ID: 1188334780

View in Genome Browser
Species Human (GRCh38)
Location X:28917546-28917568
Sequence TGATTCAGTGATTCTTAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 319}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188334780 Original CRISPR TGATTCAGTGATTCTTAGTA GGG Intronic
901422551 1:9160907-9160929 TGATTAAGTCATTTTAAGTAAGG + Intergenic
901896582 1:12318355-12318377 TGATTCATTGGTGCTTAGTTTGG + Intronic
905794394 1:40807477-40807499 TGATCCAGCGATTCTAAATATGG - Intronic
906637468 1:47418801-47418823 TGATTCAGTGAGTCTGAGTGGGG - Intergenic
907133000 1:52113392-52113414 TGAAACAGTGATTTTTAATAAGG + Intergenic
908099436 1:60775489-60775511 GGATTCATTGATTTTTTGTAGGG + Intergenic
908099902 1:60780008-60780030 GGATTCATTGATTTTTTGTAGGG - Intergenic
908871168 1:68614682-68614704 TGATTCACTGAATTTTAGTTTGG - Intergenic
908970907 1:69829090-69829112 TGATTTGCTGATTCTTACTATGG + Intronic
909309741 1:74130916-74130938 GGATTCATTGATTCTTTGAAGGG - Intronic
909396717 1:75178629-75178651 GGATTCAGTGATTTTTTGAAGGG + Intergenic
909454197 1:75831970-75831992 TGATTCATTGATTTTTTGAAGGG - Intronic
909874632 1:80786702-80786724 GGATTCAGTGATTTTTCGAAGGG - Intergenic
910612239 1:89157390-89157412 TGATTCATTGATTTTTTGAAGGG - Intronic
910717680 1:90250172-90250194 GGATTCAGTGATTTTTTGAAGGG - Intergenic
913704391 1:121404496-121404518 GGATTCATTGATTTTTAGAAGGG - Intergenic
913985413 1:143561055-143561077 GGATTCATTGATTTTTAGAAGGG + Intergenic
914801542 1:150966144-150966166 TGGTTCAGTCATTCTTACGATGG + Exonic
916603148 1:166313840-166313862 GGATTCATTGATTTTTTGTAGGG + Intergenic
916621281 1:166500422-166500444 GGATTCATTGATTCTTTGAAGGG + Intergenic
916647658 1:166802002-166802024 GGATTCATTGATTCTTTGAAGGG + Intergenic
917290156 1:173463910-173463932 GGATTCATTGATTCTTTGAAGGG - Intergenic
917467168 1:175290466-175290488 TGATTCATTGATTTTTAGAGGGG - Intergenic
917890531 1:179433320-179433342 GGATTCATTGATTCTTTGAAGGG + Intronic
918303558 1:183225831-183225853 TGAATCAGTGATTCTAAGTCAGG - Intronic
919643790 1:200071531-200071553 TTATTCAGTTATTCTCAATATGG - Intronic
920731789 1:208493762-208493784 GGTTTCAGTGATTCTTCATATGG + Intergenic
920824822 1:209415427-209415449 TGATTCAGTGGGTCTTAGGTAGG + Intergenic
920889701 1:209972311-209972333 GGTTTCATTGATTCTTCGTATGG + Intronic
1063029050 10:2213345-2213367 TGGTTCAGTCATTATTATTATGG - Intergenic
1064496043 10:15911562-15911584 TGATTCATTCATTCTTATTTTGG + Intergenic
1064858222 10:19795841-19795863 TGATTCAGTGAGTCTGACTCTGG - Intergenic
1066454103 10:35558220-35558242 TGAGGCAGTGAACCTTAGTAAGG + Intronic
1069199030 10:65590060-65590082 GGATTCATTGATTCTTTGAAGGG + Intergenic
1069406288 10:68103023-68103045 TGATTAATTCATTCTTAGTTTGG + Intergenic
1070344972 10:75532650-75532672 TGCTTGAGTCATTCTCAGTATGG + Intronic
1070970083 10:80556758-80556780 TTAATCAGTGATTTTTAGCAAGG - Intronic
1071099625 10:82019894-82019916 TGATTCATTGATTTTTTGAAGGG + Intronic
1071946255 10:90648367-90648389 GGATTCATTGATTCTTTGAAGGG + Intergenic
1072698619 10:97623123-97623145 TGATTCAGTAAGTCTGAGTTTGG - Intronic
1073296668 10:102443916-102443938 TTATTTAGTGATTATTAGTATGG + Intergenic
1074470191 10:113719921-113719943 GGATTCAGTGATTTTCAGAACGG + Intronic
1076510465 10:131010636-131010658 GGATTCAGTGAGTCTTAGCTTGG + Intergenic
1077655383 11:4014006-4014028 TGATTCATTGATTTTTTGAAGGG + Intronic
1078541298 11:12215508-12215530 TGATTCAGTGAGTCTGAAGAAGG + Intronic
1079289988 11:19179322-19179344 TGATTAAGAGGTTATTAGTAGGG + Intergenic
1079547324 11:21648155-21648177 TGATTCAGTTGTTCTAGGTAGGG - Intergenic
1079815086 11:25046238-25046260 TGAGTCAATGATTATTAGGAAGG + Intronic
1080167645 11:29259008-29259030 TGGTTCATTGATGCTTTGTATGG + Intergenic
1081010047 11:37799692-37799714 TGATTCAGTGTTACATTGTAAGG + Intergenic
1082746827 11:56972171-56972193 GGTTTCATTGATTCTTTGTATGG - Intergenic
1083152963 11:60804847-60804869 TAAATCAATGATTTTTAGTATGG - Intergenic
1083532148 11:63433473-63433495 GGATTCATTGATTCTTTGAAGGG - Intergenic
1084506454 11:69571371-69571393 TGATTCATTGAGTCTGAGCAGGG + Intergenic
1084928378 11:72533147-72533169 GGTTTCATTGATTCTTTGTATGG + Intergenic
1084945375 11:72635406-72635428 TGATTCAATGATTCTAAATGGGG - Intronic
1085954804 11:81378824-81378846 TCATTCTGTCATTCATAGTAAGG - Intergenic
1086199149 11:84179676-84179698 GCATTCAGTGCTTCTTAATAAGG + Intronic
1089755635 11:120684398-120684420 CCATTCAGTTATTCATAGTATGG + Intronic
1089886225 11:121826764-121826786 GGATTCATTGATTCTTTGAAGGG - Intergenic
1090216028 11:124965598-124965620 GGATTCATTGATTCTTTGAAGGG + Intronic
1091800864 12:3323762-3323784 TGATTCTGTGCATCTTACTATGG + Intergenic
1093270035 12:17049254-17049276 GGATTCATTGATTTTTAGAAAGG - Intergenic
1093329496 12:17817486-17817508 GGATTCATTGATTCTTTGAAGGG + Intergenic
1093425526 12:19024177-19024199 GGATTCAGTGATTTGTAGGATGG - Intergenic
1093988176 12:25561099-25561121 TGATTCATTGATTTTTTGAAGGG + Intronic
1095353863 12:41247347-41247369 TGATTCAGTGAGTTTTACTGGGG - Intronic
1095656446 12:44674987-44675009 TGAATCAGTGAATCTTTTTATGG + Intronic
1097499465 12:60383923-60383945 GGATTCAGTGATTTTTTGGAGGG + Intergenic
1097512582 12:60562288-60562310 TGATTCATTGATCTTTTGTATGG + Intergenic
1097856252 12:64465861-64465883 CAATTCAGTCATTTTTAGTATGG - Intronic
1098536638 12:71600663-71600685 TGATTCAGTGGGTCTGGGTAGGG + Intergenic
1099515550 12:83592743-83592765 GGATTCATTGATTCTTTGAAGGG - Intergenic
1099710153 12:86213335-86213357 TATTACAGTGATTCTCAGTAGGG - Intronic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1102602961 12:114046711-114046733 TGATTCAGGGTTTCTTAATTGGG - Intergenic
1105338381 13:19496296-19496318 TGAGTCAGTGAGTCTTAGATAGG - Intronic
1105668181 13:22583835-22583857 GGATTCATTGATTCTTTGAAGGG + Intergenic
1105926123 13:25010228-25010250 TGATTCATTGATTTTTTGAAGGG + Intergenic
1106066703 13:26359399-26359421 TGTTTAAGTGATTCATAATAAGG + Intronic
1106429724 13:29668759-29668781 GGATTCATTGATTTTTAGAAGGG - Intergenic
1106492894 13:30244586-30244608 TGATTCATTGATTTTTTGAAGGG - Intronic
1108113778 13:47105805-47105827 GGATTCACTGATTTTTTGTAGGG - Intergenic
1108217992 13:48204042-48204064 GGATTCACTGATTCTTTGAAGGG - Intergenic
1108373113 13:49790753-49790775 TAGCTCAGTGATACTTAGTAAGG - Intronic
1108960800 13:56226056-56226078 AGTTTCATTGATTCTTTGTATGG - Intergenic
1109331434 13:60935536-60935558 TGATTCATTGATTTTTTGAAGGG + Intergenic
1109473678 13:62847754-62847776 TGATTCAGTAGATCTTTGTAAGG + Intergenic
1109625953 13:64974706-64974728 TGTTTAATTGATCCTTAGTATGG + Intergenic
1110772132 13:79361870-79361892 TTTTTCAGTGATTCTCAGTGGGG + Intronic
1111883178 13:93984932-93984954 TGATTCACTTATTGTTAGTTTGG - Intronic
1113039587 13:106090421-106090443 TGATTCAGTACATTTTAGTAGGG - Intergenic
1115083124 14:29481105-29481127 TGATTCATTGATTTTTTGAAGGG + Intergenic
1116024995 14:39504431-39504453 TACTTCATTGATTCTTTGTATGG + Intergenic
1118521453 14:66590344-66590366 TGATTCATTGATTTTTTGAAGGG - Intronic
1120078584 14:80188485-80188507 TTATTTAATGATTCTTATTAAGG + Intergenic
1120807027 14:88763191-88763213 TGATTCATTGATTTTTTGAAAGG - Intronic
1121586447 14:95066070-95066092 AGATTCTGTGATTCTAAGAAAGG - Intergenic
1202887739 14_KI270722v1_random:123756-123778 GGATTCATTGATTCTTTGAAGGG + Intergenic
1125761157 15:42096267-42096289 TAATTCAGAGATTCTTAATTTGG + Intergenic
1127101428 15:55569240-55569262 TGTTTCATTGATACTTTGTATGG + Intronic
1127169051 15:56279672-56279694 TAATTCAGTAATTCTTGGAAAGG + Intronic
1127523115 15:59762781-59762803 TGATTCAGTCATTCTGGGTGGGG - Intergenic
1127752802 15:62062500-62062522 TGTTTCAGTTATACTTTGTAAGG + Intergenic
1130313389 15:82773677-82773699 TGACCCAGTGATTCTAAGAATGG + Intronic
1130452003 15:84064833-84064855 TGCTTCATTGATCCTTTGTACGG + Intergenic
1132376372 15:101330759-101330781 AGATTCAGTAATTATTAATAAGG - Intronic
1134131833 16:11655543-11655565 TGAGTCAGTGACTCTGAGTCTGG + Intergenic
1134421338 16:14092670-14092692 TGAGTCAGTTATTCTTAAAAAGG - Intronic
1135464882 16:22676687-22676709 TAATTCAGTGGTTCTCAGTCGGG - Intergenic
1135712233 16:24727571-24727593 TGACTCAGTGATTCTTAATTGGG - Intergenic
1135825741 16:25726945-25726967 GGATTCACTGATTCTCAGAAGGG + Intronic
1135941508 16:26826139-26826161 TAATCCAGTGATTCTCCGTAGGG + Intergenic
1136650977 16:31670402-31670424 TGTTTCATTGATTTTTTGTATGG + Intergenic
1137810371 16:51346886-51346908 TGATTCAGTGATCCTAATTCTGG - Intergenic
1138912483 16:61418401-61418423 TTGTTCAGTGATTATTATTATGG + Intergenic
1139026998 16:62830396-62830418 TGATTCAGTGAATCTAAGATGGG + Intergenic
1139154131 16:64420496-64420518 TGATTCAGTGAATTTTAGAATGG - Intergenic
1143550826 17:7629508-7629530 TGATTCAGTGAATATTAAGAAGG - Intronic
1144439858 17:15271886-15271908 TGTTGCTGTGATTCTGAGTAAGG + Intergenic
1145302572 17:21651239-21651261 TGAATCTGTATTTCTTAGTATGG + Intergenic
1145347732 17:22051953-22051975 TGAATCTGTATTTCTTAGTATGG - Intergenic
1149109784 17:53014559-53014581 TGAATCCATGATTCTTAGCATGG + Intergenic
1153784120 18:8519017-8519039 TGATTCAGGGATAGTGAGTATGG + Intergenic
1156217831 18:35018777-35018799 GGTTTCACTGATTCTTTGTATGG + Intronic
1157893715 18:51443597-51443619 TGATTCAGTGATTCCATTTAAGG - Intergenic
1158072828 18:53493719-53493741 TGATTCATTGATTTTTTGAAGGG + Intronic
1158652418 18:59299837-59299859 TGATTCAGTGGGTCTGAGTAGGG - Intronic
1162182936 19:8882994-8883016 GCATTCAGAGAATCTTAGTATGG - Intronic
1167962323 19:53116007-53116029 TGATTCAGTAGTTCTTGGAAGGG - Intronic
1202663147 1_KI270708v1_random:90598-90620 GGATTCATTGATTCTTTGAAGGG + Intergenic
925301596 2:2817834-2817856 GGATTCAGTGATTTTTTGAAGGG + Intergenic
925595044 2:5547318-5547340 TGACCCAGTGTTTCTTAGAAGGG + Intergenic
926501605 2:13660682-13660704 GGTTTCATTGATTCTTTGTATGG + Intergenic
930916226 2:56691990-56692012 GGATTCACTGATCTTTAGTATGG - Intergenic
931825872 2:66000492-66000514 TGACTCAGTAATTTTTAGAAGGG + Intergenic
933016833 2:77138657-77138679 TGATTCATTGATTTTTTGAAGGG - Intronic
933638845 2:84737785-84737807 TGTTTCATTGATCCTTTGTATGG + Intronic
939492093 2:142888609-142888631 TGATTCAGTAATTCTGAGTTAGG - Intronic
943057218 2:182997208-182997230 TGTTTCACTGATCCTTTGTATGG + Intronic
943352771 2:186815034-186815056 GGATTCATTGATTTTTAGAAGGG - Intergenic
944601824 2:201310827-201310849 TGTTTCATTGATTCTTTGTATGG - Intronic
944607613 2:201366788-201366810 GGTTTCATTGATTCTTTGTATGG - Intergenic
945289596 2:208113828-208113850 TAAATCAGTGGTTCTTAGTGCGG - Intergenic
945843164 2:214912549-214912571 TAATTCAGTGATTCTCAATTTGG - Intergenic
946468572 2:219934861-219934883 GGATTCAGTGATTTTTTGAAGGG - Intergenic
947226311 2:227843777-227843799 TGATTGAGTGATTGATACTAAGG - Intergenic
1168921767 20:1543577-1543599 TGATTCACTGATTTTTTGAAGGG + Intronic
1168961294 20:1871691-1871713 AGGTTCAGAGATTCTAAGTAGGG - Intergenic
1169729890 20:8775307-8775329 TGATTCCTTGATACATAGTAGGG + Intronic
1171168060 20:22990548-22990570 GGATTCAGTGATTTTTTGAAGGG + Intergenic
1171410688 20:24945958-24945980 TGATTCATTGATTTTTTGAAAGG - Intergenic
1172049226 20:32103574-32103596 TGATTCTGTACTTCTGAGTAGGG + Intergenic
1172064893 20:32212430-32212452 TAATTCTTTGATTTTTAGTAGGG + Intronic
1172330760 20:34074753-34074775 TGGTTCAGTGATTCTGACCAAGG + Intronic
1172830845 20:37833161-37833183 TGATTCTGGGGTTCTGAGTATGG - Intronic
1173094861 20:40015791-40015813 TGATTCAGTAATTTATAGAATGG - Intergenic
1173310372 20:41891757-41891779 TGATTCAGTGTGTCCTAGGAGGG + Intergenic
1173366916 20:42394411-42394433 TGCTTAAGAGATTCTTAGGAAGG + Intronic
1174276157 20:49405803-49405825 GGATCCAGTGATTCTCAGCAGGG + Intronic
1177089230 21:16745809-16745831 TGATTCAGTGTTTCTTATCAGGG - Intergenic
1177438741 21:21090122-21090144 TGATTCAGTGATTCTGGGGTGGG - Intronic
1177871753 21:26581252-26581274 GGTTTCATTGATTCTTTGTATGG + Intergenic
1177871866 21:26583141-26583163 TGATTGATTGATTGTGAGTATGG + Intergenic
1180329884 22:11467483-11467505 GGATTCATTGATTCTTTGAAGGG + Intergenic
1180993257 22:19951403-19951425 TGATTTTATGATTCTGAGTAAGG - Intronic
1182419279 22:30241110-30241132 TGATTCAGTGATGCTGTGCAGGG + Exonic
1182530060 22:30948423-30948445 TGATTCAGTGGATCTGGGTAGGG - Intronic
949225135 3:1684824-1684846 GGATTCATTGATTTTTAGGAGGG - Intergenic
950128414 3:10525481-10525503 TGATTCATTGATTATGAGAAAGG - Intronic
950994186 3:17477605-17477627 TGATTAAGTGATTTTTATAACGG - Intronic
951368576 3:21815369-21815391 TGATTCATTGATTTTTTGAAGGG - Intronic
951612319 3:24504250-24504272 TGATTCAGTGTTCTTAAGTAGGG - Intergenic
951828909 3:26901549-26901571 TGTTTCATTAATCCTTAGTATGG - Intergenic
953169064 3:40491154-40491176 TGAAGCAGTGATTCTGAGAAGGG - Intergenic
954286720 3:49624701-49624723 TGATTCAGTAGATCTGAGTAGGG - Intronic
955546856 3:60040479-60040501 TAACTCAGTGATAATTAGTAGGG + Intronic
957187180 3:76956788-76956810 TGATTCAGTGGTTCTGAGGTTGG - Intronic
958006999 3:87824616-87824638 TCATTCAGGGATTCATATTATGG - Intergenic
959166826 3:102790700-102790722 TGATTGTGTGATTTTTATTAGGG + Intergenic
960247840 3:115419088-115419110 TGAATAACTGATTTTTAGTAAGG - Intergenic
962028636 3:131575031-131575053 TGATTCCTTGATTCTTATTCAGG - Intronic
962111336 3:132452430-132452452 TGATCCAGTGTTTCTCAGCAGGG + Intronic
963367917 3:144362569-144362591 TGATTCAGACATTCTAAGAAAGG + Intergenic
963574496 3:147042858-147042880 TAATTCAGTGGTTCTCAATAGGG - Intergenic
963578413 3:147093161-147093183 TTATTCAGAGATGCTTAGCATGG + Intergenic
963867247 3:150375928-150375950 AGATTCAGTTCTTTTTAGTAAGG - Intergenic
964740935 3:159965243-159965265 TGATTCATTCTTTCTTAGGAAGG - Intergenic
964882288 3:161436707-161436729 TGTTTCATTGATCCTTTGTATGG - Intergenic
964966666 3:162502697-162502719 TGATTCACTGATTTTTTGAAGGG - Intergenic
965105997 3:164354350-164354372 TAATACAGTCATTCTTAGAATGG + Intergenic
965357898 3:167699688-167699710 TGGATCAGTGATTCTCAGTCTGG + Intronic
965444488 3:168758214-168758236 TGATTCACTGATTTTTTGAAGGG - Intergenic
965618917 3:170622955-170622977 TGCTTCAGTGCTTCTAAGAAGGG - Intronic
965774191 3:172210886-172210908 TGATTTAATGATTCTATGTATGG - Intronic
966352078 3:179041768-179041790 GGATTCAGTGATTTTTTGAAGGG - Intronic
967801685 3:193668760-193668782 TGACAAAGTGATTATTAGTAGGG - Intronic
967977811 3:195045163-195045185 TGATTCAGTGAGTCCAAGTGTGG - Intergenic
968637818 4:1691147-1691169 TAATTCTGTGACTCTTAATAGGG + Intergenic
969852642 4:9972983-9973005 GGTTTCATTGATTCTTTGTATGG - Intronic
970022380 4:11583608-11583630 TAATTCATTGACTCTAAGTAAGG + Intergenic
970796415 4:19918628-19918650 GGATTCAGTGATTTTTTGAAGGG + Intergenic
971989056 4:33867418-33867440 GGATTCATTGATTCTTTGCAGGG - Intergenic
972633644 4:40863424-40863446 TGATTCAGTGGGTCTGGGTAGGG + Intronic
973154016 4:46925657-46925679 TCATTCAGTGATTTTTATTTTGG - Exonic
974105968 4:57470355-57470377 TGATTCACTGATTTTTTGAAAGG + Intergenic
974710043 4:65579265-65579287 TTATTCAGTCATTCTTACTTAGG - Intronic
975461918 4:74663776-74663798 TGCTTGAGTGATTCTGAATAAGG - Intergenic
975752971 4:77543317-77543339 GGTTTCATTGATTCTTTGTATGG + Intronic
976093066 4:81477123-81477145 TGATTCATTGATTTTTTGAAGGG - Intronic
977194186 4:94039008-94039030 TGATTCAGTAAGTCTAAGTTGGG + Intergenic
977203588 4:94145425-94145447 GGATTCAGTGATTTTTTGAAGGG + Intergenic
978144083 4:105351483-105351505 TGATTCAATGATTATGAGAATGG + Intergenic
978205036 4:106071054-106071076 GGATTCAGTGATTTTTTGAAAGG + Intronic
978714918 4:111830364-111830386 TTATTAATTGATTCTTAGAAGGG - Intergenic
980973889 4:139592337-139592359 TGATTCAGTGGGTCTGGGTAGGG - Intronic
981460248 4:145005416-145005438 AGATTCAATGATCCTTTGTATGG + Intronic
982970887 4:161984864-161984886 TGATTTAGTGGTTCTGACTAGGG - Intronic
983387801 4:167088325-167088347 TAATGCAGTGATTCTCAGTGTGG - Intronic
983620770 4:169758541-169758563 TGATTCAGTAAGTCTGGGTAAGG - Intergenic
984354481 4:178640162-178640184 GGATTCATTGATTTTTAGAAGGG - Intergenic
984563174 4:181295021-181295043 TGATTCACTTTTTCTGAGTATGG + Intergenic
985012134 4:185593622-185593644 TGCTTCAGTGATTCCTAAGATGG - Intronic
986426526 5:7637119-7637141 TGAATCATTGATTCTAAGGAAGG + Intronic
986855109 5:11859219-11859241 TGCTTCAGTCATTCATAGGAAGG - Intronic
987948356 5:24644805-24644827 TCATTCAGTGCTTCTGATTAAGG + Exonic
987961944 5:24822477-24822499 GGTTTCATTGATTCTTTGTATGG + Intergenic
987983365 5:25116692-25116714 GGATTCATTGATTTTTAGAAGGG + Intergenic
988021149 5:25624038-25624060 GGATTCATTGATTTTTTGTATGG - Intergenic
988732022 5:33981830-33981852 TGATTCAGTGAGTCTAAGGCGGG - Intronic
989217015 5:38915654-38915676 TAATTCAGTTATTTTTATTAGGG + Intronic
990127483 5:52536408-52536430 GGATTCATTGATTTTTTGTAGGG - Intergenic
990534718 5:56709130-56709152 TGTTTCATTGATTTTTTGTATGG - Intergenic
991348311 5:65693634-65693656 TGGTTCAGTGAATTTTAGGAGGG - Intronic
992845717 5:80744915-80744937 TCATTCAGTGATTCTGAGCATGG + Intronic
993153876 5:84196919-84196941 TGATACAGAGAATATTAGTATGG + Intronic
993274306 5:85836518-85836540 TGCTTCAGTGATTCTTAACAAGG + Intergenic
993527628 5:88985804-88985826 TGCTTCATTGATTCTTAGATGGG + Intergenic
993627647 5:90244909-90244931 TGATTCAGAGATATTAAGTATGG - Intergenic
993688757 5:90972886-90972908 GGATTCATTGATTTTTTGTAGGG - Intronic
994265533 5:97711499-97711521 TGAATAAGTGATTATTAGAAGGG - Intergenic
994451817 5:99952789-99952811 TGATACAATGTGTCTTAGTATGG - Intergenic
994536573 5:101038757-101038779 TGCTTCATTGAATCTTTGTATGG + Intergenic
994642243 5:102424306-102424328 TGATTCATTGATTTTTTGAAGGG - Intronic
996147029 5:119989099-119989121 GGATTCATTGATTTTTAGAAGGG + Intergenic
998780754 5:145653933-145653955 GGATTCAGTGATTTTTTGAAGGG - Intronic
998925884 5:147125839-147125861 GGATTCATTGATTCTTTGAAGGG + Intergenic
1000498239 5:162013205-162013227 TGTTTCAGTAATTTTTAGGAAGG + Intergenic
1000738735 5:164938174-164938196 TGAGAGAGTGTTTCTTAGTAGGG + Intergenic
1002997445 6:2300036-2300058 GGATTCAGTGATTTTTTGAAGGG - Intergenic
1003275328 6:4646001-4646023 TGATTCAGTGCGTTTGAGTAGGG - Intergenic
1004278365 6:14257902-14257924 TGATTCAGTGAGTCTGAGGCAGG - Intergenic
1004599633 6:17135729-17135751 GGTTTCATTGATTCTTTGTATGG - Intergenic
1008937030 6:57002889-57002911 AGTTTCATTGATTCTTTGTATGG - Intronic
1008968682 6:57341206-57341228 TAGTTCAGTGATTCTCAGTGGGG + Intronic
1009157664 6:60243024-60243046 TAGTTCAGTGATTCTCAGTGGGG + Intergenic
1009482491 6:64176575-64176597 TGATTCAGTCATTTTTATTTTGG + Intronic
1009570474 6:65377559-65377581 TGATTCAATGATTTTTTGAAGGG - Intronic
1010310189 6:74375995-74376017 GGATTCATTGATTCTTTGAAGGG + Intergenic
1010352057 6:74886241-74886263 GGATTCACTGATTCTTTGAAGGG + Intergenic
1011970825 6:93220534-93220556 TGGTTCATGGGTTCTTAGTATGG + Intergenic
1012538063 6:100323510-100323532 GGTTTCATTGATTCTTTGTATGG + Intergenic
1013393012 6:109705573-109705595 TGATTCATGGATTCTTTGGAAGG + Intronic
1014161158 6:118170250-118170272 TGATTCAAAGATTTTTATTAAGG - Intronic
1014431072 6:121371427-121371449 TGATTCATTGATTTTTTGAAAGG - Intergenic
1014589514 6:123246272-123246294 AGATTCATTGATTTTTAGAAGGG - Intronic
1014590026 6:123254078-123254100 TGTTTACTTGATTCTTAGTAAGG - Intronic
1014689566 6:124546461-124546483 TGCTTCAGAGATGCTTAGCATGG + Intronic
1014872329 6:126611963-126611985 GGATTCAGTGATTTTTTGAAGGG + Intergenic
1014919090 6:127191393-127191415 TGATTCAGTGGTTCTTATGAGGG - Intronic
1015485354 6:133763888-133763910 TTATTCAGCTTTTCTTAGTATGG - Intergenic
1017552526 6:155524321-155524343 TGAATCATTGATACTTAGTCTGG - Intergenic
1017623811 6:156327939-156327961 GGATTCATTGATTCTTTGAAGGG + Intergenic
1018457763 6:163967859-163967881 TTATTCAGTCATTTTTATTATGG - Intergenic
1020364765 7:7369064-7369086 TGATTCAGTGATTATAAGGAGGG + Intronic
1021351516 7:19599777-19599799 GGATTTATTGATTCTTTGTATGG + Intergenic
1022049212 7:26648876-26648898 TAATTCAGTGACTCTTAGCCTGG - Intergenic
1022476287 7:30712589-30712611 TGATTCAGTGACTCTGAGGTAGG - Intronic
1022799404 7:33761423-33761445 TAATTCAGTGGTTCTCAGTGTGG - Intergenic
1022810718 7:33865207-33865229 CGATTCAGTGAGTCTGGGTAGGG - Intergenic
1023051443 7:36255782-36255804 GGATTCATTGATTCTTTGAAGGG + Intronic
1027630273 7:80595640-80595662 AGATTCAGTGATTCTTAACAAGG - Intronic
1028644445 7:93079570-93079592 GGATTCATTGATTCTTTGAAGGG - Intergenic
1031211468 7:118833710-118833732 TTAATAAGTGATTTTTAGTAAGG + Intergenic
1031900962 7:127410141-127410163 TAATTCAATGATTCTCACTAGGG + Intronic
1032644651 7:133809489-133809511 AGATTCAGAGCTTCTCAGTAAGG + Intronic
1033139445 7:138812254-138812276 TGATTCAGTCATTCTAAGAATGG - Intronic
1033257723 7:139816639-139816661 TGATTCAGTAATTCTGGGTTGGG - Intronic
1034551571 7:151823863-151823885 TGATTCAGTAGTTCTTAATTGGG - Intronic
1034905921 7:154945783-154945805 TAATTCAGAGATTTTTAATAAGG + Intronic
1037676580 8:21056309-21056331 TAATTCTGTGATTCTAAATAAGG + Intergenic
1038191235 8:25323088-25323110 TGCTTCAGTGGCTCTGAGTAGGG - Intronic
1040992992 8:53372170-53372192 GGATTCATTGATTCTTTGAAGGG - Intergenic
1042751976 8:72167632-72167654 GGATTCATTGATTTTTTGTATGG + Intergenic
1042969025 8:74388131-74388153 GGATTCATTGATTCTTTGAAGGG + Intronic
1043067895 8:75599802-75599824 TGATTCATTGATTTTTTGAAGGG - Intergenic
1043209917 8:77499528-77499550 TGATTCTGTGAATCTTATTAAGG + Intergenic
1044314304 8:90731712-90731734 TGATTCATTGATTTTTTGAAGGG + Intronic
1044315193 8:90742429-90742451 GGTTTCATTGATTCTTTGTATGG + Intronic
1045490746 8:102667176-102667198 TGATTCAGTGATTCTGGGTTGGG + Intergenic
1046081300 8:109373461-109373483 GGATTCAGTGATTTTTTGAAGGG + Intronic
1046454781 8:114443783-114443805 TGTTTCATTGATACTTTGTATGG - Intergenic
1046563878 8:115873709-115873731 TGCTTCATTGTTTCTTAGAATGG - Intergenic
1047630493 8:126701315-126701337 TGATTGATTGATTCTTTGTATGG - Intergenic
1048835975 8:138519274-138519296 TGAATCAGTGGTTTTGAGTAAGG - Intergenic
1050677777 9:8075899-8075921 AGATTCATTGATTTTTATTAAGG + Intergenic
1050749834 9:8924157-8924179 TGATTCAGTGCTTCTGAGAAAGG + Intronic
1050869838 9:10553095-10553117 TGCTTCTGTGATTCTCAGCATGG - Intronic
1051235240 9:14992658-14992680 TGATTCAGTAAGTCTGGGTAGGG + Intergenic
1051809513 9:21032955-21032977 TGATGCAGTGAGTCTGAGAAGGG - Intergenic
1052682516 9:31711715-31711737 TGATTCAGTAATTGTTAAAAAGG - Intergenic
1055004020 9:71484863-71484885 TGATTCAGTAGATCTGAGTAGGG + Intergenic
1056158524 9:83864130-83864152 TGATTCACTGATTTTTTGAAGGG + Intronic
1056352041 9:85759806-85759828 TGATTCACTGATTTTTTGAAGGG - Intergenic
1058124635 9:101177520-101177542 TGATTCAGTAAAACCTAGTATGG - Intronic
1058272919 9:102997391-102997413 TGAAGCAGTGTTTCTTAGCATGG - Intronic
1058367612 9:104228695-104228717 TTATTCAGTGATTCTCAGCCAGG - Intergenic
1058823683 9:108755661-108755683 TGATTCAGTGGGTCTGAGTGGGG - Intergenic
1059292365 9:113237835-113237857 TGATTGATTGATTCTAAGTCTGG - Intronic
1059822606 9:117990739-117990761 TGATTGACTAAGTCTTAGTATGG + Intergenic
1061028449 9:128065682-128065704 TCATTCAGTGATTCTCAGTGGGG - Intronic
1186198921 X:7136862-7136884 TGATACAGTGATACTCAGGAGGG - Intronic
1186205840 X:7198997-7199019 TTATTAAGTGATTGTCAGTAAGG - Intergenic
1187661149 X:21548109-21548131 GGATTCACTGATTCTTTGAAGGG - Intronic
1188146213 X:26617025-26617047 TAAAGCAGTGATTCTTAGTTGGG + Intergenic
1188334780 X:28917546-28917568 TGATTCAGTGATTCTTAGTAGGG + Intronic
1192945238 X:75959380-75959402 GGATTCAGTGATTTTTTGAAAGG - Intergenic
1193168049 X:78303907-78303929 TGATTCACAGATTTATAGTATGG - Intronic
1193409612 X:81146682-81146704 TGATTCATTGATTTTTTGAAGGG - Intronic
1193622620 X:83774741-83774763 TAATTCAGTTATTCTTAATAAGG + Intergenic
1194939081 X:99987770-99987792 TGATACAGGGATTGATAGTAAGG - Intergenic
1195469327 X:105215146-105215168 GGATTCATTGATTCTTTGAAGGG - Intronic
1196269510 X:113694874-113694896 TGATTCATTGATTTTTTGAAGGG + Intergenic
1196566590 X:117213001-117213023 GGTTTCATTGATTCTTTGTATGG - Intergenic
1198245677 X:134829356-134829378 TGTTTCAGTAATTCTAAGTGAGG + Intronic
1199597454 X:149517948-149517970 TGTTTCATTGATTCTTTGTCTGG - Intronic
1200762944 Y:7056583-7056605 TGATGCAGTGATTCTCAGTGAGG - Intronic
1201413545 Y:13725116-13725138 GGATTCATTGATTCTTTGAAGGG - Intergenic
1201533032 Y:15013299-15013321 TGATTCATTGATTTTTTGAAGGG + Intergenic
1202044734 Y:20726909-20726931 TGATGCAGTGATTCTCAACAGGG - Intergenic
1202333139 Y:23775957-23775979 GGATTCATTGATTCTTTGAAGGG + Intergenic
1202537630 Y:25894106-25894128 GGATTCATTGATTCTTTGAAGGG - Intergenic