ID: 1188340219

View in Genome Browser
Species Human (GRCh38)
Location X:28990930-28990952
Sequence TAGGGACAACAATTTAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188340215_1188340219 19 Left 1188340215 X:28990888-28990910 CCAATGAGATATGAAACTCATAG 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1188340219 X:28990930-28990952 TAGGGACAACAATTTAAATTTGG 0: 1
1: 0
2: 0
3: 16
4: 195
1188340214_1188340219 27 Left 1188340214 X:28990880-28990902 CCTCAATGCCAATGAGATATGAA 0: 1
1: 0
2: 1
3: 19
4: 167
Right 1188340219 X:28990930-28990952 TAGGGACAACAATTTAAATTTGG 0: 1
1: 0
2: 0
3: 16
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188340219 Original CRISPR TAGGGACAACAATTTAAATT TGG Intronic
900764744 1:4497173-4497195 AAGGGAAAACAATCTTAATTGGG - Intergenic
901146479 1:7068404-7068426 TACGGACATGAGTTTAAATTTGG + Intronic
904871559 1:33622287-33622309 CAGGGAAAACCATTTAAGTTTGG + Intronic
905945681 1:41899894-41899916 CAGGGACAATAATGTAGATTTGG - Intronic
907667177 1:56443617-56443639 GAGTGACAGCAATTTAAATCTGG + Intergenic
907739255 1:57148313-57148335 TAGGGAGCCCAATTTAGATTAGG + Intronic
908634739 1:66150477-66150499 GAGGTAAAACAATTTATATTTGG - Intronic
909326480 1:74357339-74357361 TAGGATGAACTATTTAAATTGGG - Intronic
910031151 1:82725541-82725563 TAGTGAAAACAATTCAAATTTGG + Intergenic
910464474 1:87482601-87482623 TAGTAACAAGAATTTAAAATAGG - Intergenic
911004909 1:93209722-93209744 TACAGATAACAATTTTAATTTGG + Intronic
911237626 1:95428614-95428636 TTGGGACAAAAAGTTGAATTTGG + Intergenic
920649091 1:207823485-207823507 TAGGGAAAAGAAATTAAAGTGGG + Intergenic
921541949 1:216427028-216427050 AAGAGAAAACAATATAAATTGGG - Intergenic
922206634 1:223453479-223453501 TCAGGACAAAAATTTAACTTAGG + Intergenic
923280507 1:232438799-232438821 TAGGGACAACAGGTTGAATTAGG + Intronic
923522488 1:234746512-234746534 CAAAGACAACAATTTATATTTGG + Intergenic
924522614 1:244818238-244818260 TAGGGTCAAACATTAAAATTGGG + Intergenic
1065979095 10:30873075-30873097 TAAGGCCAACTATTTAGATTTGG - Intronic
1068229148 10:54148648-54148670 TGAGGACATCAATTTAATTTTGG - Intronic
1068353226 10:55877625-55877647 TCAGGACAATAATTTATATTTGG + Intergenic
1068417880 10:56748466-56748488 TATGGACAATAATTTTAATGTGG - Intergenic
1069412160 10:68164915-68164937 CAAGGACCACAATTTAAAATTGG - Intronic
1069848134 10:71386956-71386978 GAGGGATTAAAATTTAAATTGGG - Intergenic
1071013441 10:80966635-80966657 GAGGGACAAAAATTAAAGTTTGG + Intergenic
1072678525 10:97487804-97487826 AAAGGGCAACAATTTAAAATGGG + Intronic
1073719497 10:106150988-106151010 TAGAAAAAACAATCTAAATTTGG + Intergenic
1078620746 11:12905511-12905533 GAGGGAAGGCAATTTAAATTCGG + Intronic
1078878709 11:15425819-15425841 TAGGCAAAACAAATCAAATTAGG + Intergenic
1079217812 11:18529651-18529673 TAAGGAAAACAATGTAAAATGGG + Exonic
1079669894 11:23155425-23155447 TTAGAACAACAGTTTAAATTAGG + Intergenic
1079816458 11:25066005-25066027 GAGGAACAACAATGAAAATTTGG + Intronic
1084771818 11:71348205-71348227 TTGGGAGAAGAATTTAAAGTGGG - Intergenic
1085858146 11:80199015-80199037 GAGGCACAACAATTGAAATTAGG + Intergenic
1086202394 11:84219212-84219234 TAGGGACAAAAAGTTCATTTAGG - Intronic
1086328227 11:85726466-85726488 TAGGGACATAACTTTAAAGTTGG + Intronic
1087258846 11:95987714-95987736 TAGCAACAAGAATTTAAATTTGG - Intronic
1087907060 11:103710509-103710531 TAGGGACAAGAACTGAAAGTAGG - Intergenic
1088189788 11:107215742-107215764 TATGAACAACTGTTTAAATTGGG - Intergenic
1095592791 12:43922973-43922995 TAGGGAAATCTATTTAATTTTGG - Intronic
1097559078 12:61179344-61179366 TATTGACAATAATTTCAATTAGG + Intergenic
1099150767 12:79110081-79110103 TATGGAAAACAACTGAAATTAGG - Intronic
1100905736 12:99296558-99296580 GAGGGATATAAATTTAAATTGGG - Intronic
1101542025 12:105673905-105673927 TAGGAAAAAAAATTTAATTTAGG - Intergenic
1102964858 12:117118209-117118231 TAGGGACCACGATTTAACCTTGG + Intergenic
1104194876 12:126526410-126526432 TAGGCACAACCTTTTAATTTGGG - Intergenic
1105794709 13:23839728-23839750 TAGAAAAAAAAATTTAAATTTGG + Intronic
1105875023 13:24543931-24543953 TAGGAACTATAATTTAAAATTGG + Intergenic
1109099021 13:58155927-58155949 TGGGGACAAGAATTTATATGAGG - Intergenic
1110564063 13:76940425-76940447 TAGGGACAACCATTTAGAAAGGG + Intergenic
1119201652 14:72757142-72757164 TAGGAACAGCAATTGAAATGGGG + Intronic
1121212635 14:92220341-92220363 AAAGGCCTACAATTTAAATTCGG + Intergenic
1122523326 14:102362558-102362580 TAGTGACAATAATTACAATTTGG + Intronic
1125449357 15:39791943-39791965 TAGTGATAACATTTTGAATTCGG - Intergenic
1125862430 15:43011638-43011660 TAGTGAGAACAAAGTAAATTAGG + Intronic
1126426577 15:48533744-48533766 TAGAGACATGAATTTAAATTTGG - Intronic
1127270736 15:57399383-57399405 TATGGACTACAATTAGAATTTGG - Intronic
1128121207 15:65148326-65148348 TAGTCACAACAACTTACATTTGG - Exonic
1128490727 15:68140320-68140342 TAGAGCCAACGATTTAAATTAGG + Intronic
1129854112 15:78811747-78811769 TAGGGACAACACATTAATTCTGG - Intronic
1130192172 15:81747897-81747919 TAGGGCCATCAAGTTAAATCTGG - Intergenic
1138081237 16:54093237-54093259 TAGAAAGAACAGTTTAAATTAGG + Intronic
1138172227 16:54863229-54863251 AAAGGAGAACAATTTAAATGTGG + Intergenic
1144366934 17:14553596-14553618 TAGGGACAATAATTTTGGTTGGG + Intergenic
1150194462 17:63281154-63281176 TAGGGACCAAAACTTATATTTGG + Intronic
1151144192 17:72024611-72024633 TAGGAATCACAGTTTAAATTGGG + Intergenic
1153515860 18:5900683-5900705 AAGAGAGAACAATTTAGATTGGG + Intergenic
1155912121 18:31516056-31516078 TATAGACAATAATTTCAATTTGG + Intronic
1155947006 18:31865100-31865122 TAGGTCCAACAATTTAATTTAGG + Intronic
1157363951 18:47046231-47046253 AAGGGACAATGATTTTAATTAGG - Intronic
1158475295 18:57774256-57774278 TATGGACAACAATGTAAAGAAGG - Intronic
1159274244 18:66194473-66194495 AAGAGACAAAAATGTAAATTGGG + Intergenic
1160198185 18:76774583-76774605 TAAGTACAACAATTTAAAGAAGG - Intergenic
1160360036 18:78267432-78267454 TAGTGACATCAATTGACATTTGG + Intergenic
925314807 2:2913304-2913326 TAAGAATATCAATTTAAATTTGG - Intergenic
926672076 2:15586017-15586039 TAGGGAACACAAGTCAAATTAGG - Intergenic
927005621 2:18844990-18845012 AATGGAGAACAATTTAAAATAGG - Intergenic
929826661 2:45314088-45314110 CAGATACATCAATTTAAATTTGG + Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
931919795 2:67002181-67002203 TAGGAACACCAATTTCAAATGGG - Intergenic
931972388 2:67603285-67603307 TTGGCAGAACAAGTTAAATTTGG - Intergenic
933489018 2:82961490-82961512 TAGGAACAACAACTTATTTTTGG - Intergenic
936907856 2:117557776-117557798 TAGGCACAAAAATTTAAAGTAGG + Intergenic
937625167 2:124035713-124035735 TTGGGTCATCAATTTTAATTGGG - Intronic
941382112 2:164806391-164806413 TAGTAACAGCAATTTAATTTTGG + Intronic
941735913 2:168977428-168977450 TCAGGACAACAATTGAAAGTTGG - Intronic
941939115 2:171014499-171014521 TAGGGACTACTATTTTAAATAGG + Intronic
942345756 2:175001120-175001142 CATGGACAAAAATTTAAATAAGG + Intronic
942670756 2:178374435-178374457 TAGGGACATGAATTTAAACTTGG + Intronic
943144924 2:184031224-184031246 TAGAGACAAGAGTTTAAAGTGGG - Intergenic
943630585 2:190247182-190247204 TAAGAAAAACAAGTTAAATTAGG - Intronic
944367621 2:198942663-198942685 TAGGGACAAAAATTCAAATCTGG + Intergenic
946143984 2:217714820-217714842 TAGAGACTATAATATAAATTCGG + Intronic
946559864 2:220900466-220900488 GAGGGAAAACAGTTTCAATTAGG + Intergenic
1168990297 20:2089489-2089511 GAGGGCCAGCAATCTAAATTAGG + Intergenic
1169314732 20:4580657-4580679 TAAAGACAACTTTTTAAATTTGG + Intergenic
1171118346 20:22546741-22546763 CAGGGACAAATGTTTAAATTGGG - Intergenic
1171726169 20:28623063-28623085 TAGGGACAACATCTAAAAGTTGG - Intergenic
1178292841 21:31384301-31384323 CAGGGAAAACATTTTTAATTTGG - Intronic
1179319742 21:40278898-40278920 TATGGGCCACAATTCAAATTTGG - Intronic
1181206579 22:21257391-21257413 TAGGGAAAAGAACTTAGATTAGG + Intergenic
1183027976 22:35080470-35080492 CAGGGACAACAATTTGGTTTTGG - Intronic
952364846 3:32665111-32665133 TAGAGAAAACAATTTAAAAGGGG - Intergenic
953400057 3:42605940-42605962 TAAGGAGCACAATTTTAATTAGG + Intronic
954338246 3:49932991-49933013 TAGGTAGAAAACTTTAAATTTGG - Intergenic
956329426 3:68089179-68089201 CAGGGCTAGCAATTTAAATTTGG + Intronic
957269080 3:78005473-78005495 TAGGAACTACAGTTTAAACTAGG - Intergenic
957560655 3:81816457-81816479 TAGGAAAAGCCATTTAAATTAGG - Intergenic
958606922 3:96370911-96370933 AAGGGAGAAAAATTTAAAATGGG + Intergenic
958990673 3:100840502-100840524 TTGGGATAAAAATTAAAATTTGG + Intronic
959267697 3:104164721-104164743 TTGGGCCAACAAATAAAATTTGG - Intergenic
959315490 3:104800815-104800837 TATTAACAAAAATTTAAATTAGG + Intergenic
963949486 3:151183105-151183127 TGGGGAAAAAAATGTAAATTGGG - Intronic
966622851 3:181984499-181984521 TAGGGTCAATAGTTTGAATTTGG + Intergenic
967358007 3:188595246-188595268 TTGGGACACAATTTTAAATTAGG - Intronic
970336146 4:15045495-15045517 TAGGGTCAATAATTTTGATTTGG + Intronic
971355719 4:25893674-25893696 GAGGGTCAGCAATTTATATTGGG - Intronic
974412250 4:61556565-61556587 TATGGACAACAATTTGCAGTAGG + Intronic
975874034 4:78814414-78814436 TAGGGACTACAATTCAAGATGGG - Intronic
976526148 4:86091617-86091639 TAGAGACCAGAATTTAATTTAGG - Intronic
976936886 4:90647064-90647086 TAGGGACAGAAATTCAATTTGGG - Intronic
978057173 4:104284694-104284716 TAGGGATAAAAATTTATCTTTGG + Intergenic
980111266 4:128639735-128639757 AAGAAACAACAATTTAAATGTGG - Intergenic
980800281 4:137739158-137739180 TTTGTATAACAATTTAAATTTGG - Intergenic
981900561 4:149857035-149857057 TAGGGATATCAAGTTAAAATAGG + Intergenic
982229390 4:153194708-153194730 TTGGGAAAACAGTGTAAATTTGG - Intronic
983361759 4:166734128-166734150 TAGGGAGCAGAATTTAAATTAGG - Exonic
983852394 4:172597688-172597710 TATTGACAACAAATTAAACTTGG - Intronic
987197579 5:15542822-15542844 TAGGGACATCAATATAAAACAGG - Intronic
988176723 5:27736391-27736413 TTGGGTCAACAATTTAGACTGGG + Intergenic
989406498 5:41067098-41067120 GAGAGACAACAATGTAAGTTTGG - Exonic
989744146 5:44808091-44808113 TAGGGACCAGAATATTAATTTGG - Intergenic
992602110 5:78412455-78412477 TTGGGAGAATTATTTAAATTGGG - Intronic
994431395 5:99666856-99666878 GAGGGACAATTATTTAAATAAGG + Intergenic
995827162 5:116313628-116313650 GAGGGAAAAAAATTAAAATTTGG - Intronic
999514470 5:152287114-152287136 TAGGTACAAAAATTAAAATTAGG - Intergenic
1000763447 5:165255338-165255360 TGAGGACAACACCTTAAATTTGG + Intergenic
1003575743 6:7292936-7292958 TAGAGAAAACAATTTAAAAATGG + Intronic
1005257843 6:24023365-24023387 CAGGGAAAAGACTTTAAATTGGG + Intergenic
1005437126 6:25826161-25826183 AAGGGAAAGCATTTTAAATTAGG - Intronic
1005467406 6:26128589-26128611 TGGGGAGGACTATTTAAATTGGG + Intronic
1009545795 6:65018584-65018606 TTAGGACAACAATATAATTTTGG + Intronic
1009789976 6:68389666-68389688 TAGAGAAAGCAATTTAAATAGGG + Intergenic
1011405708 6:87013355-87013377 TATGAAAAACAATTTAAATATGG + Intronic
1011643392 6:89434831-89434853 TAGGGATACAAATTAAAATTGGG + Intronic
1013987475 6:116213045-116213067 TAGAGATAATAATTAAAATTGGG + Intronic
1014419139 6:121219079-121219101 TTGGCAGAACAATTTAAGTTAGG + Intronic
1016300498 6:142625203-142625225 TAGTGCCAACATTTTAAATTTGG + Intergenic
1017206634 6:151809281-151809303 TAGGGAAAAAAATTAAAATGAGG - Intronic
1017294905 6:152782400-152782422 CTGAGACCACAATTTAAATTGGG + Intergenic
1021308813 7:19066052-19066074 TAAGGTCAACAATTGATATTTGG + Intronic
1021653014 7:22849975-22849997 GACGGCCAAAAATTTAAATTGGG + Intergenic
1023255959 7:38312458-38312480 AAGTGACAAGAAATTAAATTAGG + Intergenic
1023261861 7:38366546-38366568 TAGGAACAAAAATATAAATATGG + Intergenic
1023547418 7:41333078-41333100 TAGGGAAAACATTCTAAAATAGG + Intergenic
1023554733 7:41409485-41409507 TAGGAAGACCCATTTAAATTGGG - Intergenic
1023597367 7:41845325-41845347 TAGGTAAAACAAGTTAAATGAGG - Intergenic
1027610979 7:80360349-80360371 TGGGGACAAATATCTAAATTAGG - Intergenic
1028003515 7:85532059-85532081 TAGAGAAAACTATTTTAATTGGG - Intergenic
1028638278 7:93015534-93015556 AAGGGAAAACAATTTAAATGGGG + Intergenic
1029792193 7:102855788-102855810 TTTGGACCACAATTTAAAATGGG + Intronic
1029944277 7:104515340-104515362 AAGTGACAACAAATGAAATTTGG - Intronic
1030438045 7:109551365-109551387 TAAGACCAACAATTTAATTTAGG + Intergenic
1030863469 7:114667993-114668015 TAGGGACAAAGATGAAAATTGGG + Intronic
1030894120 7:115036160-115036182 TAGGGACATCATAATAAATTTGG + Intergenic
1032976455 7:137229637-137229659 TATGGACAACAATTTAGCCTGGG - Intronic
1034311036 7:150088189-150088211 AAGGGAAAACAAGATAAATTGGG - Intergenic
1034795816 7:154012448-154012470 AAGGGAAAACAAGATAAATTGGG + Intronic
1036628159 8:10489702-10489724 TAGTGTCAACAATTTAAATATGG + Intergenic
1037040985 8:14233043-14233065 TTGGGACTAGAATTTAAATGAGG + Intronic
1037506348 8:19533432-19533454 TAGGGAAATTAAATTAAATTAGG - Intronic
1038902568 8:31860332-31860354 TAGTAACAACAATTTATAATAGG + Intronic
1039124143 8:34181994-34182016 TAGGGAGAGGAATATAAATTGGG - Intergenic
1039331106 8:36537593-36537615 GAGGGACAATAATGTAAATCAGG - Intergenic
1039480153 8:37867172-37867194 AAGGGACAGCAATGAAAATTGGG - Intronic
1041308002 8:56483509-56483531 TAAGGACAACATTTGTAATTAGG + Intergenic
1042203455 8:66304272-66304294 TAGGGAAATCAATTTCATTTTGG - Intergenic
1042481982 8:69314452-69314474 GAGGGTCAAAAATTTAGATTTGG - Intergenic
1042572250 8:70178273-70178295 AAGGGCCTACAATTTAAATTGGG + Intronic
1043675300 8:82944228-82944250 TAGGTAATACAATTTAAATCAGG - Intergenic
1044645063 8:94431889-94431911 TAAGGTCAACAATTAAACTTAGG + Intronic
1046107540 8:109683729-109683751 TGGGAACTACAATTTAAGTTAGG - Intronic
1046563602 8:115870111-115870133 TGGGGACATCATTTGAAATTTGG - Intergenic
1047975901 8:130130451-130130473 TAGAGAAAATAATTCAAATTTGG + Intronic
1051283400 9:15467288-15467310 TAGGCACAAAAATATCAATTAGG - Intronic
1052657732 9:31384951-31384973 TAGAGACAACAATATAACTGTGG + Intergenic
1055004774 9:71493084-71493106 TAGGGAAAACAATGTAGAGTGGG - Intergenic
1055134833 9:72816578-72816600 TAGTGACAACAAAATAAACTCGG - Intronic
1055918095 9:81427567-81427589 TAAGGACAACATATTGAATTGGG + Intergenic
1056525070 9:87435545-87435567 TAGGGTGAACAATTTAGAGTTGG - Intergenic
1058497147 9:105571181-105571203 CAGGGACATCAGTTAAAATTAGG + Intronic
1058993984 9:110281570-110281592 TCTGGAAAACAATTTAAAGTTGG - Intergenic
1186364995 X:8882488-8882510 TAGCAACAACAGTTTGAATTTGG - Intergenic
1186821795 X:13296404-13296426 TTGGGGAAACAATTTAAATACGG - Intergenic
1187785610 X:22882387-22882409 TAAGGACAACATTTAACATTTGG - Intergenic
1188340219 X:28990930-28990952 TAGGGACAACAATTTAAATTTGG + Intronic
1188726652 X:33592391-33592413 TAAGTACAAAAACTTAAATTTGG - Intergenic
1189131779 X:38506434-38506456 TAGTGTCAACATTTTAAATGAGG + Intronic
1189179298 X:38988238-38988260 TAGCCACAGCAATTTAGATTTGG + Intergenic
1190370632 X:49737275-49737297 TAGGGAGAAAAATGGAAATTTGG - Intergenic
1190956322 X:55198120-55198142 TAGGGAGACCAATTTTATTTAGG + Intronic
1192072091 X:67951767-67951789 TGGGGATAAAAATTTCAATTCGG + Intergenic
1192799306 X:74450600-74450622 TAGGGAAAAGAATATAACTTGGG + Intronic
1193882753 X:86944661-86944683 TAGTTAATACAATTTAAATTGGG + Intergenic
1194386612 X:93263289-93263311 CAGGGACAACAGTTTGAATCAGG - Intergenic
1194647699 X:96478269-96478291 TGGAGACAAAAATATAAATTTGG + Intergenic
1196362789 X:114885489-114885511 TAAAGCCAAAAATTTAAATTTGG - Intronic
1196383849 X:115125847-115125869 TTTAGAAAACAATTTAAATTAGG - Intronic
1199192559 X:144987997-144988019 GAGGGATATCAATTTAAAATTGG - Intergenic
1199465451 X:148130608-148130630 TATGGAAAACAAAATAAATTCGG + Intergenic
1202300091 Y:23404006-23404028 TATGGAGAAAAATTAAAATTGGG - Intergenic
1202570719 Y:26266592-26266614 TATGGAGAAAAATTAAAATTGGG + Intergenic