ID: 1188338650

View in Genome Browser
Species Human (GRCh38)
Location X:28971794-28971816
Sequence CCCTCATCCCCAAATACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 204}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188338650_1188338655 -8 Left 1188338650 X:28971794-28971816 CCATCTGTATTTGGGGATGAGGG 0: 1
1: 0
2: 1
3: 12
4: 204
Right 1188338655 X:28971809-28971831 GATGAGGGGGAGGTCATACACGG 0: 1
1: 0
2: 0
3: 9
4: 164
1188338650_1188338660 10 Left 1188338650 X:28971794-28971816 CCATCTGTATTTGGGGATGAGGG 0: 1
1: 0
2: 1
3: 12
4: 204
Right 1188338660 X:28971827-28971849 CACGGGGCTGCCAACATGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 126
1188338650_1188338658 6 Left 1188338650 X:28971794-28971816 CCATCTGTATTTGGGGATGAGGG 0: 1
1: 0
2: 1
3: 12
4: 204
Right 1188338658 X:28971823-28971845 CATACACGGGGCTGCCAACATGG 0: 1
1: 0
2: 0
3: 3
4: 69
1188338650_1188338656 -7 Left 1188338650 X:28971794-28971816 CCATCTGTATTTGGGGATGAGGG 0: 1
1: 0
2: 1
3: 12
4: 204
Right 1188338656 X:28971810-28971832 ATGAGGGGGAGGTCATACACGGG 0: 1
1: 0
2: 0
3: 7
4: 128
1188338650_1188338657 -6 Left 1188338650 X:28971794-28971816 CCATCTGTATTTGGGGATGAGGG 0: 1
1: 0
2: 1
3: 12
4: 204
Right 1188338657 X:28971811-28971833 TGAGGGGGAGGTCATACACGGGG 0: 1
1: 0
2: 0
3: 14
4: 129
1188338650_1188338659 7 Left 1188338650 X:28971794-28971816 CCATCTGTATTTGGGGATGAGGG 0: 1
1: 0
2: 1
3: 12
4: 204
Right 1188338659 X:28971824-28971846 ATACACGGGGCTGCCAACATGGG 0: 1
1: 0
2: 0
3: 0
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188338650 Original CRISPR CCCTCATCCCCAAATACAGA TGG (reversed) Intronic
905557353 1:38897712-38897734 CCCTCACCCCCACACACAAAAGG + Intronic
907681878 1:56571977-56571999 CCTTCCTCAGCAAATACAGAGGG + Intronic
909531286 1:76684514-76684536 CCATCATGCCCAACAACAGATGG - Intergenic
911335161 1:96573400-96573422 CCCTCATCCCCACAGCCAGCTGG + Intergenic
912655738 1:111485051-111485073 TCCCCATCCCTAAATAGAGAAGG - Intronic
912988448 1:114458603-114458625 CCCTCATCTCCAAATTCTCAAGG + Intronic
913284523 1:117214347-117214369 GCCTTATCACCAAATACAGGGGG + Intergenic
915793841 1:158705303-158705325 CCCACATACACACATACAGAGGG - Intergenic
916678298 1:167082662-167082684 ACCTGTTCCCCAAATGCAGATGG + Intronic
917173829 1:172209020-172209042 CCCCCACCCCCAAATTCATATGG + Intronic
918837022 1:189479621-189479643 CCCTCATGCCCTTATTCAGATGG + Intergenic
922847346 1:228697593-228697615 TCCTTGTCCCCAAATCCAGAGGG + Intergenic
923889376 1:238195087-238195109 ACCTCATCCCAAAATACAGATGG - Intergenic
1063218681 10:3946286-3946308 TTCTCATCCATAAATACAGAAGG - Intergenic
1063961574 10:11310264-11310286 CCCACAGCTCCAAATACACAGGG - Intronic
1064116212 10:12579515-12579537 GACTGACCCCCAAATACAGAAGG - Intronic
1065231736 10:23605597-23605619 CCCCCACCCCCAAAAATAGAAGG - Intergenic
1065710229 10:28508880-28508902 CCTTCACTCACAAATACAGAGGG - Intergenic
1066038622 10:31521466-31521488 TCCTCATCCAGAAATACACAGGG + Exonic
1066372655 10:34830255-34830277 CCCTCAACCCCAAGCACTGAGGG - Intergenic
1068903946 10:62301762-62301784 ACCTCCTCCCCATATACACATGG + Intergenic
1069111392 10:64451805-64451827 CCCTCCTCACTGAATACAGAAGG + Intergenic
1070388973 10:75952119-75952141 CCCTCAGCCCCAAGTACATGGGG + Intronic
1070782801 10:79147310-79147332 CTCTCAGCCCTAAATAGAGAGGG + Intronic
1072833005 10:98679154-98679176 CCCTCATTCTCAAAGACACATGG - Intronic
1074104535 10:110378712-110378734 CCATAATCCCCACATACTGAGGG + Intergenic
1075154744 10:119965773-119965795 ACCACATTCCCAAATATAGAAGG - Intergenic
1075383870 10:122040437-122040459 CCCACAGCCCCAAATCCTGAAGG + Intronic
1076323101 10:129598345-129598367 CTATCATCCCCTTATACAGATGG - Intronic
1077440772 11:2567714-2567736 CACTGATCCCCAAATCCAGCTGG - Intronic
1079269181 11:18966861-18966883 CCATCATGACCAAATACACAGGG + Intergenic
1082272448 11:50186200-50186222 CTCTGATCCCCAAATACTGGGGG - Intergenic
1083526516 11:63371345-63371367 CCCTGATCCCCAAACAGAAAAGG + Intronic
1083538609 11:63494813-63494835 CTTTCTTCCCAAAATACAGATGG + Intergenic
1084751101 11:71204912-71204934 CCCTCATCTCCATCTGCAGAGGG - Intronic
1085870753 11:80346825-80346847 GCCTCATGCCAAAAGACAGAGGG - Intergenic
1086130092 11:83392656-83392678 TCCTTTTCCCCATATACAGATGG + Intergenic
1088218479 11:107540358-107540380 TCTTCACCCCCAAATACAGATGG + Intronic
1089141190 11:116285789-116285811 TCCTCATACCCCAGTACAGAGGG - Intergenic
1089759117 11:120710139-120710161 CCTGGATCCACAAATACAGAAGG + Intronic
1089936562 11:122370330-122370352 CCCTCAGCCCCCAACACACATGG - Intergenic
1089986152 11:122815999-122816021 CCCTCATCTCTGAAGACAGAGGG - Intergenic
1091571286 12:1688877-1688899 CCCTGATCCCCACATCCATAAGG - Intronic
1091613154 12:2028950-2028972 TCCTCAGCGCCAAACACAGAAGG - Intronic
1092945979 12:13454366-13454388 CCCTCCTTCCCTAAGACAGAGGG + Intergenic
1093806705 12:23442047-23442069 ATATTATCCCCAAATACAGAAGG - Intergenic
1093870951 12:24290213-24290235 TCCTCATATCCAAATCCAGAAGG + Intergenic
1094673724 12:32597187-32597209 CCCTCATACAGCAATACAGAAGG + Intronic
1098525732 12:71484693-71484715 CTCACATCCCAAAATAGAGAAGG - Intronic
1098920928 12:76301644-76301666 CCCTCTCCTCCAAATTCAGATGG + Intergenic
1100226356 12:92560292-92560314 CCCTCACTCCAAAATAGAGATGG + Intergenic
1101026049 12:100608258-100608280 CCCCCATCCCCAGATCCAGGAGG - Intronic
1102666793 12:114581078-114581100 CCCTCACCCCCAAGCAAAGAAGG + Intergenic
1103040787 12:117693776-117693798 CCGTCATCCCCACTGACAGATGG + Intronic
1103917844 12:124385182-124385204 CCCTCCTCCACAAGCACAGAAGG - Intronic
1105565908 13:21547775-21547797 CCCCCACCCCCAAGTACACATGG - Intronic
1107120734 13:36792691-36792713 GCCTCATCGACAAATGCAGATGG - Intergenic
1107706652 13:43114484-43114506 CTCTCATACCAAAATAAAGAAGG + Intergenic
1110070537 13:71171478-71171500 CCATCATTACCAAATAAAGATGG + Intergenic
1110219409 13:73058252-73058274 CCCTCCTCCCCACACACGGATGG + Intronic
1114227529 14:20752726-20752748 CCCTCCTCCACATATACAAAGGG + Intergenic
1114772458 14:25443676-25443698 CACTCATACCCAAATAGAGAGGG - Intergenic
1115709597 14:36036389-36036411 CTCTCATCTGCTAATACAGATGG + Intergenic
1115715566 14:36099276-36099298 CCTCCCTCCCCAAATACGGAAGG + Intergenic
1115750023 14:36480005-36480027 CCTTCACCCCCAAATACACTTGG + Intronic
1115805596 14:37047510-37047532 CCCTGCTCCCCAAACCCAGATGG + Intronic
1117175473 14:53141895-53141917 CCCCCAACCCCAAATACAACAGG + Intronic
1117380387 14:55156292-55156314 CCCCCATCACCAAAAACAGAAGG + Intronic
1121467305 14:94124317-94124339 CCCTAAGCCCCAAACACACAGGG - Intergenic
1122236317 14:100332532-100332554 GCCTCATCCCCAAACACTCATGG + Intergenic
1125196060 15:37047355-37047377 CCTTCAGCCCTAAACACAGAAGG + Intronic
1129202369 15:74011179-74011201 CCCTCAGCCCCAAATTCAAGGGG + Intronic
1130100099 15:80886851-80886873 TCCTTATCCCCAAACACAGAAGG - Intronic
1130531780 15:84752561-84752583 GCCTCATCCCCAAACACTGGGGG - Intronic
1131564359 15:93472513-93472535 CTCTCTTCCCCATTTACAGAGGG - Intergenic
1134280200 16:12810325-12810347 ACCTGATCCCCAAATTCACAAGG + Intergenic
1135387485 16:22056184-22056206 GCCTAGTCCCCAAATAGAGAGGG - Intronic
1135903477 16:26488890-26488912 TCCTCCTCTCCAAATTCAGAGGG + Intergenic
1136059807 16:27718712-27718734 ACCACATCCCCAAATCCAGCGGG - Intronic
1137527257 16:49247118-49247140 CCCTCCTGCCCAACTTCAGATGG + Intergenic
1137952347 16:52795749-52795771 CACACATCCCCAAAAACAGAAGG + Intergenic
1138079308 16:54073544-54073566 TCCTAATCCCAAAATACACATGG - Intronic
1138439842 16:57027508-57027530 ACCTCCTCCCCAAATACAGTAGG + Intronic
1139706519 16:68744627-68744649 GCATCTTCCCCAAATTCAGAAGG + Intronic
1141036771 16:80633414-80633436 CCTGCATCTCCAAATTCAGAAGG + Intronic
1141313810 16:82940958-82940980 AACTCATCCCCAAATGGAGAAGG + Intronic
1142006945 16:87693885-87693907 TGCTCATCCCCAAATCCAAATGG + Intronic
1142885490 17:2909850-2909872 CCCCCAACCCCAACCACAGAAGG - Intronic
1143598891 17:7931445-7931467 CCCCCATCCCCAAATTCCCAAGG + Intronic
1144841167 17:18186882-18186904 GCATCATCCCCACTTACAGATGG - Intronic
1151597222 17:75085923-75085945 CTCTGATCCCCAAATACTCAGGG + Intergenic
1151854917 17:76714196-76714218 GCCTCATCCCCAAAGACCCAGGG + Exonic
1153831383 18:8926523-8926545 CACTCATCCCCAAATTCATATGG + Intergenic
1155259474 18:24027375-24027397 CCCTCTTCCCCAATTTCAAATGG + Intronic
1155602286 18:27563398-27563420 CCCTGAGACCCAAAGACAGAAGG - Intergenic
1156074237 18:33253817-33253839 CCATCCTCCCCAATTACATAAGG - Intronic
1156635773 18:39027638-39027660 CACCCATCCCCAACTACCGAAGG - Intergenic
1158350017 18:56555310-56555332 ACCTCATCTCTAAAAACAGAAGG - Intergenic
1158639326 18:59189706-59189728 CCCTCAAGCCCATTTACAGATGG - Intergenic
1160804632 19:986885-986907 CCCTCAACCCCACATAGAGCAGG + Intronic
1161069418 19:2252853-2252875 CCTTCATCCCCAAGGAAAGAAGG - Intronic
1161729934 19:5953359-5953381 ACCTCATCCTAAAATACACATGG + Intronic
1162361837 19:10225084-10225106 TCATCATCCCCACTTACAGACGG + Intronic
1162375075 19:10300035-10300057 CCCTCATCCCCAACAGCATAAGG + Intergenic
1162937126 19:13986872-13986894 CCCCCTTCCCCATAGACAGATGG + Intronic
1163500332 19:17672464-17672486 CCGTCAGTCCCAAATCCAGACGG + Exonic
1163768717 19:19178063-19178085 GTCTCACCCCCAAATACATATGG - Intronic
1166568409 19:43779078-43779100 CCCTCACCCCAATTTACAGATGG + Intronic
1168189326 19:54726432-54726454 CCCTTTACCCCAAATACAGTCGG - Intronic
1168206227 19:54852377-54852399 CCCTTGACCCCAAATACAGTTGG - Intronic
925599817 2:5596693-5596715 CACTCATCCTCAAATCCAGCTGG - Intergenic
926061184 2:9806175-9806197 CCCTCAGCCCCAATCACAGGAGG + Intergenic
931142785 2:59481983-59482005 CTCTCATCTCCAAATTCTGATGG - Intergenic
931869277 2:66441498-66441520 CCCTTACCCCCAAACACACAGGG + Intronic
932412304 2:71554652-71554674 TCCTCAGCCCCAAATCCAGTCGG - Intronic
932915432 2:75853284-75853306 CCCTCTTCCCCAATTACTTAGGG + Intergenic
934731804 2:96663538-96663560 CCCACATCCCCTAACATAGAAGG + Intergenic
935331778 2:101982643-101982665 TCCTCATCTACAAATGCAGATGG + Intergenic
936085728 2:109467704-109467726 CGCTCATCCTCAAATAGATATGG - Intronic
937318199 2:120945363-120945385 GCCTCATGCCCAGACACAGAAGG + Intronic
938110373 2:128560249-128560271 CCTTCATCCACACAGACAGATGG - Intergenic
938256445 2:129863283-129863305 GCCTCATCCTCAAACACAGTGGG - Intergenic
939642504 2:144657354-144657376 CCCTCCTCCCCCACCACAGAAGG + Intergenic
947935616 2:234001117-234001139 TCCTCATCTCCAAAGACACAGGG - Intronic
948655232 2:239472667-239472689 CCACCATCCCCAAATTCATATGG + Intergenic
1168826845 20:819724-819746 CCTTCACCCCCAAATCCAGTCGG - Intergenic
1170093653 20:12621048-12621070 CCCCCATCCCCAAATAAAAAGGG - Intergenic
1170280110 20:14636822-14636844 CCTTCTTCCCCAAATAGAGCAGG - Intronic
1174838696 20:53881404-53881426 CCCTCCTACCCAAATATACAAGG + Intergenic
1175656159 20:60772837-60772859 CCCTCATGCCCAGATAGAGCTGG - Intergenic
1178367101 21:31997208-31997230 CCCTCATCCCCAAATCTGTAGGG + Intronic
1178461875 21:32809721-32809743 AAATCATCCCCAAACACAGAGGG - Intronic
1180702857 22:17791121-17791143 CCCTCACCCCCAAATCTGGAAGG + Intronic
1181325037 22:22038457-22038479 CCCTGATCCCCAAAGGCACAGGG + Intergenic
1181960884 22:26621092-26621114 CCCTCATACGCCAATTCAGAGGG + Intergenic
1182008206 22:26979012-26979034 CCCTCATCCCCAAAAGCTGGAGG + Intergenic
1183904500 22:41030293-41030315 CCCTGGTGCCCCAATACAGATGG - Intergenic
1184444284 22:44538391-44538413 CTGTCATCCCCAATTACATATGG + Intergenic
1185206147 22:49540278-49540300 CCAACATCCTAAAATACAGACGG - Intronic
950661939 3:14472098-14472120 CACTCAGACCCAAATACAGCAGG - Intronic
951078139 3:18422504-18422526 ACCTCATAACCAAAAACAGATGG - Intronic
952798058 3:37260661-37260683 CCCTCTGCCTCAAAGACAGATGG - Intronic
952887718 3:38021838-38021860 CCCAGATCCCCAACAACAGATGG + Intronic
953792969 3:45962558-45962580 CTCTCACCCCCACATACAAAGGG + Intronic
955960111 3:64331836-64331858 ACCTCATCCCCAAGTGCGGAAGG + Intronic
957772086 3:84707524-84707546 CCCTCAGGCCCAAATTGAGACGG + Intergenic
959999048 3:112711722-112711744 CACTGATTCCCAAATATAGATGG - Intergenic
960193062 3:114730477-114730499 GCCTTATCTCCAAATACAGTTGG - Intronic
961042046 3:123684386-123684408 CCCTCATCCCCAGATATCAAGGG - Intronic
964212385 3:154242942-154242964 CCCACAGCCGCAAACACAGAGGG - Intronic
967843046 3:194022189-194022211 CCCTCATCCTCAAAGGCAGAGGG + Intergenic
971455548 4:26840690-26840712 CCCTGAGCCCCACATTCAGAAGG + Intergenic
972740968 4:41885686-41885708 CCCCCATCCCCAAATGCAGCAGG - Intergenic
973544212 4:51964271-51964293 CACTCACACCCAAATACAGGGGG - Intergenic
978929829 4:114296486-114296508 CCCACCTCCCCACAAACAGAGGG + Intergenic
981246660 4:142549028-142549050 CCAGCATTCCCAATTACAGATGG + Intronic
984396645 4:179210405-179210427 CCCACATCCCTAGAGACAGAAGG + Intergenic
985156941 4:186999075-186999097 CCCTCACCCCCAAGAACAAACGG - Intergenic
985744048 5:1636630-1636652 CCCCCATCTCCCCATACAGAAGG + Intergenic
989734411 5:44686764-44686786 CACTCATCTCCAAATCCACAGGG - Intergenic
995896856 5:117022983-117023005 CCCTGATCCTGAAATACATATGG - Intergenic
996694234 5:126376306-126376328 ACCTCATCCCAGAACACAGAAGG - Intronic
997336297 5:133111140-133111162 TCCTCATCCCCAAAAATGGAAGG - Intergenic
999110646 5:149117930-149117952 CCCTCTCCCCCAAATTCATATGG - Intergenic
1000497332 5:162001281-162001303 CCCTCCTCCCCTTACACAGATGG - Intergenic
1001743545 5:174072437-174072459 CCCTCAACACCAAATGCACATGG + Intronic
1002391507 5:178916219-178916241 CCCTCATCACCAAATCCAACAGG - Intronic
1004128625 6:12898293-12898315 CCTTCGTCTCCAAATACCGACGG + Intronic
1006656162 6:35595085-35595107 CTGTCATCCCCATTTACAGAGGG + Intronic
1007272768 6:40650861-40650883 GCCTCATCCCCAACTCCAGGAGG + Intergenic
1007755764 6:44098345-44098367 CCCTCATTCCCCCATACACATGG + Intergenic
1009927351 6:70135684-70135706 CCCCAATCCCCAAATCCAGGAGG - Intronic
1010659239 6:78549679-78549701 CCTTCACCCCCAAATAAACATGG + Intergenic
1011161516 6:84396174-84396196 CCCAAATCCCCAAATAAACAAGG - Intergenic
1016279766 6:142402469-142402491 ACCTCATCCCCATATTCACAAGG - Intronic
1017076122 6:150620459-150620481 CCCTCTTGCACAAATACTGAAGG - Intronic
1017937117 6:159015502-159015524 CCCTCGCCAACAAATACAGATGG + Intergenic
1017944372 6:159081751-159081773 TCCTGTTCCCCAAATACATATGG - Intergenic
1019636504 7:2078843-2078865 CCCACATCCCCAAGGACAAAGGG + Intronic
1021248284 7:18291794-18291816 CCCTCATCCTCAAAGTGAGAGGG - Intronic
1022521935 7:31014064-31014086 TGCTCATGCCCAAATACACAAGG + Intergenic
1023853066 7:44161089-44161111 CCCACATACCCAACTACAGGAGG + Intronic
1027861522 7:83588832-83588854 ACCTCATCCCCAAATCCCTAGGG + Intronic
1028903699 7:96129726-96129748 TTCTTATCTCCAAATACAGATGG + Intronic
1029661054 7:101962156-101962178 CCCTTCCCCCCAAATACAGGTGG + Intronic
1030127474 7:106168305-106168327 CCCTCTTCCACACAGACAGAGGG - Intergenic
1034309987 7:150079029-150079051 CCTTCATCCCCACATACACAGGG + Intergenic
1034796858 7:154021592-154021614 CCTTCAGCCCCACATACACAGGG - Intronic
1034860655 7:154592093-154592115 CCCTCAGTCCCAGCTACAGATGG + Intronic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1035344952 7:158191805-158191827 CCCTCATGCCCACAGGCAGATGG + Intronic
1036040461 8:5074155-5074177 CCATCAACCACAAATACACACGG - Intergenic
1036060205 8:5308657-5308679 CTCACTTCCCCACATACAGATGG - Intergenic
1038444474 8:27593799-27593821 CCCTCATCCCAAAGTCCAGGTGG + Intergenic
1039160593 8:34614373-34614395 CACAGATCCCCAAATTCAGAGGG - Intergenic
1040988690 8:53325447-53325469 TCCTCCTCTCCAAATTCAGAAGG - Intergenic
1041650536 8:60297927-60297949 CTATCAACCCCAAATACAGAAGG - Intergenic
1042858088 8:73287303-73287325 CCCCCATCACCAAATACTCAAGG + Intergenic
1043593664 8:81859305-81859327 ACCTCTTACCAAAATACAGAGGG - Intergenic
1048630487 8:136237297-136237319 CCCTGATCCCCAAAGAATGACGG - Intergenic
1050145148 9:2559774-2559796 CTCTCCTCCCCACAAACAGAAGG - Intergenic
1051010426 9:12406414-12406436 CCCGAATCCTCAAATGCAGAAGG + Intergenic
1053293009 9:36894436-36894458 TTCACATCCCCAAATCCAGAAGG - Intronic
1055878902 9:80974953-80974975 CTCTCATCCCCAAATGCTCAGGG + Intergenic
1059811496 9:117860470-117860492 TTCTCAGCCCAAAATACAGACGG + Intergenic
1059849112 9:118317250-118317272 CTCTCATCAACAAATACATATGG - Intergenic
1061745965 9:132740642-132740664 TCATCATCCCCAAATCCAAACGG - Intronic
1061793453 9:133070788-133070810 CTCTCATCCTCAAACACACATGG - Intronic
1061796062 9:133086587-133086609 CTCTCATCCTCAAACACACATGG - Intronic
1188338650 X:28971794-28971816 CCCTCATCCCCAAATACAGATGG - Intronic
1189624707 X:42884112-42884134 CCCTGAACCCAAAATACAGGTGG - Intergenic
1190145645 X:47889510-47889532 CCCTCAGCCCTGAAAACAGATGG - Intronic
1191714564 X:64185449-64185471 CCCCCACCCCCATATACAGCAGG + Exonic
1191716875 X:64199919-64199941 GCCCCAGCCCCAAATACACAGGG + Intronic
1192203284 X:69080797-69080819 CCCCCACCCCCAGCTACAGATGG - Intergenic
1192210774 X:69126452-69126474 GTATCATCTCCAAATACAGATGG + Intergenic
1192450906 X:71244281-71244303 CCCCCATCCCCAAGTACTTACGG + Exonic
1194359815 X:92935953-92935975 CTCTAATGCCCAACTACAGAAGG - Intergenic