ID: 1188340410

View in Genome Browser
Species Human (GRCh38)
Location X:28993963-28993985
Sequence CCAGTGATGAAAAGAGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188340410_1188340412 0 Left 1188340410 X:28993963-28993985 CCAGGTACTCTTTTCATCACTGG 0: 1
1: 0
2: 1
3: 15
4: 209
Right 1188340412 X:28993986-28994008 AAATATAACACTGAACAAATAGG 0: 1
1: 0
2: 6
3: 42
4: 610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188340410 Original CRISPR CCAGTGATGAAAAGAGTACC TGG (reversed) Intronic
900025185 1:265948-265970 CCAGTGTAGAGCAGAGTACCAGG - Intergenic
900028785 1:355330-355352 CCAGTGTAGAGCAGAGTACCAGG - Intergenic
902683999 1:18063940-18063962 CCAGTGGCTAGAAGAGTACCTGG - Intergenic
902747557 1:18483515-18483537 CCACTGCAGAAAAGAGGACCAGG + Exonic
903359926 1:22770641-22770663 AAAGTGATTAAAAGAGTACCTGG + Intronic
904409845 1:30318924-30318946 CCAGAGATGAAAGGATTTCCTGG + Intergenic
905270912 1:36786869-36786891 CCCGTGAGGAAAAGAGGACAGGG + Intergenic
905370634 1:37480912-37480934 TAAGTGCTGAGAAGAGTACCTGG + Intronic
905898974 1:41568079-41568101 CCAGTGCTGAGAATAGTGCCTGG - Intronic
907314650 1:53560612-53560634 CCAGTGATGCCAACAGGACCTGG - Intronic
908772280 1:67607914-67607936 CCAGTGCCCAGAAGAGTACCTGG - Intergenic
908969416 1:69809337-69809359 CCAGAGGTAAAAAGAGTAGCTGG + Intronic
910599417 1:89014868-89014890 CCAATGATCATAAGAGGACCTGG - Intronic
911014740 1:93320312-93320334 CAAGTGATAAAAAGAGATCCGGG - Intergenic
911064878 1:93779331-93779353 CCACTGCTGAAAATAGTGCCTGG - Intronic
911143581 1:94531619-94531641 CCAGTGAAGAAAAGAGTCAGGGG - Intronic
911528118 1:99010393-99010415 CCAGTGATGGGAAGAAAACCCGG - Intergenic
913345277 1:117803065-117803087 CCAGTGCAGAAAGGAGTAGCTGG + Intergenic
913599225 1:120406852-120406874 CCAGTAATGACAAGATTGCCAGG - Intergenic
914088152 1:144472768-144472790 CCAGTAATGACAAGATTGCCAGG + Intergenic
914310459 1:146461442-146461464 CCAGTAATGACAAGATTGCCAGG - Intergenic
914314722 1:146499312-146499334 CCAGTAATGACAAGATTGCCAGG + Intergenic
914499631 1:148234076-148234098 CCAGTAATGACAAGATTGCCAGG - Intergenic
914591650 1:149111700-149111722 CCAGTAATGACAAGATTGCCAGG + Intergenic
915040959 1:152967943-152967965 CTAGCGGGGAAAAGAGTACCTGG + Intergenic
917257517 1:173131855-173131877 CCAGAGATACAAAGAGGACCTGG - Intergenic
917835860 1:178941267-178941289 CCAGTTCTGAAAATAGCACCAGG + Intergenic
920220112 1:204390863-204390885 CCAGTGCTGTAAAGAGAACCTGG - Intergenic
920693388 1:208163825-208163847 CCAGTGCTGAACACAGTGCCTGG + Intronic
920884400 1:209912511-209912533 CAACTGGTGAAGAGAGTACCAGG - Intergenic
922046994 1:221955293-221955315 CCAGAGGTGAAAAGAGGAGCTGG + Intergenic
1065490832 10:26280047-26280069 CCAGTGATGGCCAGAGCACCTGG - Intronic
1066277538 10:33883756-33883778 CCATTCATGAAAAGAGGACTCGG - Intergenic
1070411437 10:76145268-76145290 CCAGAGGTGAAAAGAGGAGCTGG - Intronic
1070755352 10:78988703-78988725 CCAGTCATGAAAAGAGCAAAGGG + Intergenic
1071467422 10:85954193-85954215 CCATTAATGAAGATAGTACCTGG + Intronic
1074431239 10:113396587-113396609 TCAGTGGTGGAAAGAGTACCAGG + Intergenic
1074505735 10:114068801-114068823 ACAGTGATGAAAAGAAAACAAGG + Intergenic
1076409665 10:130236950-130236972 GCAGTGAGGGAAAGAGGACCCGG + Intergenic
1077445021 11:2586836-2586858 CCAGTGATGACAAGGCCACCAGG + Intronic
1078973094 11:16437683-16437705 CAAGTGCTGAGAAGAGTGCCTGG - Intronic
1080965297 11:37207655-37207677 CCAGAGATAAAAAGAGGAGCTGG - Intergenic
1081112920 11:39158936-39158958 CCAGAAATGAAAAGAGGATCTGG - Intergenic
1081633573 11:44705575-44705597 ACTGTGATGAAAAGAGAAGCGGG - Intergenic
1087727545 11:101739573-101739595 CCAGTGCTTTAAAAAGTACCTGG - Intronic
1088087417 11:105997600-105997622 CAAGCGCTGAAAAGAGTGCCTGG - Intronic
1088562977 11:111134592-111134614 CCAGTACTTAGAAGAGTACCTGG - Intergenic
1089777022 11:120844955-120844977 CCAGTGAAGGAAACAGTCCCAGG - Intronic
1092030532 12:5279929-5279951 CCATGGATGAAAAGAAGACCAGG + Intergenic
1093806352 12:23437831-23437853 CCAGAGATAAAAAGAGGAGCTGG + Intergenic
1098130776 12:67347725-67347747 AGAGTGAGGAAAAGAGTACTAGG + Intergenic
1100148273 12:91704053-91704075 GCAGTGATGAGAAGAGCAACAGG - Intergenic
1100896595 12:99189256-99189278 CCAGTGGTGCAAAGAGGAGCTGG + Intronic
1101760622 12:107655774-107655796 TCAGTCATGAAAAGAGGCCCTGG + Intronic
1101811054 12:108108110-108108132 CCAGTGGTGAATATAGAACCCGG - Intergenic
1103105436 12:118220289-118220311 TCAGTGCTGAGAACAGTACCTGG + Intronic
1106088043 13:26560539-26560561 CTAGTGATTAAAATAGTACCTGG - Intronic
1106919576 13:34549054-34549076 CCAGTGATGAGCAGAGCCCCGGG - Intergenic
1107819678 13:44275109-44275131 CCACTTATGAAAACAGTACCGGG + Intergenic
1107872123 13:44757078-44757100 CCAGAGCTGAAAACAGTGCCTGG - Intergenic
1112886960 13:104185617-104185639 CCAGTGATACAAAGAGGAGCTGG - Intergenic
1115358518 14:32475576-32475598 CCAGTGCTGCAAAGAGAAGCTGG - Intronic
1115528258 14:34302573-34302595 CCAGTGGTGACAAGCGTCCCAGG - Intronic
1115716796 14:36114460-36114482 TCAGTGAAGAAAAGAATATCTGG + Intergenic
1117323063 14:54642632-54642654 TCAGTGATGAACACAGTACCAGG - Intronic
1121417007 14:93786708-93786730 GCAGTGATAAACAGAGTACCTGG + Intronic
1121885600 14:97539934-97539956 CAAGTGATTAGAAGAGTGCCTGG + Intergenic
1125731933 15:41897410-41897432 CAAGTGTTCAAAAGAGAACCAGG + Exonic
1126173769 15:45716501-45716523 CCAGGGAGGAAAGGAGAACCAGG - Intergenic
1126678148 15:51179583-51179605 TCAGTGATAAAAAGAGAACAGGG - Intergenic
1129106041 15:73307977-73307999 CCAGTGAAGAAAACAGCATCTGG + Intergenic
1134220343 16:12348622-12348644 CCAGTGAAGAGCAGAGGACCTGG - Intronic
1137774236 16:51042222-51042244 CCAGTGACTGAAAGAGTGCCTGG - Intergenic
1137885111 16:52094820-52094842 CCAATGATTAAAAGATGACCAGG - Intergenic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1139677238 16:68532241-68532263 CCAGTGGAGGAAAGAGTTCCAGG + Intronic
1140444798 16:75016959-75016981 ACAGTGAAGTACAGAGTACCAGG + Intronic
1141344042 16:83229021-83229043 CTTGGGATGAAAAGAGTAGCAGG + Intronic
1144576459 17:16432770-16432792 GCAATGATGATAAGAGTAGCTGG - Intronic
1146927303 17:36753870-36753892 CCAGTGCTTAGAACAGTACCTGG - Intergenic
1150549422 17:66195360-66195382 GCAATGAAGAAAAGAGAACCAGG - Intergenic
1151012823 17:70520658-70520680 ACAGTAATGACAAGAGCACCTGG - Intergenic
1152950973 17:83231227-83231249 CCAGTGTAGAGCAGAGTACCAGG + Intergenic
1153968426 18:10202948-10202970 CCAGTGATGAAAAGAAAGCCAGG + Intergenic
1158273789 18:55744801-55744823 CCAATGATTATAAGAATACCAGG - Intergenic
1161616125 19:5271264-5271286 ACAGTGATGAACACAGTAACGGG + Intronic
1164423599 19:28119636-28119658 CCAGTGATGCCAAGAGACCCTGG + Intergenic
1166167267 19:41000341-41000363 ACAGTGCTGAACATAGTACCTGG + Intronic
1167128596 19:47569303-47569325 CAAGTGATTACAAGAGTACCTGG - Intergenic
925978576 2:9158270-9158292 CCAGTGAAGACAAGTGAACCTGG - Intergenic
926783880 2:16500872-16500894 CCAGTGCTGAAAACAGTGACTGG + Intergenic
927636057 2:24817850-24817872 CCAGTACTGAAGACAGTACCAGG + Intronic
928614419 2:33022465-33022487 TAAGTGTTTAAAAGAGTACCTGG - Intronic
928919724 2:36513867-36513889 ACAGTGCTGAAAAGTGTTCCAGG - Intronic
930274326 2:49294064-49294086 GAGGTGATGAAAAGAGTAACAGG - Intergenic
930424303 2:51193988-51194010 CCAGTGAGGAAAAGTGGATCTGG + Intergenic
933271282 2:80235699-80235721 CCAGTGAAGAATCAAGTACCTGG + Intronic
933512906 2:83263623-83263645 CTGGTACTGAAAAGAGTACCAGG + Intergenic
937392536 2:121502899-121502921 GCAGTGATGATGAGAGTTCCTGG + Intronic
938750864 2:134328650-134328672 CCAGTCCTGAAAGCAGTACCTGG - Intronic
938921799 2:136002011-136002033 CCAGTGTTCAGAAGAGTGCCTGG + Intergenic
940131310 2:150386620-150386642 CCAGTGATTAAAATAGTAGGGGG - Intergenic
940748829 2:157600293-157600315 TCAGTGATGAAAGGAGGACATGG + Intronic
941095958 2:161239260-161239282 CCAGGGGTGAAAAGAGTGACAGG + Intergenic
942917078 2:181323657-181323679 TGAGTGATGAAAAGAGTAGTTGG + Intergenic
945118017 2:206428369-206428391 CCAGAGATGGAAACAGTACAGGG + Intergenic
945903383 2:215563587-215563609 TCACTTATGCAAAGAGTACCAGG + Intergenic
947197915 2:227587144-227587166 CCAGTGATGGAAAGAGAACCAGG + Intergenic
1170333590 20:15243375-15243397 CAAGTGATGAAAAGGGTAATAGG + Intronic
1172329073 20:34062075-34062097 CCAGAGATGAATAAAGTCCCTGG - Intronic
1172329084 20:34062140-34062162 CCAGAGATGAATAAAGTCCCTGG - Intronic
1174819030 20:53711557-53711579 CCAGTGACTAAAACAGTGCCTGG + Intergenic
1175181265 20:57149218-57149240 CCTGTGGTGAAAACAGGACCTGG + Intergenic
1175441446 20:58995197-58995219 CAAGTGATGAATAAAGTATCTGG - Exonic
1176455197 21:6902008-6902030 CCAGTCATGCAAGGAGTTCCAGG + Intergenic
1176833369 21:13767056-13767078 CCAGTCATGCAAGGAGTTCCAGG + Intergenic
1178699741 21:34822985-34823007 CCAGTGATATAAAGAGGAACTGG + Intronic
1178722270 21:35020583-35020605 ACAGTGACTAAGAGAGTACCTGG - Intronic
1180394105 22:12313704-12313726 TCAGTGAAGAAAAAAGTACAGGG - Intergenic
1180405641 22:12551046-12551068 TCAGTGAAGAAAAAAGTACAGGG + Intergenic
1181363331 22:22355372-22355394 GCAGTGACAAAAAGAGGACCTGG + Intergenic
1181782091 22:25200916-25200938 CCAGTGAACAAAAGAGTTCCTGG + Intronic
1183566965 22:38622425-38622447 CCAGTGCTGAGCAGAGTGCCTGG + Intronic
1183938370 22:41277759-41277781 CAAGGGATGAAAAGACTTCCTGG + Intronic
1185085553 22:48738920-48738942 CCAGTGGTGAAAGGAGGAGCCGG - Intronic
949890156 3:8727663-8727685 ACAGTGATGAACAGAGGGCCTGG - Intronic
950536737 3:13583245-13583267 CCAGTGATTAACACAGTGCCTGG - Intronic
950580373 3:13858158-13858180 CCAGGGATGAAATGATTCCCAGG + Intronic
951628425 3:24692327-24692349 CCAGTTAGGAAAAGAGAACAAGG - Intergenic
952875999 3:37945021-37945043 CCAAGGATGAAAATAGGACCTGG + Intronic
953393758 3:42550001-42550023 ACTGTGATGAGAAGTGTACCTGG - Intronic
955701047 3:61682503-61682525 CCAGTGAGGAAAAAGGTAGCTGG + Intronic
955815004 3:62833067-62833089 CCAGTCATTAAAAGAGAACTGGG - Intronic
956296265 3:67716941-67716963 TCAGAGATAAAAATAGTACCTGG + Intergenic
960255722 3:115509189-115509211 CCAGTGCTTTAAAGAGTGCCTGG - Intergenic
962409483 3:135128760-135128782 CAAGTGCTGAAAAGAATGCCGGG + Intronic
962486296 3:135845845-135845867 CCAGAACTGAGAAGAGTACCTGG + Intergenic
962865867 3:139447715-139447737 CAAGAGATGAAAAGAGGAACAGG - Intergenic
965826134 3:172732079-172732101 CCAGTGATTAACATAGTGCCTGG + Intergenic
967820737 3:193836567-193836589 CCAGTCCTGAAAGGAGCACCAGG - Intergenic
971429729 4:26553089-26553111 CCAGAGATAAAAAGAGAAGCCGG - Intergenic
972114956 4:35620005-35620027 ACAGAGAAGAAAAGAGTACTGGG + Intergenic
972912201 4:43831236-43831258 CCAGTGCTGAAAAGGGCACTTGG + Intergenic
974371439 4:61021565-61021587 CCAGAGGTAAAAAGAGGACCTGG + Intergenic
975227840 4:71895038-71895060 CCAGAGATGCAAAGAGGAGCTGG + Intergenic
975453734 4:74564583-74564605 CCAGAGATGCAAAGAGGAGCTGG + Intergenic
976327485 4:83788550-83788572 CCAGTGATTATCACAGTACCTGG + Intergenic
976382890 4:84420331-84420353 CCAGAGATAAAAAGAATACTGGG + Intergenic
977371905 4:96148279-96148301 CCAGTGATCAATGGAGTTCCAGG + Intergenic
978463738 4:108985263-108985285 CAAGTGAGAAAAAGAGTAACTGG - Intronic
978495739 4:109357503-109357525 CCACTGATGAAAAAGGCACCAGG - Intergenic
979150797 4:117311504-117311526 CCAGTGAGGAAAGGAGAACTAGG + Intergenic
982244486 4:153336997-153337019 CCAGTGCCTAAAAGAGTACTTGG - Exonic
982855513 4:160377112-160377134 CCAGTGTTGAAAGTAGGACCTGG - Intergenic
983359016 4:166703985-166704007 CCAGTGTTTAAAGCAGTACCTGG - Intergenic
983965541 4:173805367-173805389 TTATTGATGAAAAGAGTACCAGG - Intergenic
984459301 4:180012760-180012782 CCACTGATGAACAGGGAACCAGG + Intergenic
986202903 5:5594950-5594972 CCAGTGATGATGGGATTACCTGG + Intergenic
990875814 5:60484093-60484115 CCTGAGATGAAAAGACTACTAGG + Intronic
991493262 5:67204006-67204028 CAAGTGTTTACAAGAGTACCTGG - Intergenic
992336966 5:75781399-75781421 CCAGAGATGCAAAGAGGAGCTGG + Intergenic
992857239 5:80875108-80875130 AAAGTGATGAGAAGAGTAGCTGG - Intronic
995046779 5:107658926-107658948 CCAGTACTGAGAACAGTACCTGG + Intronic
999597237 5:153218434-153218456 CCAGAGATGCAAAGAGGAGCTGG + Intergenic
1000043245 5:157500849-157500871 CCATTGATGAAAAGTGTACGGGG + Intronic
1000163584 5:158625547-158625569 CCAGAAAATAAAAGAGTACCAGG - Intergenic
1002136285 5:177109849-177109871 CCAGTGACTAGAAGAGTACCTGG - Intergenic
1002745205 5:181465041-181465063 CCAGTGTAGAGCAGAGTACCAGG + Intergenic
1004328001 6:14694628-14694650 ACAGTGTTGAAAATAGTACATGG + Intergenic
1005720311 6:28595036-28595058 CAAGTTATGAAATGTGTACCTGG + Intronic
1006246716 6:32743488-32743510 CCAGTGATGGAAACAGTATGGGG + Intronic
1007258883 6:40548137-40548159 CTAGGGATAAAAATAGTACCTGG + Intronic
1008878089 6:56351318-56351340 CCCGTTGTGAAAAGAGTACGGGG + Intronic
1009855054 6:69251462-69251484 CCAGTGCTGAATACAGTGCCTGG + Intronic
1011355330 6:86467457-86467479 CCACTGACTAAAAGAGTGCCTGG - Intergenic
1014012383 6:116491258-116491280 CCTGAGATGAAAAGAGGAGCCGG + Intergenic
1014890588 6:126839377-126839399 CCAGAGATAAAAAGAGGAGCTGG - Intergenic
1017208244 6:151826773-151826795 CCAGTGCTGATAACAATACCTGG - Intronic
1019250113 6:170738587-170738609 CCAGTGTAGAGCAGAGTACCAGG + Intergenic
1019649138 7:2147183-2147205 ACAGAGATGAAGAGAGGACCAGG + Intronic
1021436077 7:20617193-20617215 TCAGTGCTTAAAACAGTACCTGG + Intronic
1022051217 7:26675137-26675159 AAACTGATGAAAAGAGTTCCCGG - Intronic
1024533037 7:50408998-50409020 TCAGTGTCAAAAAGAGTACCTGG + Intergenic
1024698893 7:51885547-51885569 TCAGTAATTAAAAGAGCACCAGG + Intergenic
1026669653 7:72378117-72378139 CCAGTGCTGAAACCACTACCAGG - Intronic
1031084678 7:117290825-117290847 CCAGTGATTATAAGAGTGTCTGG + Intronic
1031687012 7:124743055-124743077 CCATGGAGGAAAGGAGTACCAGG - Intergenic
1031713192 7:125075139-125075161 CCAGTGTTGAAAAGGGGGCCTGG + Intergenic
1031713236 7:125075426-125075448 CCAGTGTTGAAAAAAGGGCCTGG - Intergenic
1032753043 7:134861646-134861668 CCAGTGTCGAGAACAGTACCTGG + Intronic
1035949785 8:4007339-4007361 CCAGTGAGGAAAAGAGGAAATGG - Intronic
1036534070 8:9628302-9628324 TTAGGGATGAAAACAGTACCAGG - Intronic
1037036131 8:14169520-14169542 CCAGTGAGGCAAAGATTTCCAGG - Intronic
1038057213 8:23871767-23871789 ACAGGGTTGAAAAGAGAACCTGG - Intergenic
1039146031 8:34448314-34448336 CCAGAGATAAAAAGAGGAGCTGG - Intergenic
1039273074 8:35904376-35904398 ACATTGTTGAAAAGATTACCAGG - Intergenic
1042477491 8:69265516-69265538 TCAGTGCTGAAAATAGTGCCTGG - Intergenic
1044605307 8:94042771-94042793 AGAGTGCTTAAAAGAGTACCTGG + Intergenic
1044674764 8:94718453-94718475 CCAGACATAAAAAGAGTTCCTGG + Intergenic
1045798024 8:106068609-106068631 CCAGAGATAAAAAGAGGAGCTGG + Intergenic
1046619412 8:116512474-116512496 CCAGTGATGGAAAGCTTTCCAGG - Intergenic
1047610366 8:126514961-126514983 CCAGTGAGGAAAAAAGTTACAGG - Intergenic
1048002790 8:130393418-130393440 CAAATGTTTAAAAGAGTACCAGG - Intronic
1048691486 8:136969659-136969681 CCAGTGCTAAGAACAGTACCTGG + Intergenic
1052031888 9:23638167-23638189 CCAGGGATGCAAAGATTACTGGG - Intergenic
1052479274 9:29001927-29001949 CCAGTGATGAAGAGAGAAGCAGG - Intergenic
1052707168 9:32008112-32008134 CCAGAGGTGCAAAGAGTAGCTGG - Intergenic
1052715896 9:32116822-32116844 CCAGGGATGAAGAGAGCTCCAGG + Intergenic
1055438157 9:76313118-76313140 CCAATGAGGAAAAGAATAGCAGG + Intronic
1055624302 9:78158848-78158870 ACAGAGAAGAAAAAAGTACCAGG - Intergenic
1057095922 9:92309428-92309450 CAAGTGATGAAAGGAGTAATAGG + Intronic
1058139998 9:101347526-101347548 CCAGTGATGACAAAAGCAACAGG - Intergenic
1059389653 9:113990907-113990929 CCAGTGATTAACACAGTCCCTGG - Intronic
1061596694 9:131635074-131635096 CCTGAGATGATAAGACTACCTGG + Intronic
1203579673 Un_KI270745v1:31172-31194 CCAGTGTAGAGCAGAGTACCAGG + Intergenic
1185637280 X:1562013-1562035 GCAGTTATAACAAGAGTACCAGG + Intergenic
1188340410 X:28993963-28993985 CCAGTGATGAAAAGAGTACCTGG - Intronic
1193005470 X:76613952-76613974 CCAGAGATAAAAAGAGCAGCCGG + Intergenic
1194485692 X:94483144-94483166 CCAGAGGTGAAAAGAGGAGCTGG - Intergenic
1197320664 X:125025684-125025706 CCGGGGAAGAAAAGAGAACCAGG + Intergenic
1197691379 X:129504278-129504300 CCAATGATGAACAGATTAACAGG + Intronic
1198487856 X:137106384-137106406 CCAGTGAAAACAAGAGGACCAGG - Intergenic
1198535286 X:137579888-137579910 CCAGTGAAGAAAAGCCTCCCAGG - Intergenic
1198921859 X:141738030-141738052 TCAGTGTTGAGAAGAGTACCTGG - Intergenic
1202043273 Y:20709985-20710007 CCAGAGATAAAAAGAGGAGCTGG + Intergenic
1202093359 Y:21217330-21217352 CCAGAGATGAAATGAGAACTAGG - Intergenic