ID: 1188342340

View in Genome Browser
Species Human (GRCh38)
Location X:29019499-29019521
Sequence AACTCCCAAGGTTCTTGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188342340 Original CRISPR AACTCCCAAGGTTCTTGCTT TGG Intronic
900390357 1:2431225-2431247 CACTGCCATGGTTCTTGCCTGGG - Intronic
901037844 1:6347053-6347075 AAGTCCCAAGGTTCTGTCTCTGG - Intronic
903759398 1:25687299-25687321 GACTCCCAAGGCTCTAGGTTAGG - Intronic
905466815 1:38160810-38160832 AATTCCCAGGATTCTAGCTTAGG + Intergenic
907356557 1:53879822-53879844 AAATACCCAGGTTCTTGCATTGG + Intronic
907506783 1:54924915-54924937 AAATCCCAAGGGTATTGATTGGG + Intergenic
908033669 1:60029156-60029178 GACTCCCAAGGTTCTGGCTTTGG - Intronic
909579536 1:77218844-77218866 AACTCTCAAGTTTCTGGCTTAGG - Intronic
910077271 1:83296382-83296404 AGGTCCCAATGTTCTTACTTGGG + Intergenic
910995221 1:93097364-93097386 AACTCCCAAGTTTTTAACTTGGG - Intronic
913397246 1:118385541-118385563 ATCTCCCAAGGAGCTTTCTTAGG - Intergenic
914448459 1:147770658-147770680 AAATGCCCAGGTTCTTCCTTCGG + Intronic
914732822 1:150387314-150387336 TGCTCCCAAGGTTCTTTCATTGG - Intronic
915066680 1:153230818-153230840 TACTCCCAAGTTTATGGCTTAGG + Intergenic
915659392 1:157389498-157389520 AGGTCCCAAGGTTCTTTCATTGG - Intergenic
915974915 1:160379057-160379079 AACTCCCAGGTTTCTGGCCTGGG + Intergenic
917258970 1:173147263-173147285 AGTTACCAGGGTTCTTGCTTTGG + Intergenic
919112576 1:193239253-193239275 TACTCCCAAGTTTCTGGCTTAGG - Intronic
921098360 1:211906706-211906728 CACTCCCAAAGTTCTTTCCTGGG + Intergenic
923103501 1:230836414-230836436 AGCTCCCAAGCTTCTAGGTTTGG - Intergenic
923667199 1:236009124-236009146 AACTCCCAAGGTGATGGCATTGG + Intronic
1065678609 10:28205845-28205867 ACCTCCCAACGCTCTTGCATTGG - Intronic
1066024531 10:31341391-31341413 AACTCCAAAGTTTCTAGCTGAGG + Intronic
1072408402 10:95176591-95176613 TACCCTCAAGTTTCTTGCTTTGG + Intergenic
1072465406 10:95657766-95657788 ACCTCCCAATATTCTTGCATTGG - Intergenic
1075556331 10:123435198-123435220 AAATCCAAATGTTCTTGCTGGGG + Intergenic
1075809255 10:125212724-125212746 ATCTCCCAAGGGTCTTTATTTGG - Intergenic
1075966657 10:126617656-126617678 AACTTCCAAGGTCTTTGCTAGGG + Intronic
1077888375 11:6402404-6402426 ATCTCCCAAGGTCCTGGCCTGGG + Intronic
1079745838 11:24128910-24128932 AACTCTCAAGGTCCCTGCTATGG + Intergenic
1081860710 11:46332172-46332194 AAATCCCATGGTTCCTCCTTGGG - Intergenic
1084160851 11:67349254-67349276 AACTCCAAAGGTTTTGGTTTGGG - Intronic
1086346496 11:85902677-85902699 AACTCCCAAGTTTCTGGCTTGGG - Intronic
1087029158 11:93685110-93685132 AACTCCCAGTGGTCTGGCTTGGG - Intronic
1088504278 11:110513556-110513578 ACCTTCCATGCTTCTTGCTTTGG + Intergenic
1092788344 12:12050105-12050127 CATTCCTAAGGTTCTTGCTCAGG - Intronic
1092882510 12:12898735-12898757 AACTCCCAGATTTCTGGCTTAGG - Intronic
1093992992 12:25610762-25610784 AACTTCCAAGGTTATTAGTTTGG + Intronic
1094559066 12:31532722-31532744 AACTTCTAAGTTTCTGGCTTTGG + Intronic
1095184635 12:39187167-39187189 GAATCCCAGGGTTCTTGCCTTGG - Intergenic
1096596024 12:52696081-52696103 AACACCCCAGGTCCTTCCTTAGG + Intronic
1096631004 12:52926703-52926725 AACTCCCAAGGTCCTTGTGAGGG - Intronic
1098972315 12:76869310-76869332 AACTCCCAACGTTGTTGCATTGG + Intronic
1100215279 12:92441457-92441479 CTCTCCCAAAGTTCTTGCTGAGG + Intergenic
1100957495 12:99925227-99925249 AGCTCCCAAGCTTATTGCTCTGG - Intronic
1101784756 12:107873347-107873369 GACACCCCAGGTTCTTGCGTGGG - Intergenic
1103459978 12:121096053-121096075 GACTCCCCAGGCTCTTGCGTGGG - Intergenic
1105907123 13:24823034-24823056 AACTCCCATAGCTCTTGTTTGGG + Intronic
1106957022 13:34950895-34950917 AACCTCCAGGGTTGTTGCTTAGG - Intronic
1108926932 13:55761673-55761695 AGCTGCCAAGGTTCTTTCTCAGG - Intergenic
1109501994 13:63249913-63249935 AACTGCCGAGGGTCTTGCCTGGG + Intergenic
1111663773 13:91242742-91242764 CACTCCAGAGGTTCTTGCTGTGG - Intergenic
1112316563 13:98368186-98368208 AACTCACAAGGTTAGTGGTTTGG + Exonic
1114789455 14:25640361-25640383 AACACTCAAGTTTCTTGCCTAGG - Intergenic
1117200810 14:53388269-53388291 AACTCCCAAGATTCTCACTTAGG + Intergenic
1117243092 14:53855281-53855303 GACTCCCAGGTTTCTGGCTTAGG + Intergenic
1117729360 14:58706057-58706079 AACTGACAAGTTTCTTGCCTGGG + Intergenic
1118642303 14:67804094-67804116 AACTCACCAGGCTCTTGCTGGGG + Exonic
1119697646 14:76726429-76726451 ATATCCCCAGGTTCTTGCCTTGG + Intergenic
1120253637 14:82090716-82090738 ACCTCCCAAGGCTGTTGCATTGG + Intergenic
1121577269 14:94998407-94998429 GACCCCCAGGGTTCTTGATTTGG + Intergenic
1124590628 15:31050196-31050218 AACACCAAACGTTCCTGCTTTGG - Intronic
1126982011 15:54255235-54255257 GTATCCCAGGGTTCTTGCTTTGG + Intronic
1127378889 15:58410930-58410952 AACTGCCAAGAAACTTGCTTTGG + Intronic
1127741841 15:61915570-61915592 GACTCCCAAGTTTCTAGATTAGG + Intronic
1128826051 15:70718383-70718405 ACATCCCTAGGTTATTGCTTTGG + Intronic
1130093540 15:80840124-80840146 AAGTCCCAAGGTGCTTCCTAGGG + Intronic
1130704290 15:86218073-86218095 AACTTCCTAGGTTATTCCTTAGG - Intronic
1134406619 16:13965045-13965067 AAATCACAAGGTTATTGATTGGG + Intergenic
1135046406 16:19159500-19159522 CACTCCTAAGGATCTTGCTTAGG - Intronic
1135498985 16:22977531-22977553 AAACCCCAAGGTTATTGATTGGG - Intergenic
1135933301 16:26757757-26757779 GACTCCTAAGTTTCTGGCTTAGG + Intergenic
1138111684 16:54329232-54329254 AACTCCCAGAATTTTTGCTTGGG + Intergenic
1138215116 16:55197943-55197965 ACCTCCCAACGTCATTGCTTTGG - Intergenic
1139499495 16:67350637-67350659 AGCTGCAAAGGTTCTTGGTTGGG - Intronic
1139936536 16:70575743-70575765 AAGTCCCAAGGTTGTGGCTGAGG - Exonic
1141437270 16:84007386-84007408 AATTCCCAAGGCCCTTGCCTGGG + Intergenic
1147362266 17:39938471-39938493 AACTCCTAAGGCTCCTGCCTTGG - Intergenic
1147591339 17:41685519-41685541 AAATCCCAAGGGTATTGATTGGG - Intergenic
1149627086 17:58087386-58087408 AACTCCTAAGGTGAATGCTTGGG - Intronic
1154082637 18:11273548-11273570 ATCTCCCTAGGTCCTTGCTGGGG - Intergenic
1156058000 18:33034092-33034114 GACTCCAAGGTTTCTTGCTTGGG - Intronic
1158691326 18:59663840-59663862 AACTCCCAAGATTCCAGTTTGGG + Intronic
1159741869 18:72181544-72181566 ACCCCCCATGGTTTTTGCTTAGG + Intergenic
1164738017 19:30556237-30556259 AACTCACAAGGTTCTGCCCTTGG - Intronic
1165697138 19:37909072-37909094 AACTCCCAGGTTTCTGGCTTAGG - Intronic
1167850829 19:52200377-52200399 CACTCCCTCGGTGCTTGCTTTGG + Intronic
925006445 2:446636-446658 AACTCCCATGGAGCTTGCTCTGG - Intergenic
925849289 2:8065419-8065441 AACTTCCAAAGTGCTTGCTGTGG + Intergenic
928817120 2:35310945-35310967 AACTCCCAAGGTATTGGCATTGG + Intergenic
929355137 2:41014681-41014703 AACTCCCAAAGTTTTGTCTTTGG - Intergenic
929894464 2:45946376-45946398 ACATCCCAAGGTTCTGACTTGGG - Intronic
932893040 2:75612441-75612463 AGCTCTCAGGGTTCTGGCTTGGG - Intergenic
934881431 2:97984006-97984028 GAGTCCCAAGGTTTTTACTTGGG + Intronic
935100388 2:99989057-99989079 AACTTCAAAGGTTCTAGCTTAGG + Intronic
935647161 2:105348089-105348111 AGATCCCAAGCTTCTAGCTTAGG + Exonic
937314399 2:120921781-120921803 AAATCCCAAGGTTCTTCCCATGG + Intronic
939692555 2:145283097-145283119 AAATCCCAAGATGCTTGTTTTGG - Intergenic
939767986 2:146277345-146277367 AGTTCCCAAGGTTCATCCTTAGG + Intergenic
939991388 2:148879150-148879172 ATCTCCCAAGTTTTTTGCCTTGG + Intronic
942639652 2:178048263-178048285 AACACCTAGGGTTCTGGCTTGGG + Intronic
944780023 2:203008188-203008210 AAATCACAAGGTTATTGATTGGG - Intronic
948408969 2:237744290-237744312 ACCTCGCAAGGATGTTGCTTCGG + Intronic
948427600 2:237897490-237897512 CCCTCCCAAGATTCTTTCTTTGG + Intronic
1171045695 20:21808174-21808196 GACTCCCAAGTTTCTGGTTTTGG + Intergenic
1172502665 20:35437893-35437915 AACTCCTCACTTTCTTGCTTTGG - Exonic
1172607980 20:36227991-36228013 AAAACCCAAGGTTCCTGTTTTGG - Intronic
1175584611 20:60128014-60128036 AACTCCCAACATTGTTTCTTTGG + Intergenic
1180720856 22:17907368-17907390 AACTCCCAGGTTTCCAGCTTAGG + Intronic
1181050482 22:20236005-20236027 GCATCCCAAGGTTCTTGCCTTGG - Intergenic
1182947541 22:34338481-34338503 AACTCCAAAGCTTCTAGCCTGGG - Intergenic
1183089449 22:35511406-35511428 ATCTCCCAGGCTTCTTGGTTGGG - Intergenic
1184293452 22:43509878-43509900 ACCTCCCATGGGTCTTGCTTGGG + Intergenic
949773968 3:7610663-7610685 AAATCCCAAGATGCTTCCTTTGG - Intronic
956728050 3:72172784-72172806 AACAAGCAAGGCTCTTGCTTTGG - Intergenic
956954846 3:74325345-74325367 AACTCCCAATTTTCTTGATTTGG + Intronic
957940719 3:86999843-86999865 ATCTACAAATGTTCTTGCTTTGG + Intergenic
959939031 3:112060812-112060834 AAATCACAAGGTTATTGATTGGG + Intronic
961305792 3:125958671-125958693 AACTCCCGGGGTTCTTGATAAGG - Intergenic
962344852 3:134611359-134611381 GACACCCAGGGGTCTTGCTTTGG - Intronic
962985407 3:140531603-140531625 GACTCCCAAGGCACTTGCTTAGG + Intronic
963443201 3:145367528-145367550 GACCCCCAAGGTACCTGCTTGGG - Intergenic
964196182 3:154067534-154067556 AAATCCCAAGGGTATTGATTGGG - Intergenic
966870506 3:184287359-184287381 GACTCCCAGGTTTCTTGCATGGG + Intronic
969620717 4:8277446-8277468 CACTCCCAAGGGACTAGCTTTGG + Intronic
970253110 4:14137269-14137291 AACTCCCAATGCTGTTGCATTGG - Intergenic
970662457 4:18301260-18301282 AACTCCCAAGATTCTAACTTAGG + Intergenic
970715875 4:18922260-18922282 AAATTCCATAGTTCTTGCTTGGG - Intergenic
971107284 4:23540861-23540883 AACTGCAAAGGTTAATGCTTTGG + Intergenic
972917878 4:43903471-43903493 GTATCCCAGGGTTCTTGCTTTGG - Intergenic
973644218 4:52933812-52933834 ACCTCCCAATGTTGTTGCATTGG - Intronic
974791119 4:66691367-66691389 ACCTCCCAACGTTGTTGCATTGG + Intergenic
975355310 4:73395724-73395746 AAATGCCAAGCTTCTTGCTTTGG - Intergenic
976030945 4:80752241-80752263 AAATACCTAGGTTCTTGCATTGG - Intronic
978038478 4:104027172-104027194 AACTTAAAAGGTTCTCGCTTTGG + Intergenic
978323446 4:107523933-107523955 GACTCCCATGCTTCTGGCTTAGG + Intergenic
981650561 4:147053206-147053228 AAATCCCAAGTATTTTGCTTTGG - Intergenic
982070135 4:151687409-151687431 AACTTCCAGATTTCTTGCTTGGG - Intronic
984895435 4:184535294-184535316 ATCTCCTGAGGTTGTTGCTTTGG - Intergenic
987113363 5:14707659-14707681 ACCTCCCAAGGTTATTTATTGGG + Exonic
987754961 5:22088562-22088584 AACTCCCAGTGTTGTTGCATTGG + Intronic
987762501 5:22183877-22183899 AACTGTCAAGTCTCTTGCTTTGG - Intronic
990347772 5:54886129-54886151 AACCCCCAACTTTCTTGTTTGGG - Intergenic
992753158 5:79879640-79879662 GACTCCTAGGTTTCTTGCTTGGG + Intergenic
992753489 5:79882704-79882726 GACTCCTAGGTTTCTTGCTTGGG - Intergenic
994858621 5:105158966-105158988 AACACCCAATGATCATGCTTTGG + Intergenic
995901758 5:117077562-117077584 AAGTCCCAGGGTCCTTGCTATGG + Intergenic
996282776 5:121751389-121751411 AATTCCCCAGGTGCTTGCTCTGG + Intergenic
1000714589 5:164624905-164624927 AAGTCCCAAAGTTTTTGCTAAGG + Intergenic
1001585034 5:172828055-172828077 GACCCCCAAGGGTCTGGCTTAGG - Intergenic
1002651558 5:180700240-180700262 AAATCACAAGGTTATTGATTGGG - Intergenic
1003790153 6:9537221-9537243 AACTCCCAAGTTATTTGCTAAGG - Intergenic
1005113065 6:22307144-22307166 ATCTCTCATGGCTCTTGCTTGGG + Intergenic
1005260873 6:24057937-24057959 AAGTCCCTAGGTTTTTGCATAGG + Intergenic
1005432041 6:25768586-25768608 GACTCCCAAGTTCCCTGCTTGGG - Intronic
1005471880 6:26169259-26169281 AACTCCCTAGGCACTGGCTTGGG + Intronic
1006291250 6:33138539-33138561 AGCTCTCAAGTTTCCTGCTTTGG + Intergenic
1006992414 6:38226703-38226725 AAATCTCAAGGTGCTTGCTCAGG + Intronic
1007501068 6:42297342-42297364 ACCTTCCAAGGTTCCTGCTTTGG - Intronic
1007539700 6:42629892-42629914 AACTCCCCTGGTTTTTGTTTTGG + Intronic
1009172025 6:60412652-60412674 AAATCACAAGGTTATTGATTGGG + Intergenic
1009297409 6:61970230-61970252 AACTCCCATGTTACTTGATTGGG + Intronic
1012237278 6:96833557-96833579 AACTTCTAAGGATCTTCCTTGGG - Intronic
1012570651 6:100723694-100723716 GACTCCCAGGGTTTTGGCTTCGG + Intronic
1014758418 6:125327632-125327654 AACACTCAAGGGTCTTGCTAGGG - Intergenic
1015831117 6:137370012-137370034 AGCTCACCAGTTTCTTGCTTCGG - Intergenic
1017252499 6:152296471-152296493 AAATCCCAAGTTTATAGCTTAGG - Intronic
1018602403 6:165559098-165559120 GACTCCAAAGTTTCTAGCTTAGG + Intronic
1021235152 7:18134194-18134216 AAATACCAAGGCTCTTGCTAAGG - Intronic
1023236681 7:38097870-38097892 AACTCCCATGATTCTAGCTGGGG + Intergenic
1023476858 7:40589581-40589603 ACCTCCCAATGTTGTTGCATTGG + Intronic
1024602891 7:51000419-51000441 AACTTCCTAGCTTCTTGCTTTGG - Intergenic
1027295043 7:76761596-76761618 AGGTCCCAACGTTCTTACTTGGG + Intergenic
1027625451 7:80539276-80539298 AACTCCAAATACTCTTGCTTTGG - Intronic
1027776644 7:82473403-82473425 AACTATCAAGCATCTTGCTTTGG + Intergenic
1028311262 7:89339915-89339937 AATTCCCAGAGTTTTTGCTTAGG + Intergenic
1028910414 7:96201618-96201640 AATTAACAAGGTCCTTGCTTAGG - Intronic
1031009520 7:116511362-116511384 CACTCTCCAGTTTCTTGCTTTGG + Intergenic
1031346498 7:120673447-120673469 AACTCCCAGGTTTCTGGTTTGGG - Intronic
1035635286 8:1139545-1139567 AACCCCCAAGGTGATGGCTTTGG - Intergenic
1036611916 8:10357911-10357933 AAGTACCAAGATTCTTGGTTTGG - Intronic
1038248610 8:25882029-25882051 ATATTCCAGGGTTCTTGCTTTGG - Intronic
1038451893 8:27644933-27644955 AGCTCCAAGGGTTCTTGTTTGGG - Intronic
1038606117 8:29006741-29006763 AACTGTCCAGGTTCTGGCTTTGG - Intronic
1039249064 8:35641895-35641917 ATTTCTCCAGGTTCTTGCTTAGG + Intronic
1039798497 8:40935082-40935104 CACTCCCAACGACCTTGCTTTGG - Intergenic
1040630947 8:49209769-49209791 AACTCCCAGGGTACTGGCTGAGG - Intergenic
1041209544 8:55535039-55535061 AACTACCAAGGTGATAGCTTTGG - Exonic
1042814558 8:72864449-72864471 AACTCACAGGTTTTTTGCTTTGG - Intronic
1043457184 8:80424344-80424366 AACTCCCAAATTACTTGCTTTGG - Intergenic
1043593913 8:81862395-81862417 AATTCCCAAGTTTTTGGCTTTGG - Intergenic
1045378996 8:101604262-101604284 AACTCACTAGGGTCTTGCGTGGG - Intronic
1045605277 8:103766934-103766956 ATCTCCAAAGGTTCTATCTTGGG + Intronic
1045921909 8:107540224-107540246 TACCCCCAAGGTGATTGCTTTGG + Intergenic
1047065196 8:121274193-121274215 AACTCCCAAGGTTATCGTTGTGG - Intergenic
1047230813 8:122996376-122996398 ATCTCCCAATGTGCATGCTTGGG - Intergenic
1048170024 8:132097293-132097315 ATCTCCCCAGGTTCCTGCTCTGG - Intronic
1050238559 9:3610083-3610105 AACTCCAAAAGTTCTTTTTTTGG + Intergenic
1050512416 9:6410085-6410107 AGTTCCCAAGTTTCTAGCTTAGG - Intergenic
1050655042 9:7818669-7818691 ACCTCCCAACGTTGTTGCCTTGG + Intronic
1051022690 9:12563874-12563896 AACTCTCAAAGTTCTTTCTGAGG - Intergenic
1055838372 9:80473001-80473023 AAATCCCTAGTTTCTGGCTTTGG + Intergenic
1056195073 9:84220896-84220918 ACCTCCCAACATTGTTGCTTTGG - Intergenic
1058741147 9:107944060-107944082 GACTCCCAAGGGTCTGGCTTGGG + Intergenic
1059566666 9:115389209-115389231 AAATTCCAGGATTCTTGCTTTGG - Intronic
1188342340 X:29019499-29019521 AACTCCCAAGGTTCTTGCTTTGG + Intronic
1190884935 X:54523069-54523091 AATTTCCCAAGTTCTTGCTTTGG + Intergenic
1192214908 X:69151242-69151264 GACTCCCAAGATTTTGGCTTGGG - Intergenic
1192611971 X:72575750-72575772 AACTCCCAGGTTTCTGACTTAGG - Intergenic
1193061395 X:77211970-77211992 AATTACCAAAGTTCTTGCATTGG + Intergenic
1194101918 X:89716812-89716834 AAATCACAAGGTTATTGATTGGG - Intergenic
1195941184 X:110169287-110169309 AACTCCCAGTGTTCTGGCTGGGG - Intronic
1196200255 X:112878718-112878740 AACATCCAAGATTCTTGCTTTGG - Intergenic
1196416869 X:115480340-115480362 AACTTCCATTTTTCTTGCTTGGG + Intergenic
1197849558 X:130843215-130843237 AACTCCCAGGTTTCTGGCTTGGG - Intronic
1200381415 X:155841396-155841418 AACTCCCAAGTTTCTAGATTGGG - Intergenic