ID: 1188318368

View in Genome Browser
Species Human (GRCh38)
Location X:28704879-28704901
Sequence AGAATGAGACAATACTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 245}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188318368 Original CRISPR AGAATGAGACAATACTGGGA TGG Intronic
901029952 1:6301254-6301276 AGAATGAGAGAATAAATGGAAGG + Intronic
903348598 1:22703982-22704004 ACAGTGAGACAAGACTGGGAAGG + Intergenic
905002743 1:34685956-34685978 GGAATCATACAATACTGGAATGG - Intergenic
907470842 1:54672466-54672488 ACCATAAGACAATTCTGGGATGG + Intronic
907791031 1:57663614-57663636 AAAATAAGAAAATATTGGGAGGG - Intronic
910475584 1:87602626-87602648 AGAATGAGACAATCATGGGCTGG - Intergenic
910520075 1:88110765-88110787 AGAATGAGTCAAGATTTGGAAGG - Intergenic
912317710 1:108681298-108681320 AGATCGAGACCATCCTGGGAAGG + Intergenic
912625376 1:111201613-111201635 TGAATGAGTAAATACAGGGAAGG + Intronic
912962801 1:114211045-114211067 AAAATGACACAATGCTGAGAGGG - Intergenic
913311963 1:117507862-117507884 TGAATAAGACAATCCTTGGAGGG - Intronic
914984332 1:152443094-152443116 AGCGTGAGTCAATCCTGGGAGGG + Intergenic
918009486 1:180573042-180573064 GGAATTAGACAAAAATGGGAAGG - Intergenic
921265763 1:213419413-213419435 AAAATGAGATAATACTAGGTAGG - Intergenic
1064439511 10:15340976-15340998 AGCATTAGACTATTCTGGGAGGG - Intronic
1065198517 10:23290332-23290354 AGAATGAGACTATACTGGCATGG + Intronic
1065431821 10:25666220-25666242 AGACTGAGAAAAGAATGGGATGG - Intergenic
1065566731 10:27018979-27019001 AAAATGGGACAATACTGGCCAGG + Intronic
1065593707 10:27291722-27291744 AGAGTGAGTTAATACAGGGAGGG + Intergenic
1065656646 10:27958541-27958563 AGAGTGAGTTAATACAGGGAGGG - Intronic
1069318437 10:67137583-67137605 AGAATGAGACAATTTTGAGGTGG - Intronic
1070175733 10:73967627-73967649 AGAATGCCCCAATACAGGGAAGG + Intergenic
1072297326 10:94023181-94023203 AGAGTTAGAAAATAGTGGGAAGG + Intronic
1073028308 10:100504905-100504927 AGAATGAGACAGAAATGGAAAGG + Intronic
1073818763 10:107236328-107236350 AGATAGAGACAATACTGAGTAGG + Intergenic
1074176400 10:111008733-111008755 GTAAGGAGACAATACTGGGTTGG - Intronic
1074238427 10:111610240-111610262 AGCATGATATAATAATGGGATGG - Intergenic
1074597038 10:114876982-114877004 AGAATTGCTCAATACTGGGAAGG - Intronic
1074880527 10:117654073-117654095 AGAATGAGACAGAACTAGAAGGG + Intergenic
1077520181 11:3028524-3028546 AGATTGAGACAATACGGGCCAGG + Intronic
1079787231 11:24688927-24688949 ACAGTGAGACAATACAGGGAGGG - Intronic
1080437907 11:32263152-32263174 AGAAGTAGAGAATAGTGGGAGGG - Intergenic
1081037643 11:38169238-38169260 AGAGTGAGAAAATACTGGCCTGG - Intergenic
1085030800 11:73269843-73269865 GGAAAGAGACAAGGCTGGGAAGG - Intronic
1086202706 11:84223127-84223149 GGAATGATTCAATACTGAGATGG + Intronic
1087119073 11:94554025-94554047 AGCAGGAGACAGGACTGGGAAGG + Intronic
1088231785 11:107680385-107680407 AGATTCGGAGAATACTGGGAAGG + Intergenic
1088923586 11:114279657-114279679 AGAAGGAGACAGTGCTAGGAAGG + Intronic
1089499379 11:118923545-118923567 AGAATGAGTCTCTACTAGGATGG - Intronic
1089978015 11:122749521-122749543 AGAATGGAACAATACAGAGAGGG - Intronic
1092897887 12:13031123-13031145 AGAAAGAGTCACTACAGGGATGG + Intergenic
1093562200 12:20554273-20554295 AGAATGAGACAATTTTGTGTAGG + Intronic
1093821169 12:23619580-23619602 ACAAAGAGACAAACCTGGGAAGG + Intronic
1094522558 12:31208377-31208399 AGATTGAGATATTGCTGGGAAGG - Intergenic
1098785325 12:74746458-74746480 TGAATGAAACAATACTAGTACGG - Intergenic
1100341260 12:93681702-93681724 GGAATGAGACAAGATTGGGAAGG - Intronic
1104191165 12:126482772-126482794 AGACTGTGATAATGCTGGGATGG + Intergenic
1105879178 13:24588632-24588654 AGAAAAAGACAATTCTGGGAAGG - Intergenic
1105920660 13:24960417-24960439 AGAAAAAGACAATTCTGGGAAGG + Intergenic
1109913537 13:68949001-68949023 AGGATTAGAAAATATTGGGAAGG - Intergenic
1110600089 13:77363175-77363197 ATAATGTGACAATAATGTGAGGG + Intergenic
1114697873 14:24644353-24644375 AGAATAACACAGCACTGGGAAGG + Intergenic
1116115498 14:40644539-40644561 AGAATAAGAGAATACTGACATGG + Intergenic
1118555496 14:67015207-67015229 AGAATGGGTCAATACTGAAAAGG + Intronic
1120360816 14:83499599-83499621 AGGAAGAGACAATTCTGTGAAGG - Intergenic
1120456718 14:84739969-84739991 AAATTGGAACAATACTGGGAAGG + Intergenic
1121618719 14:95331649-95331671 GGAAGGAGACAGGACTGGGAAGG + Intergenic
1122457885 14:101869279-101869301 ATAATGAGACAACACTGAGAAGG - Intronic
1126291034 15:47079240-47079262 AGAATCAGAAAATGCTGTGAAGG + Intergenic
1126340226 15:47633209-47633231 AAAATGATAGAATACTGGAATGG - Intronic
1127100908 15:55563859-55563881 GCAATGAGATAACACTGGGATGG + Intronic
1127597926 15:60505458-60505480 GGATTGAGGCAATATTGGGAAGG - Intronic
1128214387 15:65924281-65924303 AAACTGAGACATTACAGGGAGGG - Intronic
1128978206 15:72168339-72168361 AGAATGTGAGAAGACTGGGCTGG - Intronic
1129513682 15:76143319-76143341 AGATTGAGACATGAATGGGAGGG - Intronic
1131197223 15:90365287-90365309 AGAGTGAGACAAAACTGGACAGG + Intronic
1131204469 15:90430233-90430255 AGATTCAGACAGGACTGGGATGG - Intronic
1131606500 15:93909442-93909464 AGATTGAGACCATCCTGGCACGG + Intergenic
1131926141 15:97385976-97385998 TGATGGAAACAATACTGGGAAGG + Intergenic
1133865018 16:9634157-9634179 AGAGTGAGACTATATTTGGACGG - Intergenic
1135689498 16:24524735-24524757 AAAATGGGATAATATTGGGATGG + Intergenic
1135874380 16:26184601-26184623 AGAATAAAACAAGAATGGGAAGG + Intergenic
1137937409 16:52647651-52647673 AGATTGAGACAAGCCTTGGAGGG + Intergenic
1138922846 16:61554291-61554313 AATATGAGAAAATACTGTGATGG + Intergenic
1139017275 16:62705606-62705628 AGAATGACAAGATAGTGGGATGG - Intergenic
1139796597 16:69487792-69487814 AGAAGAAGACAAGAATGGGAGGG - Intergenic
1139903705 16:70348020-70348042 AGAATTAGACAAGGCTGGCAAGG + Intronic
1140661769 16:77195660-77195682 AGAAGGAGACACTACTGGCCTGG + Exonic
1146606273 17:34260553-34260575 AGAATGTTACAATGCAGGGAAGG + Intergenic
1147880534 17:43650784-43650806 CGAAATAGACAAGACTGGGATGG + Intronic
1147938463 17:44027786-44027808 AGAATAACACAACATTGGGATGG + Intergenic
1150366190 17:64587479-64587501 AGAATTAAACAATACTGGAGTGG - Intronic
1155419558 18:25640181-25640203 AGAAAGAGACAATGCTGCCAGGG + Intergenic
1156670431 18:39462664-39462686 GGCATGAGAAAATACTGTGAGGG + Intergenic
1156721615 18:40076994-40077016 AGCATGAGATAAAAATGGGATGG - Intergenic
1157071007 18:44408548-44408570 AGACTGATACAATAATGGAATGG + Intergenic
1158284688 18:55866815-55866837 AAAATGAGATAATACAGGGTTGG - Intergenic
1158475036 18:57772523-57772545 AGACTGAGGCAAGGCTGGGAAGG + Intronic
1160108315 18:76001260-76001282 AAAATGAGACACTGCCGGGAGGG + Intergenic
1161559198 19:4962065-4962087 AGAATGAGACAATTTTGTGTAGG + Exonic
1164950351 19:32331646-32331668 ACAACGAGACAGTACTGGCAGGG + Intergenic
1166281363 19:41796469-41796491 AAAATGAGGCAAAACTGAGAGGG + Exonic
1166399771 19:42469810-42469832 AGAATGGGAGAAAACAGGGAAGG - Intergenic
925216701 2:2102502-2102524 AGAATGGGAAAATCTTGGGAAGG - Intronic
925417851 2:3684573-3684595 AGAATGATACAATGTGGGGAAGG - Intronic
928509339 2:31987339-31987361 AGAATGACAAAAGACTAGGAAGG + Intronic
928977737 2:37106152-37106174 GTGATGAGACAATAATGGGAAGG - Exonic
929693367 2:44093035-44093057 AGAAAGAGACAGTCCTGGGTGGG - Intergenic
929956162 2:46460293-46460315 AGAATGAGAAATGACTGGGCTGG - Intronic
930013126 2:46952953-46952975 AGAATGAGACAATACTGGCATGG - Intronic
931184443 2:59936439-59936461 AGAATGAAAAAATCCTAGGAAGG + Intergenic
931382439 2:61766203-61766225 AGAAAGAGACAATAGTGGATGGG + Intergenic
932103583 2:68923314-68923336 AGAAAGACACAATATTGAGAAGG + Intergenic
932546998 2:72722994-72723016 AAAATGTGACTATACTGGGAAGG - Intronic
933376350 2:81484303-81484325 AGAATGATACAATAGTAGTAAGG - Intergenic
933558605 2:83863637-83863659 AGAATGAGACAAAACATGGATGG + Intergenic
933697742 2:85232619-85232641 AGTAGGAGAAAATAGTGGGAAGG - Intronic
935359650 2:102236669-102236691 AGGATGAAACAATTCTGGAATGG - Intronic
936008329 2:108909265-108909287 AGAATGAGATAAGGCTGGGCTGG + Intronic
936392410 2:112087356-112087378 AGAGTGAGAAAATAGTGGCAAGG - Intronic
936512365 2:113158091-113158113 AGTATGAGAGATTTCTGGGAAGG + Intronic
937700004 2:124853360-124853382 AGAAAGAGACCACACTGGCAAGG - Intronic
937902539 2:127032083-127032105 AGAATCAGACAATTCCTGGAAGG - Intergenic
940256795 2:151739413-151739435 AGAATCAGACTAATCTGGGAAGG + Intergenic
941322335 2:164071494-164071516 AGAAGCAGACAATATTGGGTTGG + Intergenic
941666987 2:168252012-168252034 AGAATGAGTCAGCACTGGCAAGG + Intergenic
945048626 2:205802790-205802812 AGCCTGAGACAATGTTGGGAAGG - Intergenic
945975814 2:216269874-216269896 AGAATGAGAAAACAATAGGAAGG - Intronic
947402879 2:229746311-229746333 AGAAAGAGTCAGTAGTGGGAAGG + Intergenic
948378021 2:237534872-237534894 TGAATGAGAGAATGCTTGGAGGG + Intronic
948823951 2:240565491-240565513 AGCATGAGACAACACAGGGCTGG - Intronic
1169170782 20:3463236-3463258 AAAAACAGACAATACTGGCATGG - Intergenic
1170556719 20:17520734-17520756 AGAAGGAGAGGAAACTGGGAAGG - Intronic
1171841320 20:30215499-30215521 AGAATCAGAAAATGCTGTGAAGG - Intergenic
1172507388 20:35473578-35473600 AGACTGAGACCAGGCTGGGAGGG - Intronic
1173098587 20:40061833-40061855 AGAATGACATAATATTTGGAAGG + Intergenic
1174705104 20:52647250-52647272 AAAATGAGACAAGGATGGGAAGG + Intergenic
1174769258 20:53283092-53283114 ATAATGAGATAACACTGGTAGGG - Intronic
1175478308 20:59292687-59292709 TGAAAGAGACAGTAATGGGAAGG - Intergenic
1176580787 21:8522666-8522688 AGAATCAGAAAATGCTGTGAAGG + Intergenic
1177640778 21:23841990-23842012 AAAATCAGACAAAACTAGGATGG - Intergenic
1181719094 22:24760200-24760222 AGAATCAGGAATTACTGGGAAGG + Intronic
1183037231 22:35149525-35149547 GGAATGAGACCGAACTGGGATGG - Intergenic
1183463509 22:37967415-37967437 AGAATGACAGAATATTGGTAAGG - Intronic
1184309141 22:43629879-43629901 TGGATGAGACAATCCTGCGAGGG + Intronic
1184378192 22:44128360-44128382 AGAAAGAGAGAAAACTGGGGAGG - Intronic
1184801579 22:46763531-46763553 GGAATGAGACATTACGTGGAGGG + Intronic
951745346 3:25971880-25971902 AGAATGAGCCAATATAGGGCAGG - Intergenic
952243999 3:31565057-31565079 AGAATGAGAGAATGCAAGGAAGG - Intronic
953472764 3:43180966-43180988 AAAATGAGACAATACAGGCAAGG + Intergenic
953532364 3:43750009-43750031 AGAAAGAGAGAACACTGGAAAGG - Intergenic
956587622 3:70881219-70881241 GGAATGAGACAACACTGGGAGGG + Intergenic
956660163 3:71589520-71589542 AGAAAGAAACCATACTTGGATGG - Intergenic
959615137 3:108338813-108338835 AGAATGAGATAAAACAGGGAGGG + Intronic
959960038 3:112287839-112287861 AGATTGAGACCATCCTGGTATGG + Intronic
959975845 3:112458435-112458457 TTAATGAGACAATCCTGAGATGG + Intergenic
959982712 3:112534868-112534890 AGAATAAGCCAAAACTGAGAGGG + Intronic
960393251 3:117105040-117105062 AGCATGAGACTGTATTGGGAGGG + Intronic
961238203 3:125386883-125386905 AGAATAAGACAAAAGTGAGATGG - Intergenic
961742261 3:129040225-129040247 GGAAGGAGACAGTGCTGGGAGGG - Exonic
964406663 3:156355771-156355793 AGAATAATAAAATAATGGGATGG - Intronic
964463432 3:156963090-156963112 AGAAGGAGACAACATTGGGATGG - Intronic
965307791 3:167088729-167088751 AGAATTAGGGTATACTGGGATGG - Intergenic
965893328 3:173542012-173542034 AGTATGAGAGAATAAGGGGAGGG - Intronic
966450848 3:180059786-180059808 AGAATTAGGCAAAGCTGGGATGG + Intergenic
966500086 3:180629480-180629502 AGAATCAGATAATACCTGGAGGG + Intronic
967388043 3:188929537-188929559 AGAATTAGACATTCCTTGGAAGG - Intergenic
967924724 3:194637247-194637269 AGGATGACACAAGACTGGGTGGG - Intergenic
967994791 3:195158346-195158368 AGAATGGGAATATGCTGGGAGGG + Intronic
969610666 4:8226163-8226185 GAAAGGAGACATTACTGGGAAGG - Intronic
970132419 4:12885973-12885995 AGACTGAGAGAATATTGGAAAGG + Intergenic
970233167 4:13932008-13932030 AAAATGAGACCATACTGGGTAGG + Intergenic
970923190 4:21418918-21418940 AGAATGAGATTATTCAGGGATGG + Intronic
971645253 4:29191185-29191207 AGAATGTGACTATATTTGGAGGG - Intergenic
972935577 4:44130997-44131019 AGAATAAGATAATTCTTGGATGG - Intergenic
974483971 4:62482638-62482660 AGCATGACACAAGACTGTGAAGG - Intergenic
975193502 4:71494603-71494625 AGAACAAGACAGTACTGGCATGG - Intronic
975422016 4:74176414-74176436 AAAATGTGATAATGCTGGGATGG - Intronic
975912990 4:79290852-79290874 AAAATGAGACAAAACTGAAAAGG + Intronic
976684824 4:87801251-87801273 TGTATGAGACTGTACTGGGATGG - Intronic
977145258 4:93431688-93431710 AGAAAGAGATAATAATTGGAAGG + Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
980169466 4:129271349-129271371 AGAATCAGGCATGACTGGGAAGG - Intergenic
980266765 4:130525843-130525865 ATAATGAGACAATTCTAGGAAGG - Intergenic
981841340 4:149116121-149116143 AAATTGATACAATGCTGGGAAGG - Intergenic
982889922 4:160834292-160834314 AGAATGAGAGAAGAAAGGGAGGG - Intergenic
983447488 4:167872632-167872654 ACCATATGACAATACTGGGAAGG - Intergenic
983991449 4:174125002-174125024 AGAAAGAGAAAATTCTAGGATGG - Intergenic
984085473 4:175305378-175305400 AGAATGAGAAAATAATTAGAAGG + Intergenic
984742466 4:183178982-183179004 AGTACCAGACAATACTGGAAGGG + Intronic
986297257 5:6449463-6449485 AGACTGAGACCAGACGGGGACGG - Intronic
986400449 5:7374044-7374066 AGAAAGAGACAACACTGTAAAGG + Intergenic
987301990 5:16605483-16605505 AGAATGGAACAAGAATGGGAGGG + Intronic
989996386 5:50837704-50837726 AGAATGAGAGAAAAATTGGAGGG + Intronic
994266996 5:97729201-97729223 AGAATGATACCATAGTGGGCCGG + Intergenic
994473766 5:100241311-100241333 AGAATGACACAATATTTGGGAGG + Intergenic
994512552 5:100723724-100723746 AAAATGAGACAAAAGTGGAATGG + Intergenic
994666952 5:102716626-102716648 AGAATTAGAAAATAGTGGAATGG + Intergenic
995990808 5:118237058-118237080 AGAAGTAGACAATACAAGGAAGG + Intergenic
996848228 5:127924356-127924378 AGAACCAGAAAACACTGGGAGGG + Intergenic
998238554 5:140421673-140421695 AGACTGTGACAATACTGGCTTGG - Intronic
999603251 5:153290116-153290138 AAAATGGCACTATACTGGGAGGG + Intergenic
1000275729 5:159733232-159733254 AGAATGAGAGAAGAAAGGGAAGG - Intergenic
1000452926 5:161412650-161412672 GGAGTGAGATGATACTGGGAAGG - Intronic
1001509948 5:172313348-172313370 AGAATGAACGAATACTGGGCAGG - Intergenic
1002254177 5:177946678-177946700 AGAAAGAAACAATGGTGGGAAGG - Intergenic
1004127974 6:12891944-12891966 TGAATGAGATAATACTTGTAAGG + Intronic
1004559581 6:16734847-16734869 AGAATGTGACAAGATTGGGGAGG + Intronic
1006570023 6:34994830-34994852 AGAGTGAGACACTCCTGGGGAGG + Intronic
1007198774 6:40087392-40087414 AGAAAGAGAGAGAACTGGGAAGG + Intergenic
1011099240 6:83704023-83704045 AGCTTGACACAATACTGGGTAGG + Intronic
1011957319 6:93038988-93039010 AGAAAGAGACAGTACAGAGAGGG + Intergenic
1013863550 6:114665249-114665271 AGAAGGAGATAAGAGTGGGATGG + Intergenic
1013893794 6:115059594-115059616 AGAATGAGACAATTTTAGGAGGG + Intergenic
1014404166 6:121027416-121027438 AGAATAAAACAATACTGTAATGG + Intergenic
1014929099 6:127311718-127311740 AGAAAGAAAGAAAACTGGGATGG + Intronic
1015824194 6:137294525-137294547 AGAATGAAAGAATACTTGGGAGG - Intergenic
1016365600 6:143314050-143314072 AGAAAGAAAAAATACTGGGCTGG + Intronic
1016940979 6:149482618-149482640 AGAATCAGCCAATACAGGGGAGG + Intronic
1017018836 6:150123785-150123807 AGAGTGAGACAAGAAAGGGAAGG - Intergenic
1018230195 6:161667872-161667894 AGAGTGAGAAAAACCTGGGAGGG + Intronic
1018743200 6:166745543-166745565 AGAATGGGACTGTATTGGGAGGG - Intronic
1020375053 7:7476084-7476106 AGCATGAGGCCATACTGAGAAGG + Intronic
1020994425 7:15244945-15244967 AGAATGAGTAAATACTGGCCGGG - Intronic
1022750297 7:33218089-33218111 AGAATTAGACATTACAGAGAAGG + Intronic
1025289768 7:57706186-57706208 AGAATCAGAAAATGCTGTGAAGG - Intergenic
1028343815 7:89755684-89755706 AGAATGAAACAATACAGAAAAGG + Intergenic
1028902996 7:96122017-96122039 AGAATGTGACCAGACTGAGATGG - Intronic
1030908170 7:115212367-115212389 TGAGTGAGAAAAGACTGGGATGG + Intergenic
1031672732 7:124569779-124569801 AGAAGGAGACAGTAATGGGATGG - Intergenic
1031738545 7:125398345-125398367 ACACTTAGAAAATACTGGGATGG + Intergenic
1033387996 7:140897704-140897726 AGATTGAGACCATCCTGGCATGG - Intronic
1035692066 8:1566704-1566726 GGATAGAGACAATACAGGGAGGG - Intronic
1036543732 8:9746005-9746027 AGAATGGGAAAAGACAGGGAAGG - Intronic
1036770023 8:11572412-11572434 AGGATGGGACCAGACTGGGAAGG - Intergenic
1037642758 8:20763008-20763030 AGAATGAGACAAACTAGGGAGGG - Intergenic
1038081678 8:24144350-24144372 AGACAGAGACAATGCAGGGAAGG + Intergenic
1038974675 8:32680673-32680695 AGAATCAGAAAATTCTGGGTAGG - Intronic
1039086991 8:33789792-33789814 TGAGTGAGACAACAGTGGGATGG - Intergenic
1039314716 8:36358472-36358494 AGAAAGATACAATGCTGGCAGGG - Intergenic
1041143481 8:54846802-54846824 AGAATGAGACACCTCAGGGAAGG - Intergenic
1043291703 8:78610193-78610215 AGAATGAAACAAAATTGGGAAGG + Intergenic
1043811167 8:84742608-84742630 AGAATCAGAGGAAACTGGGAGGG + Intronic
1044635876 8:94323425-94323447 AGAATGGGACAAACCTTGGAAGG + Intergenic
1044889082 8:96813258-96813280 AGAATAAGCCAAGGCTGGGAGGG + Intronic
1045930767 8:107624045-107624067 AGAATGAAACATTAGGGGGATGG - Intergenic
1047303880 8:123637694-123637716 AAGATGAGACCATGCTGGGAAGG + Intergenic
1048203165 8:132393847-132393869 AGCATGCAACAAGACTGGGAGGG - Intronic
1048884422 8:138898277-138898299 AGAAATTCACAATACTGGGATGG - Intronic
1049827870 8:144681689-144681711 GGTAGGAGACAAAACTGGGATGG + Intergenic
1050809089 9:9720491-9720513 AGACTTAGAAAATACTGGCAGGG + Intronic
1051081397 9:13298488-13298510 AGAATGAGATAATCCTTGGGTGG + Intergenic
1052778122 9:32753672-32753694 AGAATGAGCAAAGAGTGGGAGGG + Intergenic
1054704734 9:68450884-68450906 TGACTGAGAGAATTCTGGGATGG + Intronic
1055630722 9:78220716-78220738 AGAATGAGGCAAGAGAGGGAAGG - Intergenic
1056706038 9:88953459-88953481 AGAATGAGACATCGCTGGGCAGG - Intergenic
1057499281 9:95584169-95584191 AGAAGGAGACAGGACTGAGATGG - Intergenic
1057805319 9:98215799-98215821 AGAATGAGACAGTCCTGGCCAGG - Intronic
1057952883 9:99384159-99384181 AGCAGGAGACAATGCTGGAAAGG + Intergenic
1059009764 9:110444032-110444054 AGAATGAGTCAAGAATGGAAAGG + Intronic
1060458124 9:123820028-123820050 ATGATGAAACAATATTGGGAGGG + Intronic
1060770475 9:126327974-126327996 ACAATGAGATTATACTGAGAAGG - Intronic
1062265087 9:135683326-135683348 AAAATGACACAATTCTGGGCAGG + Intergenic
1187128523 X:16477682-16477704 AGAGCCAGACAATCCTGGGATGG - Intergenic
1188318368 X:28704879-28704901 AGAATGAGACAATACTGGGATGG + Intronic
1188429285 X:30087619-30087641 ACAATAAGAAAATTCTGGGAAGG - Intergenic
1190323118 X:49190059-49190081 AGAAGGTGGCAATACTTGGATGG - Intronic
1191904926 X:66077305-66077327 AGAGTGAGACCCTATTGGGAAGG - Intergenic
1193227743 X:79005139-79005161 AAAATGAAAGAATAATGGGAGGG + Intergenic
1194378639 X:93166517-93166539 AAAAGGAGAGAATAGTGGGAAGG + Intergenic
1194476943 X:94369767-94369789 AGAAGGAGAGAAGAGTGGGAAGG + Intergenic
1198214420 X:134544208-134544230 AAAATGAGAAAATAGTGGAAAGG + Intergenic
1198831932 X:140759995-140760017 AAAATGAGACTATACTAGGCTGG + Intergenic
1199310247 X:146313064-146313086 AGAAGGTGACAATACTTGCAGGG - Intergenic
1201379744 Y:13361845-13361867 AGAATGAGTCATTAATGGGCTGG + Intronic
1202129245 Y:21595208-21595230 GGAATGGGTTAATACTGGGAGGG + Intergenic