGAGAGG + Intergenic
1106071757 13:26418915-26418937 CACTCATGAAGGAGTTTGAGGGG + Intergenic
1106149243 13:27082452-27082474 GCCAAATGGAGAAGTTTGAGTGG - Intronic
1113649583 13:112026446-112026468 GCCTGAAGAAGGAGGGTGAGGGG + Intergenic
1122935413 14:104953779-104953801 GGGGGATGAAGGAGATGGAGAGG - Exonic
1125717305 15:41826678-41826700 GCTGGATACTGGAGTTTGAGAGG + Exonic
1135351244 16:21730953-21730975 GAAGGCTGAAGGAGTTTGAAGGG + Intronic
1135413523 16:22252200-22252222 TTCGGATTAAGCAGTTTGAGTGG - Intronic
1135449724 16:22547079-22547101 GAAGGCTGAAGGAGTTTGAAGGG + Intergenic
1135516648 16:23141195-23141217 GCGGGATGGAGGAGGTGGAGAGG - Intronic
1136390751 16:29962611-29962633 GGCGGATGAAGCAGTCTGCGTGG - Intronic
1143363515 17:6390182-6390204 TCTGGGTGAAGGAGTTTAAGTGG - Intergenic
1143917243 17:10302949-10302971 GCAGGATGAAGGGGATGGAGGGG + Intronic
1144316869 17:14069856-14069878 GCCGGATGGAGGAGGCTGTGTGG - Intronic
1151099500 17:71540453-71540475 GCTGAATGAAGGGGTTTTAGAGG + Intergenic
1159714441 18:71804304-71804326 GCTGGAGGAAGGGGTTTGATGGG + Intergenic
1162423496 19:10579760-10579782 GCGGGATGAAGGAGATGGTGCGG + Exonic
1163035330 19:14566235-14566257 TGCGCATGAAGGAGTTTGAGCGG - Exonic
1164784019 19:30915156-30915178 GCCCGATGAAAGAGTTTGCAGGG + Intergenic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
925423824 2:3732598-3732620 GGCTGATCAAGGAGTTTGAGGGG + Intronic
927332302 2:21879842-21879864 GGAGGATGAATGGGTTTGAGTGG + Intergenic
928683582 2:33726993-33727015 GCAGGATGAAGAGGTTGGAGAGG + Intergenic
931868784 2:66438240-66438262 GCCCGCTGAAGGAGTCTGAGAGG - Intronic
932260337 2:70321534-70321556 GCTGGATGAGGGAGGTAGAGAGG + Intergenic
932284168 2:70518623-70518645 GCCTGATTGAGGAGTTGGAGTGG - Intronic
939304710 2:140396204-140396226 GCTGGTTGAAGGAGCTTAAGTGG - Intronic
940012044 2:149064917-149064939 GCCTGGTACAGGAGTTTGAGTGG + Intronic
940070910 2:149686869-149686891 GCCAGCTGAAGAAGATTGAGAGG - Intergenic
944768933 2:202893793-202893815 GGAGGAGGAAGGACTTTGAGAGG - Intronic
948404712 2:237708596-237708618 TCCGCATGAAGGAGCTGGAGCGG + Exonic
1170298734 20:14858276-14858298 ACCCGATGCAGGAGTCTGAGTGG + Intronic
1170650385 20:18234739-18234761 GCATCATGAAGGATTTTGAGCGG - Intergenic
1173838421 20:46140370-46140392 GCCACAGGAAGGAGTTGGAGGGG + Intergenic
1180205973 21:46260816-46260838 GCGTGATGATGGAGTTTGTGAGG - Exonic
1180753104 22:18139108-18139130 GAAGGGTGAAGGAGTATGAGGGG - Intronic
1183832476 22:40425702-40425724 GCCGGAAGTAGGAGATTGTGGGG - Intronic
1184663959 22:45977831-45977853 GCCTGTGGAAGGAGGTTGAGGGG + Intergenic
1185169115 22:49282058-49282080 GCCGGATGGAGGAGCCTGAAGGG + Intergenic
949787762 3:7760459-7760481 CCCTGATGAAGGAATTTCAGTGG + Intergenic
955497959 3:59556123-59556145 GCTGGAAGAAGGAGCTTGAGTGG - Intergenic
957445479 3:80309409-80309431 GCCGGATGGAGGAGAGTCAGTGG - Intergenic
958173933 3:89971455-89971477 AGCAGATGAAGGAATTTGAGCGG - Intergenic
960754524 3:120996551-120996573 ACAGGATGAATGAGTTTTAGAGG - Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
987508131 5:18799799-18799821 GCAGCATGGAGAAGTTTGAGAGG - Intergenic
989735445 5:44698229-44698251 GCAAGATTAAGGAGATTGAGAGG - Intergenic
990851618 5:60211249-60211271 GGAGGTTGAAGGAGTTTGTGTGG + Intronic
992519720 5:77538083-77538105 GTAGGATGAAGGAGTGGGAGGGG - Intronic
993950617 5:94170535-94170557 GCTGCATCAAGGAGGTTGAGAGG + Intronic
995372714 5:111437668-111437690 GCCAGATGAAGAAGTGTGAAAGG + Intronic
995887052 5:116907187-116907209 CCCTCATGAATGAGTTTGAGAGG + Intergenic
999143266 5:149376855-149376877 CCCGCATGGAGGAGTATGAGAGG - Exonic
1002865432 6:1117798-1117820 GTAGGATGAGGAAGTTTGAGTGG + Intergenic
1004003774 6:11620784-11620806 CCAGGATGCAGGAGTTTGGGTGG + Intergenic
1005360605 6:25027747-25027769 TGCGGATCAAGGTGTTTGAGAGG - Intronic
1006299842 6:33187870-33187892 GCTGGATGGAGGAGTTGAAGAGG + Intronic
1009059833 6:58385565-58385587 GTGGAATGAATGAGTTTGAGAGG + Intergenic
1009231079 6:61061831-61061853 GTGGAATGAATGAGTTTGAGAGG - Intergenic
1012707210 6:102546761-102546783 TCCGGAAGGAGGAGTTTGCGGGG + Intergenic
1012914642 6:105156459-105156481 GCAGGTTGAAGGAGAATGAGAGG - Intergenic
1015343620 6:132130542-132130564 GCTGGAGGAAGAAGTTTGACAGG - Intergenic
1021226810 7:18037399-18037421 GGCGGATGAAGAGGTTGGAGTGG + Intergenic
1023422092 7:39991833-39991855 GCTGAATCCAGGAGTTTGAGAGG + Intronic
1029254334 7:99259173-99259195 GTAAGATGAAGGAGTTTAAGGGG - Intergenic
1033773580 7:144581347-144581369 TCCAGATGAAGGAGGTTTAGAGG + Intronic
1034452455 7:151144254-151144276 TCAGGATGAAGGCGTGTGAGGGG - Exonic
1036147865 8:6271063-6271085 GCCAGAAGAAGGAATTTAAGAGG + Intergenic
1048110958 8:131468204-131468226 GTGGGATGCAGGACTTTGAGTGG - Intergenic
1048364933 8:133730265-133730287 GGTGGAGGAAGGAGGTTGAGGGG + Intergenic
1057724099 9:97556075-97556097 GATGGAAGCAGGAGTTTGAGTGG + Intronic
1057888825 9:98852669-98852691 AGCGGATGCAGGAGTTAGAGGGG - Intergenic
1059246823 9:112856219-112856241 GCCAGATGAAGAAGTTTAAATGG + Intronic
1060733877 9:126054059-126054081 GGAGGATGAATGAATTTGAGAGG + Intergenic
1186173264 X:6899865-6899887 GCCTGAAGTAGCAGTTTGAGAGG - Intergenic
1188316313 X:28678143-28678165 GCCGGATGAAGGAGTTTGAGAGG + Intronic
1190109846 X:47582745-47582767 TCGGGATGAAGGAATTTGCGGGG - Intronic
1197635117 X:128905835-128905857 ACTGGATCAAGGAGTTAGAGGGG - Intergenic
1197758779 X:130013845-130013867 GCCGGAAGATGGGGTTGGAGTGG - Exonic