ID: 1188337352

View in Genome Browser
Species Human (GRCh38)
Location X:28953303-28953325
Sequence GATTTCCCTGGGAGAAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 388}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188337348_1188337352 -5 Left 1188337348 X:28953285-28953307 CCCAATCATATTTTAATAGATTT 0: 1
1: 0
2: 7
3: 80
4: 842
Right 1188337352 X:28953303-28953325 GATTTCCCTGGGAGAAGAAATGG 0: 1
1: 0
2: 3
3: 31
4: 388
1188337349_1188337352 -6 Left 1188337349 X:28953286-28953308 CCAATCATATTTTAATAGATTTC 0: 1
1: 1
2: 3
3: 35
4: 445
Right 1188337352 X:28953303-28953325 GATTTCCCTGGGAGAAGAAATGG 0: 1
1: 0
2: 3
3: 31
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188337352 Original CRISPR GATTTCCCTGGGAGAAGAAA TGG Intronic
900437159 1:2636417-2636439 GATTCACCTGGGAGAGGAAGTGG + Intronic
900708579 1:4096073-4096095 GAATCCCCTGGGAGAAGAAAGGG + Intergenic
901146190 1:7066205-7066227 TGTTGCCCTGGGAGAAGAAGAGG - Intronic
901640568 1:10691009-10691031 GATTTCCCTGGGGGAGGGAGCGG - Intronic
902694707 1:18132643-18132665 TCTTTGCCAGGGAGAAGAAAAGG - Intronic
903618194 1:24677773-24677795 CATTTCCATTGAAGAAGAAATGG - Intergenic
904997729 1:34643995-34644017 GTCTTCCCTGGGAGGAGAGAGGG + Intergenic
905354903 1:37374784-37374806 AATTTCCTAGGGTGAAGAAAAGG + Intergenic
905539072 1:38745845-38745867 GATTTGCTTTGGAAAAGAAAAGG - Intergenic
905562507 1:38938548-38938570 TACTTCCCTGGGACAACAAATGG - Intronic
905714023 1:40132802-40132824 GCTTTGCCAGAGAGAAGAAAGGG + Intergenic
906856348 1:49309714-49309736 GATTTTTCTGGAAGATGAAAGGG + Intronic
906947950 1:50311459-50311481 CATTTCCCTGGGAGAAACAAAGG - Intergenic
908356033 1:63325190-63325212 GATTTTCTGGGGAGGAGAAAAGG - Intergenic
908903385 1:68981560-68981582 GAGTTCCATGGGAGAGGTAAGGG - Intergenic
908968101 1:69791005-69791027 GAATTACATGGGAGAACAAATGG + Intronic
909517118 1:76523483-76523505 TATCTGCCTGGCAGAAGAAAGGG - Intronic
910246864 1:85148489-85148511 GATTTCCCTGGAGGTAGAGAAGG + Intergenic
911391440 1:97249507-97249529 AAGTTCCTAGGGAGAAGAAAAGG + Intronic
911698573 1:100923822-100923844 GATTTCCAAAGAAGAAGAAAAGG - Intronic
914051299 1:144135615-144135637 GATTTTACTGGAACAAGAAAAGG + Intergenic
914127882 1:144829827-144829849 GATTTTACTGGAACAAGAAAAGG - Intergenic
914805431 1:150987916-150987938 GATTTCGCTGGGTGAAGACTGGG - Exonic
915909917 1:159908577-159908599 GACTTCTCTGGGAGTAGGAAGGG - Intergenic
916652428 1:166844357-166844379 AACTTCCCAGGGAGAAAAAAAGG + Intronic
918164750 1:181934485-181934507 GATTTCCCTGGGTGGAGAGAAGG + Intergenic
918405277 1:184206140-184206162 GACTTTCCAGGAAGAAGAAATGG + Intergenic
918797895 1:188928492-188928514 AATTTACCTTGGAGAAAAAATGG + Intergenic
919208857 1:194453916-194453938 GATTTTCCTGGGACAGGAAAAGG + Intergenic
919436749 1:197572151-197572173 GATTTCCCTTGGCTAGGAAAGGG - Intronic
919639756 1:200036439-200036461 GAGTTCTGAGGGAGAAGAAAGGG + Intronic
920225404 1:204434868-204434890 GATCTCCCTAGGAGAAAGAAAGG - Intronic
920837494 1:209525247-209525269 GAATTTGCTGGGTGAAGAAAAGG + Intergenic
921334769 1:214075298-214075320 GATTTTCCTGAGGGAAGACATGG - Intergenic
922412807 1:225392198-225392220 GATGTCTCATGGAGAAGAAAGGG - Intronic
1063055488 10:2500006-2500028 GAGTTCCCTGAGAAAAGAAATGG + Intergenic
1063499030 10:6536630-6536652 TTTTTGCCTGGGAGAAGAACAGG - Intronic
1064849865 10:19698570-19698592 CTCTTTCCTGGGAGAAGAAATGG + Intronic
1066429748 10:35340361-35340383 TATTTCTGTGGGAGGAGAAAGGG + Intronic
1067262418 10:44706000-44706022 TATTTCCATGGGAGCAAAAAAGG + Intergenic
1068433404 10:56961502-56961524 GATTTCACTTGGAAAAGAAAGGG - Intergenic
1070577073 10:77687348-77687370 ACTTTTCCTGGGTGAAGAAAGGG - Intergenic
1071455615 10:85849445-85849467 GATTTCCCAGGGAAATGGAAGGG - Intronic
1072795736 10:98353152-98353174 CATTTTCCTGGGAGAGGGAAGGG + Intergenic
1072917130 10:99544932-99544954 TATTTTACTGGGAGAAGAGAGGG - Intergenic
1074024789 10:109623211-109623233 GATTTCCCTTGAAGGACAAATGG - Intergenic
1074988671 10:118681867-118681889 GATTTCCCTTGGAAAACAACAGG + Exonic
1075202557 10:120417659-120417681 GATTTCCCAGGAAGAAAAGAAGG - Intergenic
1075874539 10:125795449-125795471 GCTTGCCCTGGGAGAGGAAAGGG + Intronic
1077773205 11:5243644-5243666 CATTTCACTGGGAGAGGCAAAGG - Intergenic
1078114187 11:8428429-8428451 GAAATCCCTGGGAAAATAAAGGG - Intronic
1079687836 11:23383398-23383420 GATTTACCTGAGAGATGCAAGGG + Intergenic
1079963390 11:26951051-26951073 GATTTCTCTGGGAGAAAAGCAGG + Intergenic
1080485335 11:32700790-32700812 GTGTGCCCTGGAAGAAGAAAAGG - Exonic
1080733751 11:34988666-34988688 GATTCACCAGGTAGAAGAAAAGG + Intronic
1080920538 11:36704666-36704688 GCTTCCCCTGGGACATGAAAAGG - Intergenic
1081354768 11:42099038-42099060 GATTTCCACTGGAGAAGTAAGGG - Intergenic
1081578601 11:44335332-44335354 GTTTTCCCTGTGAGATCAAAAGG - Intergenic
1081933651 11:46889831-46889853 GATTTCCCCATCAGAAGAAATGG + Intronic
1082299717 11:50491334-50491356 GAATTCCATGGGGAAAGAAAAGG + Intergenic
1083088300 11:60173312-60173334 CATTTCCTTGAGAGGAGAAAGGG + Intronic
1083108375 11:60380779-60380801 AATGTCCCTGGGAGAGGATATGG + Intronic
1083666294 11:64276687-64276709 GAATTCCCTGGGGGAAGGAGAGG + Intronic
1084077101 11:66788142-66788164 TATTTCTGTGTGAGAAGAAATGG - Exonic
1085226185 11:74923271-74923293 GAAGTCCCTGGCATAAGAAATGG + Intronic
1085349352 11:75788612-75788634 GTTTCCCATGGGAGAAGATAAGG - Intronic
1085388996 11:76172632-76172654 GCTTTCCCTGGGCCAAGAAGGGG - Intergenic
1086029503 11:82336830-82336852 GATTTCCCTTTTAGAAGAGATGG + Intergenic
1087488624 11:98792955-98792977 GATTTCCTTTGGTGGAGAAAAGG + Intergenic
1090274560 11:125410358-125410380 GAATTCCCTGGGAGGAGAAAGGG + Intronic
1090586540 11:128219312-128219334 GACTTCCCAGGGAGAAGGAAGGG - Intergenic
1091302798 11:134518258-134518280 TGTCTCCCTGGGAGAAAAAACGG - Intergenic
1092399547 12:8162643-8162665 GCTCTCCGTGGGAGAAGATAGGG - Intronic
1093967092 12:25339599-25339621 GATTTCCCTGGAGGAAAATAAGG - Intergenic
1094495892 12:30989129-30989151 AATCTCCCTGGGAGAAGGGACGG - Intronic
1096240755 12:49958974-49958996 GAGTTCCCTGGGAGAAGTTGAGG - Intergenic
1096561650 12:52439856-52439878 GATGTAACTGGGAGAGGAAAGGG - Intergenic
1097803705 12:63942754-63942776 GACGGCACTGGGAGAAGAAACGG - Intronic
1098612218 12:72472801-72472823 TATTTGACTTGGAGAAGAAAGGG - Intronic
1101711466 12:107270961-107270983 CATGTTCCTGGGAGAAGAACTGG + Intergenic
1102939556 12:116927501-116927523 GTTTTCACTGGGAAAAGAACAGG - Intronic
1103027852 12:117588114-117588136 CATGTCCCTGGGAAAAGCAAAGG + Intronic
1103390739 12:120571276-120571298 GATTTACCTGGGCAAAGGAAGGG - Exonic
1104617668 12:130284007-130284029 GTTGTCCCTGGGAAAAGAAATGG + Intergenic
1105297466 13:19101555-19101577 AAATTCCATGGGAGCAGAAAAGG + Intergenic
1106117506 13:26830057-26830079 TACTTCCCAGGGAGAAGGAACGG - Intergenic
1106419439 13:29573357-29573379 GAGATCCCTGGGAGAAAAGAAGG + Intronic
1106809212 13:33343146-33343168 GATTTGCATGGGAGAGAAAAAGG - Intronic
1108331936 13:49395639-49395661 GAGTTCCCTGGGAGCAGAGTTGG - Intronic
1108463784 13:50694294-50694316 GTTTTCCATGGGAGAAGAGTGGG - Intronic
1108691023 13:52859350-52859372 GAGCTCCTTGGGAGAAGGAAGGG + Intergenic
1108955560 13:56152776-56152798 GTTTTCACTGGGGGAAGGAAAGG - Intergenic
1108969636 13:56357196-56357218 TATTTACCTGGAAGAACAAAAGG - Intergenic
1109705103 13:66079511-66079533 ACTTTGCCTGGAAGAAGAAATGG + Intergenic
1110377237 13:74806975-74806997 GCTTTTCATGGAAGAAGAAATGG + Intergenic
1110431653 13:75431059-75431081 GGTGTCCCAGGGAGAATAAAAGG + Intronic
1110738902 13:78971148-78971170 AATGTCCGTGGGACAAGAAAGGG - Intergenic
1113096031 13:106664465-106664487 CATTTCCCTGGCAGAACAGAAGG - Intergenic
1113953212 13:114083639-114083661 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953246 13:114083801-114083823 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953269 13:114083909-114083931 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953306 13:114084071-114084093 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953317 13:114084125-114084147 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953330 13:114084179-114084201 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953344 13:114084233-114084255 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953357 13:114084287-114084309 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953370 13:114084341-114084363 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953383 13:114084395-114084417 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953396 13:114084449-114084471 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953407 13:114084503-114084525 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953420 13:114084557-114084579 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953481 13:114084827-114084849 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953494 13:114084881-114084903 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953603 13:114085367-114085389 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953616 13:114085421-114085443 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953821 13:114086339-114086361 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953846 13:114086447-114086469 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953859 13:114086501-114086523 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953872 13:114086555-114086577 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953885 13:114086609-114086631 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953922 13:114086771-114086793 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953957 13:114086933-114086955 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1113953992 13:114087095-114087117 GATTTCCCCGCGAGGAGGAAGGG - Intronic
1114678062 14:24458813-24458835 GCTTTCCCTTTGGGAAGAAAAGG + Intergenic
1115964281 14:38869482-38869504 GATTTTGCTGGAAGAAAAAATGG - Intergenic
1117992514 14:61448669-61448691 GATATCCCAGGGAGAGAAAAGGG + Intronic
1118516520 14:66534762-66534784 TATTTGCCTGGGAAATGAAAAGG - Intronic
1118840216 14:69504326-69504348 GACTTGCCTGGGAGAGGACAAGG - Intronic
1118968472 14:70610768-70610790 GATTTTCCTGGTAGAGGAAAGGG + Intergenic
1119414064 14:74457709-74457731 GAGTCCCCTGGGAGGGGAAATGG - Intergenic
1119529649 14:75350814-75350836 GAGATCCCTGTGAGCAGAAAGGG + Intergenic
1119759331 14:77140144-77140166 GACCTCCCTAGGAGGAGAAAGGG + Intronic
1120967138 14:90177476-90177498 GATTCCCTTGGGGGAAGAGATGG - Intronic
1121865467 14:97358883-97358905 GACTTCCCTGGCAGAAGGAGAGG + Intergenic
1123421072 15:20134123-20134145 GATTTTACTGGAACAAGAAAAGG + Intergenic
1123530297 15:21140652-21140674 GATTTTACTGGAACAAGAAAAGG + Intergenic
1125518309 15:40335114-40335136 GAGTCCCCGGGGAGAGGAAAAGG - Exonic
1126252964 15:46589952-46589974 ACTTTGCCTGGGAGAAAAAAAGG - Intergenic
1126318830 15:47399836-47399858 AACATCCCTGAGAGAAGAAATGG + Intronic
1126547527 15:49889377-49889399 GAATTTCCTGGGAGAAGCAGCGG - Intronic
1126793941 15:52244741-52244763 AATTACCCTGGAGGAAGAAATGG + Intronic
1128524634 15:68403987-68404009 GAGTTCCCTGGGGGAAGGACAGG - Intronic
1128690369 15:69720205-69720227 GATTTTCTTGGGAAAAGCAATGG + Intergenic
1130833741 15:87629369-87629391 CATCTCCCAGGGAGAACAAAGGG - Intergenic
1131028906 15:89169898-89169920 GATTTCCTGGGGAGAAAAACTGG - Intronic
1131782568 15:95875483-95875505 GATTTGCCTGGCAACAGAAATGG + Intergenic
1132794823 16:1714646-1714668 CATTTCCTGGGGAGAAGGAAAGG - Intronic
1135064298 16:19296309-19296331 CATTTCTCTGGGGAAAGAAAGGG - Intronic
1137652696 16:50134175-50134197 GCTTTGCTTGGAAGAAGAAATGG - Intergenic
1137997982 16:53240700-53240722 AATTGCCCTGGGAAAAGTAATGG + Intronic
1139135716 16:64202180-64202202 GATATTTCTGGGAGAACAAAAGG - Intergenic
1139258801 16:65571875-65571897 AATTTCCGTGGAAGAAGAAAAGG - Intergenic
1141176718 16:81725273-81725295 GATTTGCCAGGGAGGAGAAGGGG + Intergenic
1141192916 16:81837500-81837522 GAATCCCCTGGGAGGAGTAAGGG + Intronic
1141243312 16:82283370-82283392 AATTTCCCACAGAGAAGAAAAGG + Intergenic
1141410233 16:83828178-83828200 GAGTGCCCTGGGAGATGAGAAGG - Intergenic
1141760814 16:86027266-86027288 GCATTGCCTGGGGGAAGAAAAGG - Intergenic
1144774868 17:17780372-17780394 GGTTTTCTTGGGAGAAAAAAAGG - Intronic
1146802465 17:35837491-35837513 GATTTGGCTGGGATAAGACAAGG - Intronic
1149026457 17:52032774-52032796 GATTTGCCAGGGAGAAAAATGGG + Intronic
1149191834 17:54072454-54072476 GAGTTCCTTTGGAGGAGAAAAGG + Intergenic
1149947611 17:60947617-60947639 GTTTTCCCTGGGGCAAGAAATGG - Intronic
1150625696 17:66839753-66839775 GCTTTCTCTGTGAGTAGAAAGGG + Intronic
1150893943 17:69187342-69187364 GATTAGCATGGTAGAAGAAAAGG - Intronic
1151603989 17:75124792-75124814 CATTTCCATGGGAGAAGTCAAGG - Intronic
1152533852 17:80939008-80939030 GCTTTCTCTGATAGAAGAAATGG - Intronic
1153947191 18:10028428-10028450 AACTGCCCTGGGAGAAGAAAAGG - Intergenic
1154093477 18:11387232-11387254 TAGTTGCCTGGGAGAAAAAAGGG - Intergenic
1154100904 18:11472716-11472738 GATTTCCTTTGGAGAACAAAGGG - Intergenic
1154357131 18:13630273-13630295 GATTCCCCAGGAGGAAGAAAGGG + Intronic
1155166517 18:23236573-23236595 AATTTCCCTGAGAGTAGACACGG - Intronic
1156036400 18:32771292-32771314 CACTTTCCCGGGAGAAGAAAGGG - Intronic
1156887600 18:42153399-42153421 TAGTTCCCTAGGAGAAGAATGGG - Intergenic
1157120940 18:44910641-44910663 GTTTCCTCTGGGGGAAGAAAAGG - Intronic
1157155694 18:45263430-45263452 AATTTCAAAGGGAGAAGAAAAGG - Intronic
1157675923 18:49568722-49568744 GATTTAGCTGGGAGAAGGCAGGG + Intronic
1157843563 18:50981609-50981631 GATTTCAAAGGGAGAAGGAATGG - Intronic
1159075466 18:63676770-63676792 GACTTCCTGGGGACAAGAAAGGG + Intronic
1159272421 18:66169567-66169589 ATTTTGCCTGGGAGGAGAAATGG - Intergenic
1159277166 18:66235793-66235815 GAAGTCACTGGGAGAAAAAAAGG - Intergenic
1159945796 18:74443931-74443953 GCTCTCCCTGGGAGATGAGAAGG - Intronic
1162164639 19:8743955-8743977 AGCTTCCCTGGGTGAAGAAAAGG + Intergenic
1162165711 19:8751423-8751445 AGCTTCCCTGGGTGAAGAAAAGG + Intergenic
1162166776 19:8758879-8758901 AGCTTCCCTGGGTGAAGAAAAGG + Intergenic
1162167842 19:8766339-8766361 AGCTTCCCTGGGTGAAGAAAAGG + Intergenic
1162168781 19:8772633-8772655 AGCTTCCCTGGGTGAAGAAAAGG + Intergenic
1162170527 19:8785401-8785423 AGCTTCCCTGGGTGAAGAAAAGG + Intergenic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1162971077 19:14181926-14181948 GATTTCACTGTGACAAGGAAGGG + Intronic
1163111352 19:15162556-15162578 GATTTCCCTGGAGGATGAAGGGG + Exonic
1165271542 19:34711884-34711906 GCTTTCTGTCGGAGAAGAAATGG - Intergenic
1165849734 19:38842848-38842870 TATGTTCCTTGGAGAAGAAATGG + Intronic
1202690705 1_KI270712v1_random:88251-88273 GATTTTACTGGAACAAGAAAAGG + Intergenic
925901246 2:8510889-8510911 GGTTCCCCTGGGAGCAGACATGG - Intergenic
926371406 2:12182395-12182417 GAGTTCCATGGGAGAAGCAATGG - Intergenic
926528024 2:14007171-14007193 AATTTCCCGGGCAGAAGAAAAGG - Intergenic
928072663 2:28233127-28233149 GCTTAACCTGGGAGGAGAAAAGG - Intronic
930565026 2:53007965-53007987 TATTTACATGGGAAAAGAAATGG - Intergenic
930697326 2:54425283-54425305 GGTTTCTCTGGGACAAGGAATGG + Intergenic
930871930 2:56179602-56179624 CATTTCCCTGGCAGAGGCAAAGG - Intergenic
930893016 2:56412868-56412890 CATTTCTCTGAGAGTAGAAAGGG + Intergenic
931322013 2:61180826-61180848 GAGTACCCTGGGACAAGAAGAGG + Intronic
931650448 2:64463866-64463888 TCTTTCCCTGGGAGATGGAAGGG - Intergenic
931721280 2:65069444-65069466 AATGGCCCTGGGTGAAGAAAAGG + Exonic
932287474 2:70548927-70548949 CATTTCCTAGGGGGAAGAAAAGG + Intronic
932362792 2:71122864-71122886 GAATTCCCTAGGTGAACAAAAGG - Intronic
932418512 2:71587879-71587901 GAGTCCCCTGGGAGAATAGAGGG + Intronic
932514010 2:72326204-72326226 AATTTCCCTGGGAGTAGCAGTGG - Intronic
933955707 2:87367753-87367775 GATTTTACTGGAACAAGAAAAGG - Intergenic
934239859 2:90259786-90259808 GATTTTACTGGAACAAGAAAAGG - Intergenic
934273330 2:91556968-91556990 GATTTTACTGGAACAAGAAAAGG + Intergenic
934462307 2:94223053-94223075 GATTTTACTGGAACAAGAAAAGG - Intergenic
935061557 2:99612656-99612678 TTTTTCCCTGGGAGAGGATAGGG + Intronic
935380735 2:102448634-102448656 CAGATCCCTGGGGGAAGAAAGGG + Intronic
938774143 2:134526200-134526222 GAAATCGATGGGAGAAGAAAAGG + Intronic
940544714 2:155069377-155069399 CACTTCCTTGGAAGAAGAAATGG - Intergenic
942111164 2:172684017-172684039 GAATACCCTGGCAGCAGAAATGG + Intergenic
942215673 2:173716960-173716982 TATTTGCCCTGGAGAAGAAATGG + Intergenic
942571904 2:177323464-177323486 GAATTACCTGGGAGTAGTAAAGG - Intronic
943701369 2:190991384-190991406 GATTTTCCTGAAAGAAAAAAGGG + Intronic
944131558 2:196352985-196353007 GATTTCACTCTGAGAAGAATAGG - Intronic
946073897 2:217057743-217057765 GATTTCCTTGGGACCAGAGAGGG - Intergenic
947102802 2:226639293-226639315 GAGTTCCCTGAGGGTAGAAAAGG + Intergenic
1168930738 20:1621411-1621433 AATTTCCTTGGTAGGAGAAATGG + Intergenic
1169877602 20:10315038-10315060 CATCTGCCTGGGACAAGAAAGGG + Intergenic
1170256058 20:14344960-14344982 GATTTGCCTTGGGGAAGAAAGGG - Intronic
1170952654 20:20950870-20950892 AATTTCCAGGGGAGAAGAAATGG + Intergenic
1170961201 20:21027318-21027340 GATTTAGCTGGGAGAAGACTAGG - Intergenic
1171247218 20:23621242-23621264 GGCTTCCCTTGGATAAGAAAGGG + Intergenic
1171262700 20:23747849-23747871 AAGTTCCCTGGGAGAACAGAAGG - Exonic
1172527664 20:35610075-35610097 AATTACCCTGAGAGCAGAAAGGG + Intergenic
1172814605 20:37676542-37676564 GGTTTCCTGGGCAGAAGAAATGG - Intergenic
1173586923 20:44189393-44189415 GATTGTCCTGGGAGAAGACTTGG + Intergenic
1174200798 20:48805144-48805166 TATGTGCCGGGGAGAAGAAACGG + Intronic
1175344743 20:58264761-58264783 GGTGTCACTAGGAGAAGAAAAGG + Intergenic
1176103952 20:63376994-63377016 GCTTTGCCTGGGAGAAATAAAGG + Intronic
1177509270 21:22062669-22062691 AATTTTCCAGGCAGAAGAAAAGG - Intergenic
1177713181 21:24806369-24806391 GATTTCTCTGAGAGATGGAAGGG + Intergenic
1178990100 21:37346166-37346188 GATATCCCAGGGAACAGAAAAGG - Intergenic
1179244095 21:39615127-39615149 GACTTACCTGGGAGCAGGAAGGG - Intronic
1179281676 21:39939163-39939185 GAATTCCCTGGGAATAGACATGG + Intergenic
1181460597 22:23083755-23083777 GACTTCCCCTGGGGAAGAAATGG - Intronic
1182854533 22:33505464-33505486 CGTTTCCCTGGAAGAAGAAAAGG + Intronic
1183040646 22:35175355-35175377 GATTTCACTGGATGAAGAAGTGG - Intergenic
1183240877 22:36657465-36657487 GCTCTGCCTGGGAGAAGAAGAGG + Intronic
1183261630 22:36799147-36799169 GATTTCCCTGGGTGGAGAGGGGG - Intergenic
949930582 3:9075183-9075205 TATTGGCCTGGGAGAAAAAAAGG - Intronic
950046545 3:9951768-9951790 CATTTCACAGGGGGAAGAAACGG + Intronic
950107418 3:10397031-10397053 CATTTCCCTGGGAGGACAATAGG - Intronic
951014203 3:17712140-17712162 GATTTCACCGAGAGAAGAGAAGG - Intronic
951243783 3:20316818-20316840 GGTTTCTGTGGGAGAAAAAAAGG + Intergenic
952419582 3:33118981-33119003 GACTGGCCTGGGAGAAGAAGAGG - Intronic
952736093 3:36692938-36692960 GATTTCCCCTGAAGAAGAAAAGG - Intergenic
953749555 3:45598792-45598814 CATTTCCCTGGGAAAACACATGG - Intronic
954849530 3:53588624-53588646 GTTTTCCCTGAGAGCAGCAAAGG + Intronic
955932701 3:64073600-64073622 GGTCTCCCTTGGAGAAGGAAAGG - Intergenic
955983723 3:64551906-64551928 CAGTTCCCCTGGAGAAGAAAAGG - Intronic
956349559 3:68320124-68320146 GATTTTACCGGGAAAAGAAAAGG - Intronic
956357446 3:68409698-68409720 CAATTCCCTGGCAGATGAAAAGG + Intronic
956890999 3:73613890-73613912 GATCTCCCTGGGAGAAGCTTAGG + Intronic
957666028 3:83228865-83228887 GATTTAGCTGTGAGAAGAAGAGG + Intergenic
960644975 3:119870085-119870107 GATTTGCCTAGGTGTAGAAAAGG - Intronic
961330392 3:126134854-126134876 GATGTTCCTGGGAGAAGAGAGGG - Intronic
962426933 3:135278441-135278463 GATTGACCTGGGAGATGAAGGGG - Intergenic
963069409 3:141290571-141290593 GATTTCCCTAGGGAGAGAAAGGG + Intronic
963931513 3:151008745-151008767 AATTTCCCAGGGATAAGAAATGG + Intergenic
963966073 3:151372050-151372072 TATTTCCCTGGGAATGGAAAAGG - Intronic
964446448 3:156764245-156764267 GATTTGGTGGGGAGAAGAAATGG + Intergenic
966520516 3:180869274-180869296 AATTTCACTGAAAGAAGAAAGGG - Intronic
968935329 4:3607327-3607349 GATGTGCTTGGGAGAAGACAGGG - Intergenic
969595502 4:8147304-8147326 GACTCCACAGGGAGAAGAAAAGG + Intronic
970746244 4:19299349-19299371 AATTTCCCAGGAAGAAGAAACGG - Intergenic
970811012 4:20094002-20094024 AATTTCCATTGGTGAAGAAAGGG - Intergenic
971015947 4:22488854-22488876 AAGTCCCCTGGGAGAAAAAAAGG + Intronic
971131515 4:23816096-23816118 ATTCTCCCTGAGAGAAGAAAAGG + Intronic
971232429 4:24810478-24810500 GTTATCCCTGGCAGCAGAAAAGG - Intronic
971458084 4:26862282-26862304 GATTTCTTTGGGAAAAGTAATGG + Intronic
971766970 4:30845098-30845120 GATTTCCTTTGGAGCAGTAATGG + Intronic
971774373 4:30942996-30943018 TTTTTCCCTGGGAGAACATAGGG + Intronic
975008237 4:69317688-69317710 CATTTCCCTGTGAGGAGAAAAGG - Intronic
977138173 4:93332841-93332863 AATTACCTGGGGAGAAGAAAAGG - Intronic
978645755 4:110929416-110929438 AATTTCTTTGGGAGAAGAAGAGG - Intergenic
978751712 4:112256256-112256278 TATTTTACTGGGAGAACAAACGG - Intronic
981343051 4:143644855-143644877 GCTTTCCCTGGGAAACCAAAAGG - Intronic
982475216 4:155842200-155842222 TATTTACCAGGAAGAAGAAAAGG + Exonic
983339096 4:166434921-166434943 TATTTGCTTGGGAGAATAAATGG + Intergenic
984781703 4:183532356-183532378 GATTAGGCTGGGAAAAGAAAGGG - Intergenic
985792853 5:1939963-1939985 GATTCCCAGGGGAAAAGAAAAGG - Intergenic
987865379 5:23529143-23529165 GATTCCCCTGGAAGAAGCAGGGG - Intergenic
989244189 5:39235127-39235149 AAATTCCCTGGAAGAAAAAAAGG + Intronic
989974849 5:50572781-50572803 GTTTTCCCAGGGAAAAGAGAAGG - Intergenic
990570791 5:57076299-57076321 GATTTCCCTTGAATAATAAAAGG + Intergenic
990702145 5:58485309-58485331 GTTTCCCATGGGAGAATAAAAGG + Intergenic
990771267 5:59248513-59248535 CAACTCCCTGGGACAAGAAAAGG + Intronic
991145698 5:63300959-63300981 GATTTCCCGGAAAGAAGAAGGGG - Intergenic
992258251 5:74943726-74943748 GATAGCCGTGAGAGAAGAAAAGG + Intergenic
993383339 5:87233299-87233321 GAGTCCCTTGGGAGGAGAAATGG - Intergenic
994116012 5:96062079-96062101 GACTTCCCTGTGAGAAGGTAAGG - Intergenic
995642870 5:114277894-114277916 GTTTTCCTTTGGAGGAGAAAAGG + Intergenic
995776213 5:115727195-115727217 GATTTGCATGGAAGAAGAATTGG - Intergenic
998700250 5:144690164-144690186 ATTTTCTCTGGGAGTAGAAAGGG - Intergenic
998704927 5:144748040-144748062 AATATTCCTGGGAGAAGAGAGGG - Intergenic
999311359 5:150554027-150554049 CATATCCCAGGGGGAAGAAAGGG - Exonic
1000204311 5:159043337-159043359 GATATGCCAGGGAGAAGAACTGG - Intronic
1001298502 5:170516264-170516286 AAGTTCCCTGGGAGAGGAGAAGG - Intronic
1001416276 5:171546535-171546557 GATTCCCGTGTGAGAAAAAAAGG + Intergenic
1001770254 5:174290510-174290532 GCATTCCCTGGGAGAATAAGAGG - Intergenic
1001835697 5:174829992-174830014 GACTTCACAGGGAGAAGACATGG + Intergenic
1002180872 5:177430550-177430572 GAGTTCCCCCGGTGAAGAAAGGG - Intronic
1003691700 6:8361297-8361319 CATTTCTGTGGGAGTAGAAATGG - Intergenic
1004319424 6:14621092-14621114 TATTTCCCAGTGAGAACAAAGGG + Intergenic
1006184468 6:32173095-32173117 ACTTGCCCTGGGAGAGGAAAGGG + Intronic
1007667992 6:43527579-43527601 GATTTTCCTGGAAGAAGAGCTGG - Intronic
1010098634 6:72076861-72076883 GGTTTCCCTGGGAAAAACAAAGG + Intronic
1010212157 6:73370616-73370638 GATTTCCTCTGGAGAAGGAAAGG - Intronic
1010649194 6:78431231-78431253 GATTTCAGTGACAGAAGAAATGG - Intergenic
1011249874 6:85359837-85359859 TGTTTCCAGGGGAGAAGAAAAGG - Intergenic
1012712639 6:102628279-102628301 TATTTCTGTGGGAGAAGGAAAGG - Intergenic
1012986208 6:105878751-105878773 GATCTCCCAGGGAGAACACAGGG + Intergenic
1013596929 6:111668887-111668909 GTTTTTCATGGGAGAAGAAAGGG - Intronic
1015341194 6:132103005-132103027 GTTTTCACTGGGAGAACACAGGG - Intergenic
1015488649 6:133800387-133800409 GAGCTCCCAGGGAGAAGAATGGG - Intergenic
1016328286 6:142927213-142927235 GATTTCCCACGGGGAGGAAAAGG + Intronic
1016406230 6:143733997-143734019 CATTCTACTGGGAGAAGAAAAGG - Intronic
1016431188 6:143987906-143987928 TATTTCCCTGGGAGAAGAATTGG - Intronic
1016694220 6:146974011-146974033 GCTTTCCCTGAAATAAGAAAAGG - Intergenic
1017500122 6:155016340-155016362 GATTCCCATGAGAAAAGAAAAGG + Intronic
1018742188 6:166738384-166738406 GATGGTCCAGGGAGAAGAAAAGG + Intronic
1019297428 7:285559-285581 TCTTTCCCTGGGAGAGGATAAGG + Intergenic
1019393398 7:802490-802512 GATCTCACCGGGAGAAGAACCGG - Intergenic
1019414455 7:920866-920888 TAATTCCCTGGGAGTGGAAAAGG - Intronic
1020000546 7:4753346-4753368 GATGTTCCTGGCAGAGGAAAGGG + Intronic
1020883846 7:13797978-13798000 CATTTACCTTGGAAAAGAAAAGG + Intergenic
1020885892 7:13819015-13819037 GATTTGACTGGGACGAGAAAGGG + Intergenic
1021556041 7:21919224-21919246 GATATACATGGTAGAAGAAAAGG - Intronic
1021807958 7:24375457-24375479 GATTTCCCTGGAAAAGGAATGGG - Intergenic
1022775280 7:33520892-33520914 GATTTCCCAGTGAGAACAACTGG - Intronic
1023193092 7:37604150-37604172 GAAGTCACTGAGAGAAGAAAAGG - Intergenic
1024441711 7:49427109-49427131 GAATTCCCTAAGAGAAGACAGGG - Intergenic
1026158601 7:67849364-67849386 GCTATCCCTGCAAGAAGAAAAGG - Intergenic
1027223833 7:76231853-76231875 AAGTTCCCTAGGTGAAGAAAAGG + Intronic
1028563974 7:92207042-92207064 GATTTTAGAGGGAGAAGAAATGG + Intronic
1028732643 7:94169629-94169651 GATTTCCATGGGAGGATAAAAGG - Intergenic
1029709954 7:102294004-102294026 AGTTTTCCTGGGAGAAGAGAAGG + Intronic
1030636362 7:111953769-111953791 GTTCTCCCTGGTAGAAGAAGGGG - Intronic
1030825580 7:114153305-114153327 GATTGCTGTGGGGGAAGAAAAGG + Intronic
1031900056 7:127398903-127398925 GAATTCCATGGGGGAAAAAAGGG + Intronic
1032101920 7:128987138-128987160 GACTGCCCTGAGGGAAGAAATGG - Intronic
1032354683 7:131199549-131199571 CACTTCCCTTGGAGAAGAAAGGG + Intronic
1032427574 7:131833818-131833840 TATTTCCCTGGGAGTGGAGAGGG - Intergenic
1032728685 7:134616162-134616184 GAGCTCCCTGGGTCAAGAAAAGG + Intergenic
1033347965 7:140540221-140540243 GATTTCTGTGGGAGAAGAGAAGG - Intronic
1033460687 7:141544918-141544940 AAGTACCCTGGAAGAAGAAAAGG - Intergenic
1035703771 8:1658356-1658378 GCTTTCCCTTAAAGAAGAAACGG + Intronic
1037448326 8:18990479-18990501 GATGTCCCTGGCAGATGAAATGG - Intronic
1037500628 8:19482385-19482407 GGTTGCCGTGGGACAAGAAAAGG - Intronic
1038168132 8:25104344-25104366 GGTTTCCGTGGGGGAAAAAAGGG + Intergenic
1039569600 8:38576277-38576299 GAGGTCCCTGGGGGAAGAAGAGG - Intergenic
1040711141 8:50190506-50190528 GATTTCTCTTTGAGAAAAAAAGG + Intronic
1040842928 8:51803781-51803803 GATTTCCCAGAGGGAAGAATGGG - Intronic
1041356361 8:57005017-57005039 CATTTCCTTAGAAGAAGAAAAGG - Intergenic
1041744174 8:61188840-61188862 AATTTCCCTTTAAGAAGAAAAGG + Intronic
1041935053 8:63324437-63324459 GTTTTCTCTGAGAGAAGGAAGGG + Intergenic
1043088799 8:75872134-75872156 GAGGTTCCTGGGAGAAGAGATGG - Intergenic
1043719286 8:83526262-83526284 GATTCCTCTGGCAGAATAAATGG + Intergenic
1047680226 8:127247135-127247157 TATTTCACTGAGAGAAGAGAAGG - Intergenic
1048481681 8:134801715-134801737 TTTTTCTCTGGGAGAAAAAATGG + Intergenic
1048600822 8:135916977-135916999 GATGTGTCTGTGAGAAGAAAAGG + Intergenic
1049522833 8:143103139-143103161 GTTTTGCCTGGAAGGAGAAAGGG - Intergenic
1050068479 9:1786037-1786059 GATTACACTGGAAGATGAAAGGG - Intergenic
1050422101 9:5476878-5476900 GCGTTCCTTTGGAGAAGAAAAGG + Intergenic
1050673915 9:8029988-8030010 GATATCGATGGGAGTAGAAAAGG + Intergenic
1050766023 9:9134645-9134667 GAGTGTCCTGGGAGGAGAAAGGG - Intronic
1050801092 9:9615444-9615466 GACTTCCCTTGGAGAAGACATGG - Intronic
1051557038 9:18395477-18395499 GCTTTCCTTTGGAGAAGAATAGG - Intergenic
1052717869 9:32139568-32139590 GATGTCCCAGGAAGAGGAAACGG + Intergenic
1053618588 9:39794068-39794090 CTTTTCACTGAGAGAAGAAAAGG - Intergenic
1053692823 9:40603704-40603726 GATTTTACTGGAACAAGAAAAGG - Intergenic
1053859457 9:42372232-42372254 GATTTTCCTGGAGGAAAAAAAGG - Intergenic
1053876761 9:42553429-42553451 CTTTTCACTGAGAGAAGAAAAGG - Intergenic
1053895913 9:42741276-42741298 CTTTTCACTGAGAGAAGAAAAGG + Intergenic
1054234936 9:62548293-62548315 CTTTTCACTGAGAGAAGAAAAGG + Intergenic
1054265567 9:62913361-62913383 CTTTTCACTGAGAGAAGAAAAGG + Intergenic
1054272010 9:63036390-63036412 GATTTTACTGGAACAAGAAAAGG + Intergenic
1054304063 9:63402931-63402953 GATTTTACTGGAACAAGAAAAGG - Intergenic
1054402810 9:64726944-64726966 GATTTTACTGGAACAAGAAAAGG - Intergenic
1054436433 9:65212434-65212456 GATTTTACTGGAACAAGAAAAGG - Intergenic
1054454856 9:65424575-65424597 GATGTGCTTGGGAGAAGACAGGG + Intergenic
1054493965 9:65809560-65809582 GATTTTACTGGAACAAGAAAAGG + Intergenic
1054787655 9:69224223-69224245 GAATTCAGTGGGTGAAGAAAAGG - Intronic
1055145110 9:72924049-72924071 TATATCCATGTGAGAAGAAATGG + Exonic
1055491638 9:76810854-76810876 GATTTCTCTGTCACAAGAAAAGG + Intronic
1055537039 9:77258898-77258920 TATTTCTCTGAGGGAAGAAAAGG + Intronic
1055559707 9:77510708-77510730 GATGCCCCTGGGAGAAGTGATGG + Intronic
1055697148 9:78897969-78897991 CATTTGCCTTGGAGAAGAAAAGG + Intergenic
1056752738 9:89363913-89363935 GCTTTGTCTGGGAGAAGAATGGG - Intronic
1057059064 9:91987065-91987087 ACTTTGCCTGGAAGAAGAAATGG + Intergenic
1057999074 9:99847139-99847161 GCTTTCCTTGGGACAGGAAATGG - Intronic
1058409431 9:104714986-104715008 CATTATCATGGGAGAAGAAATGG + Intergenic
1058825729 9:108774602-108774624 GCTTAGCCTGGGACAAGAAAGGG - Intergenic
1059198823 9:112395923-112395945 GATTTCCCTCGTAGAGGAACAGG + Intronic
1059402980 9:114082063-114082085 GATTTTCCAGGAAGAAGGAAGGG + Intergenic
1059744063 9:117183093-117183115 GCATGCTCTGGGAGAAGAAAGGG - Intronic
1060274934 9:122175256-122175278 GGTTTCCCAGCGAGAGGAAATGG + Intronic
1060358901 9:122936219-122936241 GAGTTCCAAAGGAGAAGAAAGGG - Intergenic
1061126427 9:128679381-128679403 GCTTTCTCTGGTGGAAGAAAAGG - Intergenic
1062353459 9:136150253-136150275 GCTTTCCCTGGGAGAGGGAGGGG - Intergenic
1185753965 X:2637958-2637980 AACTCCCCTGGGAGAAAAAATGG - Intergenic
1186263500 X:7806610-7806632 GATATCCTAGGGAGGAGAAAGGG + Intergenic
1186720275 X:12296694-12296716 AAGTTCCCTGGGAGAAGTTATGG - Intronic
1187650260 X:21394538-21394560 GAGTTCCCTGGCAGGAAAAATGG - Intronic
1188337352 X:28953303-28953325 GATTTCCCTGGGAGAAGAAATGG + Intronic
1190993912 X:55585520-55585542 GATTCCCCTGGGGTCAGAAAAGG - Intergenic
1191686010 X:63891941-63891963 GAATTCCCTGGGGAAAAAAAAGG + Intergenic
1193359368 X:80561882-80561904 GAGTTCGTTGGGAGAATAAAGGG + Intergenic
1193407309 X:81118126-81118148 TGTTTCCCTGGGAAAACAAAAGG - Intronic
1194522663 X:94937388-94937410 GATGTCTCAGGGAGAAGCAAAGG - Intergenic
1196737066 X:118989392-118989414 GATTGTCCTGGATGAAGAAAGGG - Exonic
1197059460 X:122160111-122160133 AACTTCCCTGGTAGCAGAAAAGG + Intergenic
1199611698 X:149622561-149622583 GTTTTTCCAGGGAGAAAAAAAGG + Intronic
1199676721 X:150195721-150195743 TATTTGCCTGGTAGAAGAGAGGG + Intergenic
1201012429 Y:9560755-9560777 GAGTTCCCTGTGAGAAACAAAGG + Intergenic
1201470375 Y:14326837-14326859 AATTTCCCTGGCAGAATAAAAGG + Intergenic