ID: 1188336677

View in Genome Browser
Species Human (GRCh38)
Location X:28943859-28943881
Sequence AACTCAGAAAAAATACATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 556}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188336677 Original CRISPR AACTCAGAAAAAATACATTA AGG (reversed) Intronic
900528407 1:3140569-3140591 AACTCAGGAGCAATTCATTAAGG + Intronic
901135790 1:6994168-6994190 AAAAAAGAAAAAATACACTATGG - Intronic
903672402 1:25044517-25044539 GTCTCAGAAAAAAAAAATTAGGG - Intergenic
904107737 1:28099899-28099921 ATCTCAAAAAAAAAAAATTATGG + Intergenic
904204750 1:28846775-28846797 AACTCTGAATAAATACAATGGGG - Intronic
904312691 1:29639589-29639611 ACCTCAGAGAATATACATTCTGG + Intergenic
904899017 1:33841637-33841659 AACTGAAAAAAAAAACCTTAAGG + Intronic
905381742 1:37566749-37566771 ACCTCAGAACAAATGCATTAGGG + Exonic
905683969 1:39895836-39895858 ACCTCAGAAAGAAACCATTATGG + Exonic
906014863 1:42567040-42567062 AATTCTGTAAATATACATTAAGG + Intronic
906265781 1:44428208-44428230 AACCCAGAAAAAATTCCTTCTGG - Intronic
909073087 1:71019796-71019818 AACCCAGAAAAATTAATTTATGG + Intronic
909307911 1:74105211-74105233 AGATGTGAAAAAATACATTAAGG - Intronic
909492414 1:76239891-76239913 AATTCAGAAGAAAAAGATTAAGG - Intronic
909630176 1:77762568-77762590 AACGTAGAAAATATACATTTTGG + Intergenic
909672099 1:78200937-78200959 CACTCTGAATAAATGCATTAGGG - Intergenic
909800519 1:79802082-79802104 AATTCAGAAAAAAAAAATTGAGG + Intergenic
910548878 1:88453712-88453734 CACTTAGTAAATATACATTAAGG + Intergenic
911402264 1:97390843-97390865 AACTAAATAAAAATATATTATGG - Intronic
911618604 1:100041330-100041352 AATTAAGATAAATTACATTAAGG + Intronic
912000478 1:104828099-104828121 ACCTATTAAAAAATACATTATGG + Intergenic
912113855 1:106379358-106379380 AGCTCAGAGAATATACAGTAGGG - Intergenic
913334276 1:117694363-117694385 GAATCAGAAAAAATACCTTCAGG - Intergenic
914739036 1:150447720-150447742 AACTTAAAAAAAATTCATTATGG - Intronic
914849037 1:151300603-151300625 ATCTCAAAAAAAATAAAATAAGG + Intronic
915845015 1:159253607-159253629 AAATCAGGAAAAATAAATAATGG + Intergenic
916294313 1:163200362-163200384 AATTCATATAAAATAAATTAGGG - Intronic
916998781 1:170331953-170331975 ATCTCAGAAAGAAAAAATTATGG - Intergenic
917112546 1:171564152-171564174 ATCTAAGAAAAAGTCCATTAGGG - Intronic
918661700 1:187096232-187096254 AACTCAAAAACAATACAAAAGGG - Intergenic
918785642 1:188759303-188759325 AAGTAAGAAAACATACATTTGGG + Intergenic
919087580 1:192938766-192938788 AAGAAAGTAAAAATACATTAGGG - Intergenic
919309865 1:195893988-195894010 GACTCAGTGAAAATACATCAGGG + Intergenic
919515990 1:198523904-198523926 AATTCAGAAAATAAACAATAGGG - Intronic
919653587 1:200175697-200175719 CAATCAGAAAAATAACATTAAGG - Exonic
919982122 1:202648504-202648526 AACTAATAAAAAATACATACTGG + Intronic
921267472 1:213434852-213434874 AACACAGAAAAAATACAACAAGG - Intergenic
921507038 1:215984231-215984253 AAGCCTGAAAAAATACAATATGG - Intronic
921528947 1:216255582-216255604 AAATCATATAAAGTACATTATGG - Intronic
921761219 1:218917324-218917346 AACTTAGATAAAATACTTTTAGG + Intergenic
921786141 1:219231949-219231971 AACATAGAAAAAATACAAAATGG - Intergenic
922047737 1:221963094-221963116 AGCTCAGAAAAAACTCATCAAGG - Intergenic
922231166 1:223687889-223687911 AAATCAGACATAATACTTTAAGG - Intergenic
922691048 1:227691435-227691457 AACCCAAAATAAATACATTGAGG - Intergenic
923571535 1:235119587-235119609 AACTCACTTAAAATATATTATGG + Intronic
923918238 1:238533412-238533434 AATTCATAAAATACACATTATGG - Intergenic
1063517551 10:6712023-6712045 AACGCAGAAAAGATTAATTATGG + Intergenic
1065160742 10:22918782-22918804 AAAGCAGAAAAAAGACATTAGGG - Intergenic
1065509122 10:26460231-26460253 TAGTCAGAAACAATACATGAAGG + Intronic
1065717430 10:28585884-28585906 AAGTCAGAAAGAATAAATAATGG + Intronic
1065717834 10:28590676-28590698 AACATATAAAAATTACATTAAGG - Intronic
1066649891 10:37644261-37644283 ATCTGAGAATAAATAAATTATGG - Intergenic
1066757180 10:38722810-38722832 ATCTCAAAAAAAAAAAATTATGG + Intergenic
1066997174 10:42575023-42575045 AAATCTGAAAATGTACATTATGG - Intronic
1067032783 10:42889800-42889822 ATCTGAGAATAAATAAATTATGG - Intergenic
1067962974 10:50877593-50877615 AAATCAGAACAAATATAATATGG - Intronic
1068167546 10:53350931-53350953 AAATCAGAAAAAATATGATACGG + Intergenic
1068709684 10:60120358-60120380 TACTAAAAAAAAATACATTAGGG + Intronic
1068957706 10:62834442-62834464 AACTGAGAAAAAAGACATTAGGG + Intronic
1069174433 10:65272385-65272407 AACACACAAAAAATGCACTAAGG + Intergenic
1069234925 10:66059105-66059127 CAGTAAGAAAAAATAAATTATGG - Intronic
1070115782 10:73527545-73527567 AACTCAGTAAAAATAATGTATGG + Intronic
1070812774 10:79306610-79306632 ATCACAGAAAAAATACAGGAGGG - Intronic
1070824546 10:79383265-79383287 AACACAGAAAAACAACAATATGG + Exonic
1071234657 10:83631514-83631536 ATCTCAGAAAAAAAAGAGTAAGG - Intergenic
1073140574 10:101244649-101244671 AGCACAGAAATAATACAGTAAGG + Intergenic
1073817296 10:107222114-107222136 TACTAAGAAAAAATATATGAAGG - Intergenic
1073847325 10:107571984-107572006 AAATTAAAAAAAATACGTTAAGG + Intergenic
1073870197 10:107854538-107854560 AAATCAGGAAAAGTACATTTTGG - Intergenic
1074359846 10:112816821-112816843 AACTCAGAAGAAAACCATTATGG + Exonic
1075131253 10:119741833-119741855 ATCTCAAAAAAAATAAATAATGG - Intronic
1076019587 10:127061372-127061394 AACACAGAAAATATACAGAAAGG - Intronic
1076239943 10:128897241-128897263 AACTCAGAGACATTACATCAGGG + Intergenic
1076303086 10:129442488-129442510 AACTCTGAGAAAATAAATTTCGG + Intergenic
1077255926 11:1583039-1583061 ATCTCAGAAAAAAAAAATTGTGG + Intergenic
1077582623 11:3426560-3426582 GACTCAGAAAAAATTGATTCAGG + Intergenic
1078013911 11:7596001-7596023 AATCCAGACAAAATACATAAAGG - Intronic
1078876626 11:15405335-15405357 AAAGGAGAAAAAATACATTGTGG - Intergenic
1079553946 11:21736542-21736564 AAGTTAAAAAAAATACATAATGG + Intergenic
1079881360 11:25931636-25931658 AACTGTGAAAAAATAAATTTTGG - Intergenic
1080329052 11:31114421-31114443 AAAGGAGAAAAAATACATCAGGG + Intronic
1080338609 11:31230374-31230396 AAAAAAGAAAAAATATATTAAGG + Intronic
1080381240 11:31774294-31774316 ACCTCAGAGAAAAAAGATTAAGG - Intronic
1080808691 11:35680988-35681010 AATACAGAAAAAACACATAAGGG - Intronic
1082166232 11:48954750-48954772 AAAACAGAAAAGATACATAAAGG + Intergenic
1082983737 11:59147798-59147820 AACTCAGAGAATATACTTTCAGG - Intronic
1083101466 11:60310870-60310892 GACTCAAAAGAATTACATTAGGG - Intergenic
1083863524 11:65440491-65440513 AAAACAGAAAAAATAAACTAAGG + Intergenic
1085816205 11:79739795-79739817 AAATGTGAAAAAATACATCAGGG + Intergenic
1085915091 11:80877236-80877258 AAGTCAGGAAAAATAGATCAAGG + Intergenic
1088617987 11:111652283-111652305 AACTCAGAAGCAATTCATTTTGG - Intronic
1090517322 11:127442943-127442965 AACTAAGAAGAACTACCTTATGG + Intergenic
1090618335 11:128537793-128537815 AACACAAAAACAATACATTCTGG + Intronic
1091678238 12:2507089-2507111 GACTCAGAACAAGAACATTAAGG + Intronic
1092800250 12:12157770-12157792 AAATCAGAAAGAGTAGATTATGG - Intronic
1092917223 12:13199821-13199843 AACTCAGAAAATATCTATTCTGG + Intronic
1093044223 12:14423933-14423955 ACCTCAGAAAAAAGTCTTTAAGG + Exonic
1093193661 12:16104849-16104871 AATTAAAAAAAAATACATCAAGG - Intergenic
1093234520 12:16590368-16590390 CACTTAGAGAAGATACATTAAGG - Intronic
1093577034 12:20743721-20743743 AACTGAAAAAAAATATATTTAGG - Intronic
1093840126 12:23888121-23888143 AACACACAAAAACTACATGAGGG + Intronic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1093977877 12:25442410-25442432 AACTGATAAAAAATAAAGTATGG - Intronic
1094375753 12:29785478-29785500 AACTTAATAAAAATATATTAAGG + Intergenic
1094412480 12:30181695-30181717 AACTATGAAAACATATATTAGGG - Intergenic
1094584232 12:31762730-31762752 AATTCACAAAAAATCCATTAGGG + Intergenic
1095243569 12:39890318-39890340 AACTGAAAAAAAATACATTGTGG + Intronic
1095490776 12:42731698-42731720 ATCTCAGAAAAAATATATCCTGG - Intergenic
1095546478 12:43376842-43376864 AACTGAGAAATAATAGATTCAGG - Intronic
1096370496 12:51065149-51065171 ACTTCAAAAAAAATACATTCTGG + Intronic
1096446847 12:51700827-51700849 AACTCAGAAAACTTACTTTTAGG + Intronic
1097103198 12:56604008-56604030 ATCTCAAAAAAAAAAAATTACGG + Intronic
1097141314 12:56904451-56904473 CACTAAGAAAAAAGACATAAAGG - Intergenic
1097818398 12:64100809-64100831 AATCCAGGAAAAATGCATTATGG - Intronic
1097825827 12:64173710-64173732 AACTGAGATAAGATACATTTCGG + Intergenic
1098196491 12:68007475-68007497 TAGTCAGAAAAAATAAATAATGG + Intergenic
1098223315 12:68293467-68293489 AACTCAGAAGACATGCATTTGGG - Intronic
1098232150 12:68382550-68382572 AACTCATAAAACATATACTATGG + Intergenic
1098278103 12:68833784-68833806 ATCTCAGAAAACATACTCTACGG - Intronic
1098335078 12:69395850-69395872 AACTCGGATAAATAACATTATGG + Intergenic
1098755544 12:74358227-74358249 AACAGAGAAGAAATAAATTATGG + Intergenic
1099099424 12:78419638-78419660 AAGGCAGAAAAAGTAAATTATGG + Intergenic
1099167784 12:79327944-79327966 AAGCCAGAAAAAATAAATAAGGG + Intronic
1099211618 12:79797835-79797857 AAGACAGAAAAAGTATATTAAGG + Intronic
1099901563 12:88716763-88716785 AACCCAGTAAAACTACATTTAGG - Intergenic
1100037594 12:90272144-90272166 AACTCAGAAAAAAGATAAAAAGG - Intergenic
1100548397 12:95624396-95624418 AACACAGAAAAAGGAGATTAGGG - Intergenic
1100569039 12:95829051-95829073 AACTTGGGAAAAATGCATTATGG - Intergenic
1101203004 12:102456373-102456395 AAATCAGAGAAAATACTTCAGGG + Intronic
1101291126 12:103370754-103370776 GAATCAGAAAAAATACCCTATGG + Intronic
1101349605 12:103916642-103916664 AGCTCAGAAAAAAAAAACTATGG + Intergenic
1102377278 12:112432809-112432831 ATCTCAAAAAAAAAAGATTATGG + Intronic
1102702986 12:114855962-114855984 AACTTAGAAAAAATACTCTCTGG + Intergenic
1103036853 12:117663933-117663955 AACACAGAATAAATACAGCAAGG + Intronic
1103510284 12:121468871-121468893 AACTCAGAACAGATACGTTTCGG - Intronic
1105586519 13:21749934-21749956 AACTTATAAAAATAACATTAGGG - Intergenic
1106320675 13:28635302-28635324 AACTCATAGAAAATACAATCAGG + Intergenic
1107621206 13:42232330-42232352 AACTGAAAGAAAATACATTCTGG - Intronic
1108510919 13:51155224-51155246 AACTCAAAAAAACTACATTTTGG + Intergenic
1108536624 13:51387805-51387827 AACACACAAAACATACTTTACGG + Intronic
1108728739 13:53209746-53209768 GTCTCAGAAAAAAAAAATTACGG + Intergenic
1108736767 13:53292317-53292339 AGCTCAGAAAAAACACTGTATGG + Intergenic
1108761371 13:53569878-53569900 AATTCAGAAAAAGAACATTGAGG - Intergenic
1109575743 13:64255227-64255249 ATCACAGAAATAATACATTGTGG - Intergenic
1109594992 13:64539930-64539952 AAATCAGAAAAAATAACTAATGG - Intergenic
1109664820 13:65520144-65520166 AACTCATCTAAAATATATTATGG - Intergenic
1109999961 13:70183891-70183913 ATCACAGAAATAATACATTGTGG + Intergenic
1110286666 13:73757492-73757514 AACTGAGAAAAATTATATTGAGG + Intronic
1110484553 13:76022730-76022752 CACTCAGAAAAATTAGAGTAAGG - Intergenic
1110787353 13:79545471-79545493 AACTCAGTAAAAGTATTTTAAGG - Intronic
1110991030 13:82042906-82042928 AACACAGAAAATATACTTGAAGG - Intergenic
1111553341 13:89846341-89846363 ATCTCAGAAACAATTCTTTAGGG - Intergenic
1112312423 13:98330750-98330772 ATCTCAAAAAAAAAAAATTAAGG + Intronic
1114319235 14:21533251-21533273 AGATCAGAAAAAACACATTTTGG - Intronic
1114737772 14:25060169-25060191 GACTCAGAAAAAGTAGATGAAGG + Intergenic
1117111741 14:52464369-52464391 AACTCAGCAATAAAACAGTAGGG - Intronic
1117150970 14:52887526-52887548 AATTCATAAAATAAACATTATGG + Intronic
1118238595 14:64035684-64035706 AATTCATAAAAAATAAATAAAGG - Intronic
1118856088 14:69624138-69624160 AACATAGAAAAAATACAATATGG - Intronic
1119174636 14:72560162-72560184 AACTCAGAACATATATATTTGGG + Intronic
1119403049 14:74377461-74377483 CACTCTGAAAAAATACATGGTGG - Intergenic
1120067924 14:80066515-80066537 AACTCACAAAAAAGAGATGAAGG + Intergenic
1120337490 14:83175423-83175445 CACCCAGAAAATATACATTAAGG + Intergenic
1120587562 14:86332508-86332530 AAGCCAGACAAAATACATAAGGG + Intergenic
1120658817 14:87228812-87228834 AAATAAGGAAAACTACATTATGG + Intergenic
1121487216 14:94326644-94326666 AATTCAGAAAAGATACAGTGGGG - Intergenic
1202845541 14_GL000009v2_random:169874-169896 AAATAAGAAGAAATAAATTAAGG - Intergenic
1202875251 14_GL000225v1_random:201347-201369 AAATAAGAATAAATAAATTAGGG + Intergenic
1202877730 14_KI270722v1_random:22567-22589 AAATAAGAATAAATAAATTAGGG + Intergenic
1124869552 15:33527278-33527300 AAATAAAATAAAATACATTAAGG + Intronic
1126546307 15:49878117-49878139 AATTCAAAAAAAATATAATAAGG - Intronic
1126928901 15:53624902-53624924 AACTCAGAAAATATATATTATGG - Intronic
1126986699 15:54319651-54319673 CACTCACAAAAAATAAATGATGG - Intronic
1127156390 15:56130080-56130102 AACTCATAAAAAATACAGTAAGG + Intronic
1127268226 15:57377840-57377862 AAAGGAGAAAAAATACTTTAGGG + Intronic
1128010103 15:64285788-64285810 AGCACAGAAAAACTACATTTTGG + Intronic
1128211460 15:65906100-65906122 ACGTCAGAACACATACATTATGG - Exonic
1128830959 15:70768126-70768148 AACTAAGAAAACTTACATGAGGG - Intergenic
1128973709 15:72132413-72132435 AAGTCAGAAAATTTAGATTACGG - Intronic
1129959672 15:79672639-79672661 ATTTCAGAAGAAATACACTAAGG - Intergenic
1130061524 15:80573865-80573887 ACCGCAGAACAAATACTTTAAGG - Intronic
1130286788 15:82562341-82562363 AACTCATTAAAAATGCATTTTGG + Intronic
1132794073 16:1710039-1710061 AACTCGGAAAAAATAAGTTTTGG - Intronic
1133071877 16:3252064-3252086 AAATTAAAAAAAATACAGTAGGG + Intronic
1133687051 16:8175651-8175673 AAGTCAGAATACATACAGTACGG + Intergenic
1135093756 16:19544430-19544452 AATTCAGAAAAAACAAATGATGG + Intronic
1135210003 16:20517216-20517238 ATCTCAGAAAAAAAACAATGAGG + Intergenic
1135353814 16:21752844-21752866 AACTCAGAAAAAAAAAATGTGGG - Intronic
1135452303 16:22568982-22569004 AACTCAGAAAAAAAAAATGTGGG - Intergenic
1135769747 16:25208377-25208399 AACTAAGAAAAAATAATTTTTGG - Intergenic
1136352958 16:29723297-29723319 GGCACAGAAAAAATACCTTAAGG - Intergenic
1136595531 16:31246829-31246851 AAATCAGAAATGATAGATTAAGG - Intergenic
1137819872 16:51434001-51434023 AACTAAGAAAAATTATAATATGG - Intergenic
1138501209 16:57446281-57446303 AACTCAGAAACAAATCCTTATGG + Intronic
1141918321 16:87117103-87117125 AACTCAGAACAATTAGAATAAGG + Intronic
1142249528 16:88984839-88984861 GCCTCAGAAAAAATAAATAATGG - Intergenic
1144193632 17:12869755-12869777 TGCAGAGAAAAAATACATTAAGG - Intronic
1145364691 17:22249290-22249312 AATACACAAAAAATACATTTTGG - Intergenic
1145983264 17:29027007-29027029 AACTCAAAAAAAAAAAATGATGG + Intronic
1146951478 17:36909726-36909748 AACTCAGAAGAAACACACCAAGG + Intergenic
1148883821 17:50756724-50756746 CACACAGAAAACATACATTTAGG - Intergenic
1149059076 17:52400546-52400568 AACTCAGAAAAAAGAAAATTGGG - Intergenic
1149094225 17:52821135-52821157 ATCTTCAAAAAAATACATTAGGG + Intergenic
1149414545 17:56445746-56445768 AAGTCTGTAAAAACACATTAAGG - Intronic
1149667649 17:58377044-58377066 AAATCAGAACAAATAAGTTAAGG - Intronic
1149788778 17:59459254-59459276 AATTCATAAAAAATATATTTTGG + Intergenic
1150183554 17:63154729-63154751 TAATCAGAAAAAATACTTAAAGG + Intronic
1150361461 17:64538541-64538563 AAATAATAAAAAATGCATTATGG + Intronic
1150632226 17:66887982-66888004 AACTCAGAAATCATAAATTAGGG + Intergenic
1151858615 17:76741470-76741492 AAATCTGAAATAATAAATTATGG + Intronic
1152306784 17:79525701-79525723 AGCTTAGAAAAAATAGATGATGG - Intergenic
1153088475 18:1317216-1317238 AAATTAGAAAAAGTACAATAAGG - Intergenic
1153574011 18:6502752-6502774 AACTTTGCAAACATACATTAAGG + Intergenic
1154399048 18:14017725-14017747 AACTTACAAAAAATATATAAAGG + Intergenic
1154929499 18:20977690-20977712 AACTCTGAAACAATATAGTATGG + Intronic
1155074798 18:22345263-22345285 AACTCTGGAAAAATACCTTTGGG + Intergenic
1155192025 18:23438681-23438703 AAAACAGAAAAATTACATAAGGG - Intergenic
1155603275 18:27574188-27574210 AACACAGAAAAAACACAGCAAGG + Intergenic
1155669690 18:28355009-28355031 AACTCAAAAAAAATCAATAATGG - Intergenic
1155701650 18:28751302-28751324 AACTCAGTAAAAATACCAGAAGG + Intergenic
1156054393 18:32980996-32981018 AAGTAATGAAAAATACATTATGG + Intronic
1156614226 18:38764470-38764492 AACCCATAAAAAATAGGTTAAGG + Intergenic
1156928564 18:42613376-42613398 AAGTCAGCAAAAGTACACTATGG + Intergenic
1157754868 18:50208740-50208762 ACCACTGAAGAAATACATTAAGG + Intergenic
1157937836 18:51892801-51892823 AACACAGACATAATACATAAAGG + Intergenic
1158708009 18:59811391-59811413 ATCTCAAAAAAAAGAAATTAAGG - Intergenic
1159192165 18:65060678-65060700 AACTCAAAATAGATACATCATGG + Intergenic
1159650101 18:70968261-70968283 AACTCAGAAAAACTAGTTTTAGG - Intergenic
1159766703 18:72500005-72500027 AAAGCAGAAAAAAAAAATTAGGG + Intergenic
1159815604 18:73070848-73070870 AATTAAAAAAAAATACATCATGG + Intergenic
1161669329 19:5596344-5596366 AACCTACAAAAAATAAATTACGG - Intronic
1163414747 19:17179387-17179409 GACTCAGAAAAAAGACCCTAGGG - Intronic
1164431637 19:28194052-28194074 AACTCAGAAAACATTTATTTGGG + Intergenic
1165083415 19:33325288-33325310 AACTCAGAGTGAAAACATTAGGG - Intergenic
1165476048 19:36031798-36031820 AAATGTGAAAAATTACATTATGG + Intronic
1167960488 19:53100976-53100998 ATCTCAAAAAAAATAAATAAGGG + Intronic
1202672948 1_KI270710v1_random:10373-10395 AAATAAGAATAAATAAATTAGGG - Intergenic
925312027 2:2891439-2891461 AACACAGAAAAAGTACCTTTTGG + Intergenic
925943074 2:8838126-8838148 AACTCAGGAAAAAGCCAATAAGG + Intergenic
925955260 2:8957458-8957480 AACTCATGAAAAATTAATTAGGG - Intronic
926342551 2:11915799-11915821 AAGGCAGAAAAATTACATGAGGG - Intergenic
926552068 2:14312936-14312958 CATTCAGAAAAAGTACATTATGG - Intergenic
927223984 2:20743704-20743726 AACTCAGAAAGAAAATAATAGGG - Intronic
927801314 2:26102218-26102240 AACACATAAATAAAACATTATGG - Intronic
928816867 2:35307359-35307381 AACTAAAAAAAAATACAGTGAGG - Intergenic
928818618 2:35331406-35331428 TACACATAAAAAATATATTATGG + Intergenic
928857818 2:35821477-35821499 AAATCAGAAAAAAAAAATTTTGG + Intergenic
930519859 2:52451855-52451877 AACCTAGAAAAAATACACAAAGG - Intergenic
930638359 2:53830054-53830076 AACAAACAAAAAAGACATTAAGG - Intergenic
930718676 2:54617874-54617896 AATTAAGAAAAAAAAGATTAAGG - Intronic
931034569 2:58224886-58224908 AACTGAGAAAAAATACTTTTTGG - Intronic
931133157 2:59362817-59362839 ATAACAGAAAAAATATATTAAGG + Intergenic
931179309 2:59883881-59883903 AACCCAGAAAGAATACAAGATGG - Intergenic
931613550 2:64130877-64130899 AAATAAAAAATAATACATTATGG - Intronic
932370274 2:71181302-71181324 AACTCAGCAAAAATCACTTATGG - Intergenic
932719489 2:74128463-74128485 TACCTAGAAAAAAGACATTAAGG + Intergenic
933530256 2:83500737-83500759 GACCCAGAGAAAATTCATTAAGG - Intergenic
935561242 2:104562444-104562466 AAATGAGAAAAAAGACATTAAGG - Intergenic
937568711 2:123330908-123330930 TACACAGAAACAATAAATTATGG + Intergenic
937654136 2:124355729-124355751 AACTCAGAAAAAAATAATAATGG - Intronic
938710575 2:133973108-133973130 AACTTAGAAAAACTACAAGATGG + Intergenic
938883675 2:135619504-135619526 AACTGAGAAAGAATATATTAAGG - Intronic
939002230 2:136749578-136749600 AGCTCATTAAAAATACATTTTGG + Intergenic
939177545 2:138766782-138766804 AAAACACAAAATATACATTAAGG + Intronic
939380592 2:141430688-141430710 CAGTCAGAAAAAATAAAATATGG + Intronic
939403726 2:141729483-141729505 AAATCAGAAATTATACATCAGGG + Intronic
940169477 2:150812274-150812296 ACCTCAGAAAAAATAATTTTTGG - Intergenic
940551005 2:155156677-155156699 ACATCAGAAAAAATACAAAAAGG - Intergenic
940648122 2:156413180-156413202 AGCTCAGAGAAAATATATTTTGG - Intergenic
940721667 2:157289280-157289302 AATTCAAATAAATTACATTATGG - Intronic
940898915 2:159108482-159108504 ACCTCAGAGAAAATAGATGAGGG + Intronic
941028322 2:160483905-160483927 AACCCAGAAAAAAAACATGAAGG + Intronic
941129921 2:161635158-161635180 ATCTTAAAAAAAATACATAAAGG - Intronic
941255742 2:163229256-163229278 AACTTAAAAAAAAAAAATTATGG - Intergenic
941258051 2:163258729-163258751 AACTCAAAATACATACATAAAGG + Intergenic
941320088 2:164043343-164043365 AACTCTGAAAAAACATCTTATGG + Intergenic
941366678 2:164619017-164619039 AACTAACAGAAAATACATCATGG - Intronic
942507148 2:176655197-176655219 AATTCAAAAATAATCCATTAAGG + Intergenic
943826264 2:192397480-192397502 AACAGAGAAAAAAAAAATTAAGG - Intergenic
943941224 2:194000719-194000741 AATTTAGACAAAATGCATTATGG + Intergenic
944755840 2:202760871-202760893 AACTCCAAAAAAGTACATTTGGG - Intronic
945310131 2:208302147-208302169 AACTGAAAAAAAATATTTTAAGG + Intronic
945564547 2:211380941-211380963 AAATCAGAAAAAAAAAATCAAGG + Exonic
945773124 2:214070247-214070269 AAATAAGAAATAAAACATTAGGG - Intronic
945823910 2:214697575-214697597 AAATCAGAAAAAACAATTTATGG + Intergenic
945967186 2:216200987-216201009 AAGTATGAAAAAATTCATTATGG - Intronic
946631935 2:221678703-221678725 ACCTCAGAAAACATACAATCAGG - Intergenic
947921821 2:233882563-233882585 AACTGAGAAACAATACAAGATGG - Intergenic
948720403 2:239895978-239896000 AAGTAAGAAAAAGTACAATAGGG + Intronic
1169407962 20:5340689-5340711 GACTAAGAAAAAATACAGAAGGG + Intergenic
1169707543 20:8522560-8522582 AACCCAGAAAAGACAAATTAAGG + Intronic
1170435317 20:16320664-16320686 AACTCAGATAAAACACATCAAGG + Intronic
1170937270 20:20821110-20821132 AACTAAGAAAAAACAAATTCTGG + Intergenic
1171108171 20:22456002-22456024 AACTAAGGAAAAATACAGTGTGG - Intergenic
1172560129 20:35880506-35880528 TATGCAGAAAAAATACCTTATGG - Intronic
1173294630 20:41746034-41746056 AACCCAGAAAACATACTTGAAGG - Intergenic
1173689579 20:44949931-44949953 ATCTCAGAAATATAACATTAAGG - Intronic
1174423151 20:50413711-50413733 TATTCAGAAAATATTCATTATGG + Intergenic
1175626708 20:60494479-60494501 AAATCAGCAAAAATAAAATAGGG + Intergenic
1176639018 21:9280006-9280028 AAATAAGAATAAATAAATTAGGG + Intergenic
1176890460 21:14311886-14311908 AAATCATAAAAAATAAATTTGGG + Intergenic
1177047805 21:16192259-16192281 CATTAAAAAAAAATACATTATGG + Intergenic
1177403926 21:20641832-20641854 AAAAAAGAAAAAATATATTATGG + Intergenic
1177757555 21:25365870-25365892 AAAGGAGAAAAAATAAATTAAGG + Intergenic
1177913884 21:27063586-27063608 AACCCAGAAAATATACTTGAGGG + Intergenic
1178018319 21:28378353-28378375 AATTCAGAAAAAAAACAGCATGG + Intergenic
1178677597 21:34644448-34644470 AACTCATAAAAACTTCATTTCGG - Intergenic
1178820318 21:35968994-35969016 AATTTAGATAAAATACAATATGG - Intronic
1178824101 21:36001051-36001073 AAATCAGAGAAAATCCATAAAGG - Intronic
1179316670 21:40249888-40249910 ATCTCAGACAAAATACCTTGAGG - Intronic
1180372326 22:12052849-12052871 AAATAAGAATAAATAAATTAGGG + Intergenic
1180390149 22:12222804-12222826 AAATAAGAAGAAATAAATTAGGG - Intergenic
1180415785 22:12711663-12711685 AAATAAGAAGAAATAAATTAGGG + Intergenic
1180423063 22:12887513-12887535 AAATAAGAATAAATAAATTAGGG + Intergenic
1180717907 22:17884406-17884428 AACAAAATAAAAATACATTAAGG + Intronic
1183994728 22:41624383-41624405 ATCTCAAAAAAAATAAAATAGGG + Intronic
949367981 3:3303622-3303644 AAGTCTGAGAAAATACATTCTGG + Intergenic
949400704 3:3662679-3662701 AAATCAAAGAAAATAAATTAAGG - Intergenic
949595832 3:5546570-5546592 AAAGTAAAAAAAATACATTATGG - Intergenic
950352239 3:12367404-12367426 TCCTCAGCAAAAATTCATTATGG - Intronic
950994296 3:17479394-17479416 ATCTCAGAAAAAATAAAGAAAGG + Intronic
951056410 3:18151420-18151442 AAATCAGACAAGATACATTTGGG - Intronic
951402095 3:22245501-22245523 AACCCAGAAAAATTAAAGTAGGG + Intronic
951960593 3:28314765-28314787 AATGCATAAAAAATTCATTAGGG - Intronic
952021140 3:29022068-29022090 AATTCAGAAAATTTACCTTATGG - Intergenic
953021433 3:39116292-39116314 AAGAAAGAAAAAATATATTAGGG - Intronic
953363068 3:42316837-42316859 AATACATAAAAATTACATTATGG - Intergenic
953746048 3:45574885-45574907 ATGTCAGAAAAAAGACATCATGG + Intronic
953779869 3:45858507-45858529 AAATGATAAAAAATATATTAGGG - Intronic
954805833 3:53219872-53219894 AATTTAGAAAAAATAAAATAAGG + Intergenic
955554556 3:60121913-60121935 AACTAAGAAATAATATATTTGGG + Intronic
955577752 3:60384991-60385013 TAAGCAGAAAAAATATATTATGG + Intronic
955618794 3:60838665-60838687 AACTCAAAAATAATACATGTAGG + Intronic
956722162 3:72127818-72127840 AACTTATTGAAAATACATTAAGG + Intergenic
957101196 3:75830858-75830880 AAATAAGAAGAAATAAATTAGGG - Intergenic
957841936 3:85683290-85683312 AATTCTGAATAAACACATTAGGG - Intronic
958827291 3:99046499-99046521 AACTCAGAAATAACAGATTATGG + Intergenic
959793318 3:110391543-110391565 CATACATAAAAAATACATTAAGG + Intergenic
960035403 3:113097492-113097514 AACCCAGAAAAAAAAAAGTAAGG - Intergenic
960309503 3:116103787-116103809 CACTTAGAAAAAATAAATTAGGG - Intronic
960394507 3:117119760-117119782 AAACCAGAAAAAATACAGAATGG - Intronic
960572213 3:119196376-119196398 GACTCAGAAAAAATAGACTTGGG - Intronic
962011184 3:131392460-131392482 AAATAATAAAAAATACAATAAGG - Intergenic
962544179 3:136415465-136415487 AATTCAGAGAAAATACCTTTTGG - Intronic
963124978 3:141807594-141807616 AACACAGAACAAAGACACTAAGG - Intronic
963311669 3:143716600-143716622 CACTCAGAAAAAGCACACTATGG + Intronic
963555023 3:146776259-146776281 ACTTCAGAAAAATTAAATTAAGG - Intergenic
963686637 3:148443514-148443536 AACTCTGATAAAATAAATCAAGG + Intergenic
964001336 3:151776498-151776520 ATCACAGAAAAAAAACATTCTGG + Intergenic
964279625 3:155049949-155049971 AGATCAGAAAAAATACCTTTTGG - Intronic
965563987 3:170091673-170091695 AATTTAGAAAACATACATTAAGG - Exonic
965646388 3:170886103-170886125 AAATAACAAAAAATATATTAAGG - Intergenic
966080739 3:175997035-175997057 AACTTGGAAAACATACATCAAGG + Intergenic
966084180 3:176047282-176047304 TACACTGTAAAAATACATTAAGG - Intergenic
966308071 3:178559842-178559864 TAGTCTGAAAAAATAAATTATGG - Intronic
966697677 3:182808922-182808944 AAACCAGAAAAAGAACATTAGGG - Intronic
967854399 3:194105603-194105625 AACTCAGACAGCATACAATAGGG + Intergenic
967897948 3:194415209-194415231 GACTGGAAAAAAATACATTAGGG + Intronic
1202747877 3_GL000221v1_random:125013-125035 AAATAAGAATAAATAAATTAGGG - Intergenic
970173930 4:13318217-13318239 AACTGATAAAAAATTCAATAAGG - Intergenic
970521959 4:16893738-16893760 AAAACAGGAAAAATACATAACGG + Intronic
970522038 4:16894949-16894971 AAAACAGGAAAAATACATAACGG + Intronic
970957287 4:21828945-21828967 AACTCTGCAAAAATACATATAGG + Intronic
970962284 4:21886484-21886506 CCCTCTGTAAAAATACATTAGGG - Intronic
971229316 4:24786695-24786717 AATTCAGAAAATATACAATATGG - Intergenic
971492152 4:27224468-27224490 CACTCAGAGAAAATACTCTAAGG + Intergenic
971613178 4:28752755-28752777 AACTCAGAAAAAAAATTTGAGGG + Intergenic
971755854 4:30707375-30707397 AACATAGATAAAATACATCAGGG - Intergenic
971822707 4:31579481-31579503 AGCTCAGAGAAAATATATTGAGG + Intergenic
971832700 4:31718041-31718063 AAAACAGAATAAATATATTATGG - Intergenic
971989997 4:33880443-33880465 ATCTCAGGAATAATACCTTAGGG + Intergenic
972072706 4:35040782-35040804 AAATCAGAAAAACCACAATAGGG - Intergenic
972749177 4:41971819-41971841 AACTCTGGGAAAATACATTTTGG - Intergenic
972947430 4:44273437-44273459 CAGTCATAAAAAATTCATTAAGG - Intronic
973014829 4:45125241-45125263 AAATCAGAAAAAAAAAATAAGGG + Intergenic
973085207 4:46050458-46050480 AACTCATTATATATACATTAAGG + Intronic
973873402 4:55189213-55189235 TACTCAGAAAAAATATCTTAGGG + Intergenic
973881500 4:55276465-55276487 TATTCAGAATAAATACATTCTGG - Intergenic
975053450 4:69896257-69896279 AATTCAGATAAAATAGATTGAGG + Intergenic
975147887 4:70990550-70990572 AATTCAAAAAAAATACCTTTGGG - Intronic
975186133 4:71405537-71405559 AATGCAGAAAAATTACAATAAGG - Intronic
975216965 4:71767124-71767146 AATTCTGAAAAAATAGATAAGGG + Intronic
976489813 4:85657159-85657181 AGCCCAGAAAAAATAAAATAAGG - Intronic
976701415 4:87972989-87973011 AATTCAGGAAAAAGACCTTAAGG + Intergenic
976764743 4:88588312-88588334 AACTTAGAATAAAAACATTATGG - Intronic
976947553 4:90789330-90789352 AAAAGAGAAAAAATAAATTAGGG - Intronic
977105628 4:92880380-92880402 CACTGAGAAAAAAAATATTATGG - Intronic
977252165 4:94701381-94701403 AACGATGAAAAAATAAATTAAGG - Intergenic
977594600 4:98865067-98865089 AACACAGAAAAAGTATAATATGG + Intergenic
978454190 4:108869785-108869807 AACTGAGAACAAAGCCATTATGG - Intronic
978697671 4:111602086-111602108 AACACAGAAAAATTACATATAGG + Intergenic
979933353 4:126660791-126660813 AACTTAGGAAAAATAAATCAGGG + Intergenic
980265289 4:130507228-130507250 AACACAGAAAAACTCCATAATGG + Intergenic
980726738 4:136771070-136771092 AACTCAGCAAAAATAAATATTGG - Intergenic
981353812 4:143764205-143764227 AAATCTGAAAAATTTCATTAGGG - Intergenic
981542409 4:145859578-145859600 AACACAGCCAAAATACATCAGGG - Intronic
982885216 4:160770908-160770930 AACTAAGTAAAAATACATTGGGG - Intergenic
983029851 4:162786110-162786132 AAATCAGAAAAACCACATTTCGG + Intergenic
983088360 4:163474359-163474381 AACACAGAAATAGTACTTTACGG - Intergenic
983091304 4:163505963-163505985 AAAACAGAAAGAATACATTAGGG - Intronic
983097556 4:163581981-163582003 ATTACAGAAAAAATATATTAGGG + Intronic
983756384 4:171342422-171342444 AACTGACACAAAATACATTATGG - Intergenic
983846057 4:172519989-172520011 AACTCATAAAAGAAAAATTATGG + Intronic
984280086 4:177659597-177659619 AACACACAAAAAACACACTAAGG - Intergenic
984391339 4:179137963-179137985 AACTGTGAAAAAATATATAATGG + Intergenic
984507427 4:180637408-180637430 AATCCAGAAAAATTACATCAAGG - Intergenic
984838580 4:184046772-184046794 AACCCAGAAGAAATAAAATAAGG - Intergenic
984855311 4:184189940-184189962 AACTGAGAAAATATAAAATATGG + Intronic
1202753911 4_GL000008v2_random:38417-38439 AAATAAGAATAAATAAATTAGGG + Intergenic
986844176 5:11733727-11733749 AACTCAGACAAAATCAACTATGG - Intronic
987228329 5:15866985-15867007 AACTTAAGAAAGATACATTATGG + Intronic
987962294 5:24825538-24825560 AATACAGAAAAAATAAATTTAGG - Intergenic
988663891 5:33303720-33303742 AACTCAGAAAAGATTCATTTTGG + Intergenic
988941114 5:36149250-36149272 CAATTAAAAAAAATACATTAGGG + Intronic
989303497 5:39923131-39923153 ACCCCAGAACAAATACAATATGG + Intergenic
989308867 5:39989231-39989253 AACTGAGACATAACACATTATGG - Intergenic
990501919 5:56405091-56405113 AACTCAGAAAACATGGTTTATGG - Intergenic
990542286 5:56785773-56785795 AAATCAGGAACAATAAATTAGGG + Intergenic
990742258 5:58923872-58923894 AACTCAGAGAGAATAAATTTAGG + Intergenic
991344787 5:65652301-65652323 GCCTCTCAAAAAATACATTAGGG + Intronic
993847079 5:92957385-92957407 AACTCAGAAAAAAATAATTCAGG + Intergenic
994022399 5:95042864-95042886 AAATCAGATTAAATAAATTATGG - Intronic
994536884 5:101042497-101042519 ATCTAAGAAAAAATTCATTATGG - Intergenic
995008437 5:107229837-107229859 CACTCAGAAAACATAAATTTTGG + Intergenic
995368443 5:111390285-111390307 AATTCAGAAACAATATATTGAGG - Intronic
995490631 5:112687639-112687661 GACCCAGAAACAATACATCAGGG + Intergenic
995760023 5:115552782-115552804 AACTCACAGAACATACACTAAGG - Intergenic
995933899 5:117485339-117485361 AACTCAGGAAAATTAAATCAAGG + Intergenic
996486418 5:124040802-124040824 AACACAGGAAAAATAGAATAGGG + Intergenic
996667429 5:126075993-126076015 ATCTCAGAAAAGATAAATTGAGG + Intergenic
997054920 5:130430735-130430757 AAGTCATAAAAAAGACATGAAGG + Intergenic
997486447 5:134234891-134234913 AACTCTGAAAAAATAATGTATGG + Intergenic
997909822 5:137860372-137860394 AACTCAGAAAAGGTGCATAAAGG - Intergenic
999001265 5:147925445-147925467 AAATCAAAAATAAAACATTAGGG + Intergenic
999861630 5:155653905-155653927 AACACAGAAAAAAAATATTTAGG + Intergenic
1000280035 5:159774200-159774222 AATGCACAAAAAATAAATTAAGG - Intergenic
1002682599 5:180979057-180979079 GACTCTGAAAAAATAAAATAAGG + Intergenic
1003738828 6:8911001-8911023 GTCCCAGAAAAAATACATTCAGG - Intergenic
1004341137 6:14808343-14808365 AACTCAGATAAAACAAATTTGGG + Intergenic
1004417339 6:15436826-15436848 AACACAGAATATAAACATTATGG - Intronic
1004920849 6:20374054-20374076 AAGTCAGAACTATTACATTATGG - Intergenic
1005016802 6:21382272-21382294 AAATAAGAAAAAATAAATCAGGG - Intergenic
1005395109 6:25373985-25374007 AACAAACAAAAAATACATCAAGG - Intronic
1005469609 6:26149450-26149472 GACACAGAAAAAGAACATTAGGG - Intergenic
1007528002 6:42513803-42513825 TACACAGAAAAAATAAAGTAGGG + Intergenic
1008333098 6:50266144-50266166 AATGCAAAAAAAGTACATTATGG + Intergenic
1009192252 6:60643538-60643560 AACTCAGAAAAAATAAAACAAGG - Intergenic
1009432153 6:63576369-63576391 AATTCAAAAGAAATACATTAGGG - Intronic
1010098316 6:72073353-72073375 AAATCAGAACAAATACTTGAAGG + Intronic
1010256299 6:73761940-73761962 AATTAAAAAAAAATACATTATGG - Intronic
1010813643 6:80329192-80329214 AACTTAGAAAAATTAAAATAGGG - Intronic
1010946130 6:81975552-81975574 AAGTCAGGAAAAATACATGCTGG + Intergenic
1011524542 6:88249427-88249449 AGATTAGAAAGAATACATTAAGG - Intergenic
1012139979 6:95614274-95614296 TACTCAGAAAAAATGCTTGAAGG - Intergenic
1012518775 6:100094836-100094858 AATTCAGATGGAATACATTATGG + Intergenic
1012704769 6:102509488-102509510 TTTTCAGAAAAAATACATTATGG + Intergenic
1012898573 6:104980163-104980185 AATTTAGGAAAACTACATTACGG - Intronic
1012989849 6:105914149-105914171 AAGTCAGCAAAAATATATAATGG - Intergenic
1013484941 6:110588017-110588039 AACTTAGAAACAGGACATTATGG - Intergenic
1013856247 6:114576162-114576184 AAATTTGAAGAAATACATTACGG - Intergenic
1015611729 6:135028936-135028958 AACTCAGAAAAACTATAAAAAGG + Intronic
1015798111 6:137033253-137033275 GACTCAGAAAAACCACATGAAGG - Intronic
1016148696 6:140708554-140708576 AGCTGAGAAAAAAAAAATTAGGG + Intergenic
1016321940 6:142855841-142855863 AACTTATTAAAAATACACTATGG + Intronic
1016769994 6:147838600-147838622 AACTCAGAAAAATTGCATCAAGG - Intergenic
1016890610 6:149003442-149003464 AACAAAAAAAAAAAACATTAAGG + Intronic
1018062771 6:160103558-160103580 CAATCACAACAAATACATTAGGG + Intronic
1018104495 6:160469915-160469937 AGCTCAAAAATATTACATTAAGG - Intergenic
1018543209 6:164906928-164906950 AATTCAGAAGCAAAACATTATGG - Intergenic
1019375208 7:687364-687386 AACTAAGAAAAAAAACTATAAGG + Intronic
1019829744 7:3315734-3315756 AATCCAGTAATAATACATTATGG - Intronic
1020665081 7:11031252-11031274 AAGTCATAAAAAATACAGAAAGG - Intronic
1020732261 7:11895282-11895304 AACTCAAAAAATATTCATAAAGG - Intergenic
1020835016 7:13138400-13138422 AACTCACAAAAAATACATTTTGG + Intergenic
1021008248 7:15427490-15427512 AAAACAGAAAAAGAACATTAGGG - Intronic
1021283253 7:18746401-18746423 AAGTCAGAAGGAAGACATTAAGG - Intronic
1021798286 7:24279480-24279502 AGCTCAGAAAAACTCCATCAAGG - Intergenic
1023008935 7:35907956-35907978 AACTGAGAAGAAATACTTTTTGG - Intergenic
1023405257 7:39826908-39826930 AGCAGAGAAAAAATACATTGTGG + Intergenic
1023542595 7:41282332-41282354 CAGTAAGAAAAAATACTTTAAGG + Intergenic
1024093416 7:45966092-45966114 AACAAACAAAAAATACATCAAGG + Intergenic
1024832127 7:53473253-53473275 AACTGTGAAAACATACATTAGGG - Intergenic
1025247823 7:57330670-57330692 CATTCAGAAAATATTCATTATGG - Intergenic
1026289023 7:68989317-68989339 AATTCAGAAAATATAATTTAAGG - Intergenic
1027491640 7:78834563-78834585 AACTGATAATAAATACAATATGG - Intronic
1028304706 7:89248167-89248189 AACCTAGAAAACATACATAAGGG + Intronic
1028649609 7:93137058-93137080 AAATCAGAAAGAATATTTTACGG + Intronic
1029878896 7:103784760-103784782 AACTCAGAAAACATTCTTTTTGG + Intronic
1030660307 7:112210940-112210962 AATTCAGTAATAATACATTTAGG + Intronic
1030959697 7:115901678-115901700 AAATAAGAAGAAATAAATTAAGG - Intergenic
1031164923 7:118216387-118216409 AACTCTGAAAAAATAGGTTCTGG + Intronic
1031423458 7:121577599-121577621 AACATAGAAAAAAAACCTTAGGG - Intergenic
1032103935 7:129008496-129008518 AACTCAGAAAGAAAATATTCAGG + Intronic
1032207201 7:129877807-129877829 TATCTAGAAAAAATACATTAAGG + Intronic
1032760713 7:134938892-134938914 AAATCAGATATAATACATTTGGG + Intronic
1033390258 7:140920546-140920568 AGGCCAGAAAAATTACATTAGGG - Intronic
1034563773 7:151897514-151897536 AACACAGAAAAAAAAAATCATGG + Intergenic
1034684230 7:152955884-152955906 AACACAGAAAGAATAAATTTGGG - Intergenic
1037040345 8:14223186-14223208 AAATCAGTAACAATACAGTAAGG - Intronic
1037200283 8:16243881-16243903 AACTCAATAAAAAAAGATTATGG + Intronic
1037234311 8:16698849-16698871 AACTCAGAAGGAATACTTCATGG + Intergenic
1037926707 8:22849258-22849280 CACTGAGTAAAAATAGATTATGG + Intronic
1038257399 8:25962836-25962858 TAGTCAGAATCAATACATTATGG + Intronic
1040113486 8:43587013-43587035 GACTCAGCAAAAAGACATTTGGG + Intergenic
1040623232 8:49113582-49113604 AACTCAAAACAGATAAATTAAGG + Intergenic
1041976553 8:63805483-63805505 ATCTTAAAAAAAATACATTCTGG + Intergenic
1042754784 8:72198735-72198757 AAAATAGAAAAAATACATTTAGG - Intergenic
1042993774 8:74670146-74670168 AACTGTGAAAAAATAAATTTTGG + Intronic
1043264865 8:78252787-78252809 AACTCTAAAAAATTACATTTAGG + Intergenic
1043281808 8:78477456-78477478 AACTTAAAGAAAATACATTGGGG - Intergenic
1043371319 8:79596532-79596554 AATACAGAAAAATTCCATTAGGG + Intergenic
1043781995 8:84347656-84347678 TGCTCAGAAAATAGACATTAGGG - Intronic
1043955399 8:86353425-86353447 AATTGAGAAAAAATAAATCATGG - Intronic
1044027094 8:87186135-87186157 AAATTAGAATAAATACATTTTGG - Intronic
1044139468 8:88632468-88632490 AACTCTGACTAAATAAATTAAGG + Intergenic
1044463579 8:92477600-92477622 GACACTTAAAAAATACATTAAGG - Intergenic
1044609971 8:94081607-94081629 AACTCAAAAATAATATAGTATGG - Intergenic
1044773970 8:95668462-95668484 TGCTATGAAAAAATACATTAAGG - Intergenic
1044805123 8:95999164-95999186 AAATCAGTAAAAGTAAATTAAGG + Intergenic
1044846611 8:96388163-96388185 TACTCAGAAGAAATCCATTTTGG - Intergenic
1045612186 8:103858448-103858470 AAATCAGAAAAATTAAGTTAAGG + Intronic
1046460053 8:114521551-114521573 AACACAGAAAAGAGAAATTAAGG - Intergenic
1046850473 8:118966717-118966739 AAACCACAGAAAATACATTATGG - Intergenic
1046865020 8:119138791-119138813 AAGTCTAAATAAATACATTAAGG - Intergenic
1047106331 8:121734568-121734590 AAATAAAAAAAAATAAATTAAGG - Intergenic
1047157224 8:122332772-122332794 AACTCAGAAAAAATGAAGAAAGG + Intergenic
1047160838 8:122377503-122377525 CACTCACAAAATGTACATTAAGG - Intergenic
1048322901 8:133415265-133415287 TACTCAGAAAAGATACATCATGG + Intergenic
1048893936 8:138971783-138971805 ACCACATAAACAATACATTAGGG - Intergenic
1049047986 8:140167927-140167949 CACCCAGAAAATATGCATTATGG + Intronic
1049948041 9:617189-617211 GACTCAGTAAAATAACATTAAGG - Intronic
1050075214 9:1855904-1855926 ATCCCAGAAAACATACATGAGGG + Intergenic
1050246568 9:3696245-3696267 GGCACAGAAAAAATACATAATGG - Intergenic
1050264289 9:3873777-3873799 ATATCTGAAATAATACATTATGG + Intronic
1050656285 9:7832150-7832172 AAGTCAGCAAAAATATAATAGGG + Intronic
1050867687 9:10523946-10523968 AACTGAGAGAAAATATATTTCGG - Intronic
1051072949 9:13194897-13194919 ACCTAAGGAAAAATAGATTAAGG - Intronic
1051754149 9:20377376-20377398 AAGTCATAAAAAGTACATTATGG + Intronic
1052233632 9:26185065-26185087 AACCTAGAAAAAATACAAAAAGG - Intergenic
1052251118 9:26398264-26398286 ACCTCAGGAAACACACATTAAGG + Intergenic
1052506547 9:29361351-29361373 ATCTCAAAAAAAATAAAATAAGG - Intergenic
1052657512 9:31381752-31381774 AACACAGAACAAATACACAATGG + Intergenic
1054358661 9:64090730-64090752 AACTAAGAAAATATAGATGAAGG + Intergenic
1055209001 9:73766449-73766471 AACCCAGAAAAGAGACATTGTGG - Intergenic
1055717872 9:79138225-79138247 AACTCAGAAAGAATGCCTTTGGG + Intergenic
1057627964 9:96694599-96694621 ATCTCAAAAAAAAAAAATTAAGG - Intergenic
1057952756 9:99383009-99383031 AACTGTGAAAAAATAGATTTCGG + Intergenic
1059847817 9:118301084-118301106 ATGTCTGGAAAAATACATTATGG + Intergenic
1059876655 9:118642774-118642796 AACTCAAAGAAAATACTCTATGG - Intergenic
1060429814 9:123541278-123541300 AACCAAGAAAATATACATAAAGG + Intronic
1060609731 9:124952340-124952362 GAATGAGAAAAAATATATTATGG + Intronic
1203757130 Un_GL000218v1:142427-142449 AAATAAGAAGAAATAAATTAAGG - Intergenic
1203716514 Un_KI270742v1:155095-155117 AAATAAGAATAAATAAATTAGGG - Intergenic
1203534699 Un_KI270743v1:23141-23163 AAATAAGAATAAATAAATTAGGG + Intergenic
1203650743 Un_KI270751v1:118656-118678 AAATAAGAATAAATAAATTAGGG - Intergenic
1185499536 X:586151-586173 AGATTAGAAAAAATACATTTTGG - Intergenic
1185770208 X:2760175-2760197 GTCTCAGAAAAAAAAAATTAAGG + Intronic
1185942537 X:4337791-4337813 AACTCAGACGATATACATTAAGG + Intergenic
1186190042 X:7059195-7059217 TACTCAATAAAAGTACATTACGG + Intronic
1186888964 X:13941414-13941436 AACACAAAGAAAATACACTATGG + Intergenic
1187582112 X:20618137-20618159 AACTAATAAAAAATGAATTAAGG + Intergenic
1187606873 X:20894521-20894543 AAGGCAGAAAAAATCCCTTATGG - Intergenic
1188336677 X:28943859-28943881 AACTCAGAAAAAATACATTAAGG - Intronic
1188448042 X:30277658-30277680 AAATCACAAAATAAACATTAAGG - Intergenic
1188610179 X:32086098-32086120 AATTCAGCAAAAATATAGTAGGG + Intronic
1189356804 X:40316049-40316071 AACTGAGAAGAAATAGATTCAGG + Intergenic
1189854637 X:45211383-45211405 AACTTAGAAAAAATACTTTTGGG + Intergenic
1190030432 X:46967407-46967429 AACTCAGAATAATTAAAATAGGG + Intronic
1190057889 X:47192575-47192597 AAATCAGAGAATATAAATTATGG - Intronic
1191083741 X:56541487-56541509 TACTTAGAAAAAATAGATTACGG + Intergenic
1191212145 X:57896815-57896837 AGCTGAGAAAAAAAACAATAAGG + Intergenic
1191215912 X:57932330-57932352 ACCTCAGAAAGAAACCATTATGG + Intergenic
1193014394 X:76715981-76716003 ATCTCAGAAAAAATAAATACAGG + Intergenic
1193250624 X:79287664-79287686 AATTAAAAAAAAATGCATTATGG + Intergenic
1193722161 X:84999796-84999818 AAGTCAGAAAAAATATATACTGG - Intergenic
1193934734 X:87603299-87603321 AATACAGAAAAGATAAATTAAGG + Intronic
1194004474 X:88473473-88473495 GACTCTGAGAAAATAAATTAAGG - Intergenic
1194053534 X:89101784-89101806 AATTTAGAAAAAAAAAATTAGGG - Intergenic
1194120506 X:89957540-89957562 AATTTAAAAAAAATACATTTTGG + Intergenic
1194369650 X:93056964-93056986 TATTCTGAAAAAATACACTAAGG + Intergenic
1194757080 X:97749983-97750005 AACTGACAAAAAGTAGATTAAGG + Intergenic
1195524765 X:105874024-105874046 ATGTCAGAAAAAAAACAATAGGG - Intronic
1195650186 X:107275551-107275573 ACCTCAGAAAGAAACCATTATGG - Intergenic
1195790171 X:108575838-108575860 AAAAAAGAAAAAATACAATAAGG + Intronic
1196299568 X:114038903-114038925 GTCTCAGAAAAAAAAAATTATGG - Intergenic
1196334820 X:114519536-114519558 ATCTAAGAAAAGATACATTCAGG + Intergenic
1197017565 X:121645492-121645514 TACTCAGAAACAATTCATTATGG + Intergenic
1197457905 X:126701034-126701056 AACTGAGAATAAAGACATTCTGG + Intergenic
1198115531 X:133541399-133541421 AATACAGCAAAAATACATTCTGG - Intronic
1198545466 X:137687531-137687553 AAAGAAAAAAAAATACATTAAGG - Intergenic
1199082794 X:143595282-143595304 ACCTCAGAAAGAAACCATTATGG + Intergenic
1199319711 X:146423495-146423517 AATAAAGAAAAAATACAGTAGGG - Intergenic
1199337232 X:146632542-146632564 AACTCAGAAAAGAAAAATTTGGG + Intergenic
1200021632 X:153216009-153216031 AAGTCAAAAAGAATTCATTAGGG + Intergenic
1200473371 Y:3615061-3615083 AATTAAAAAAAAATACATTTTGG + Intergenic
1200677840 Y:6173173-6173195 TATTCTGAAAAAATACACTAAGG + Intergenic
1201170712 Y:11260047-11260069 AAATAAGAATAAATAAATTAGGG - Intergenic
1202070511 Y:20987165-20987187 AAATCAGAAAAAATAGTTAATGG + Intergenic
1202273440 Y:23092494-23092516 AACACAGAAGAAATACAAAACGG + Intergenic
1202292586 Y:23328188-23328210 AACACAGAAGAAATACAAAACGG - Intergenic
1202426437 Y:24726238-24726260 AACACAGAAGAAATACAAAACGG + Intergenic
1202444352 Y:24943848-24943870 AACACAGAAGAAATACAAAACGG - Intergenic