ID: 1188343328

View in Genome Browser
Species Human (GRCh38)
Location X:29032369-29032391
Sequence GGATTCTGCTTAGGTAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 233}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188343328 Original CRISPR GGATTCTGCTTAGGTAGATC TGG (reversed) Intronic
902178641 1:14670571-14670593 TGATTCTGATTCAGTAGATCTGG + Intronic
905398202 1:37681424-37681446 GGATTCTGATTCTGTAGGTCTGG - Intergenic
908185321 1:61647152-61647174 GGATTCTGATTCAGTAGGTCTGG + Intergenic
908473439 1:64467465-64467487 AGATTCTGCTTTAGTAGACCTGG + Intergenic
908983203 1:69983892-69983914 GGATTCTGATTCAGCAGATCTGG + Intronic
910044402 1:82894198-82894220 GAATTGTGCTTAGTTAAATCTGG + Intergenic
910763086 1:90754348-90754370 AGATTCTGATTCAGTAGATCTGG + Intergenic
911741319 1:101389032-101389054 GGTTTCTGCTTCAGTAGATCTGG + Intergenic
912882339 1:113428188-113428210 GAATTCTGCTTAGAAATATCTGG + Intronic
913251702 1:116917296-116917318 GGATCCTGTTTAAGTTGATCTGG - Intronic
917508309 1:175648964-175648986 GGATGCTGCTGAGGTAGTCCAGG - Intronic
920515500 1:206582014-206582036 GGATTCTCCTTTGGTAAATGAGG - Intronic
921477016 1:215623455-215623477 AGATTCTGATTCGGTTGATCTGG - Exonic
921900947 1:220450259-220450281 GGATACTGTTTAGGAAAATCAGG - Intergenic
1065738596 10:28776110-28776132 GGATTCTGATTCAGTAAATCTGG + Intergenic
1067766155 10:49088974-49088996 AGATTCTGATTCAGTAGATCCGG - Intronic
1068319511 10:55393249-55393271 GGGTTCTGATTCGGTAGATCTGG + Intronic
1068605142 10:58997088-58997110 AGATTCTGATTTCGTAGATCTGG + Intergenic
1068813365 10:61281748-61281770 AGAGTCTGATTAAGTAGATCAGG + Intergenic
1069580985 10:69566750-69566772 GGATGCTACTTAGTGAGATCAGG + Intergenic
1069690486 10:70348584-70348606 GGATCCAGGTTAGGTGGATCAGG + Intronic
1070644083 10:78189388-78189410 GGTTTCTGATTCAGTAGATCTGG - Intergenic
1070787429 10:79170103-79170125 GGAGTCTGATTCTGTAGATCTGG + Intronic
1071278696 10:84079727-84079749 AGATTCTGCTTAAGTAGATCTGG + Intergenic
1073531117 10:104232582-104232604 AGATTCTGATTGAGTAGATCTGG - Intergenic
1075096734 10:119476537-119476559 GTTTTCTTCTTAGGTAGGTCTGG + Intergenic
1075906515 10:126086317-126086339 GGCTTCTACTTAGGTCGGTCTGG + Intronic
1076027882 10:127131279-127131301 GGCTTCTGTTTGGGAAGATCAGG - Intronic
1077729277 11:4711724-4711746 GGCTTCTGTTTAAGTAGCTCTGG - Intronic
1079291585 11:19192924-19192946 AGATTCTGGTTTGGTAGATCTGG + Intronic
1079885713 11:25986364-25986386 AGATTCTGATTCGGTAGATATGG + Intergenic
1079908229 11:26276290-26276312 AAATTCTGATTAGGAAGATCTGG + Intergenic
1080735709 11:35011863-35011885 GGATGCTGCCTAGGAAGAGCAGG + Intronic
1083445109 11:62703190-62703212 AGATTCTGATTTGGTAGCTCTGG + Intronic
1083635135 11:64116822-64116844 GGATGCTGCTCAGGTGGTTCCGG - Exonic
1083852003 11:65373526-65373548 AGATTCTGATTTGGTAGGTCTGG + Intergenic
1084453832 11:69255963-69255985 GGCTTCTGTTTAGGAAGATGGGG + Intergenic
1086344728 11:85884394-85884416 GGATTCTGATTCAGTAGGTCTGG - Intronic
1087535667 11:99442033-99442055 CAATTCTGCTTAGGATGATCAGG - Intronic
1088500352 11:110476822-110476844 AGATTCTGATTCTGTAGATCTGG + Intergenic
1090502132 11:127271386-127271408 GCATTCTGCCTAGGTGGATGGGG - Intergenic
1090516207 11:127430370-127430392 AGATTCTGGTTTGATAGATCAGG + Intergenic
1091123975 11:133080280-133080302 GGGTTCAGCTTTGGTAGGTCTGG + Intronic
1091455837 12:607182-607204 AGATTCTGGTTGAGTAGATCTGG - Intronic
1091614367 12:2037823-2037845 AGATTCTGATTCAGTAGATCTGG - Intronic
1093982561 12:25490833-25490855 GGATTCTAATTTGGTAGGTCTGG + Intronic
1094039454 12:26107665-26107687 AGATTCTGATTCAGTAGATCTGG + Intergenic
1098861570 12:75716625-75716647 TGATTCTGCTTAGAGTGATCTGG - Intergenic
1100268049 12:92997349-92997371 AGATTCTGATTCGGTAGCTCGGG + Intergenic
1102982670 12:117254460-117254482 AGATTCTGATTAAGTAGTTCTGG + Intronic
1108528154 13:51303376-51303398 GGCTTCTGCTTCGGCAGAGCTGG - Intergenic
1108695646 13:52900258-52900280 AGATTCTGGTTCAGTAGATCTGG - Intergenic
1108695731 13:52900843-52900865 AGATTCTGGTTCAGTAGATCTGG + Intergenic
1108742484 13:53352579-53352601 AGATTCTAACTAGGTAGATCTGG - Intergenic
1111920019 13:94400670-94400692 GGATGCTACTTAAGTAAATCTGG - Intronic
1113374110 13:109748088-109748110 TGAGTCTGGTTAGGTAGATAGGG + Intergenic
1114187898 14:20417025-20417047 AGATTCTGATTCAGTAGATCTGG - Intergenic
1115713195 14:36073020-36073042 GGATTCTGATTTGGTGGGTCTGG + Intergenic
1118055973 14:62080258-62080280 GGATTCTGATTCAGTAGGTCTGG - Intronic
1118857951 14:69638629-69638651 AGATTCTGATTCAGTAGATCTGG + Intronic
1118912075 14:70069869-70069891 GGATTCTGATTCAGTAGATCTGG + Intronic
1121230567 14:92354662-92354684 AGATTCTGATTCAGTAGATCTGG + Intronic
1125404992 15:39342626-39342648 AGATTCTGATTTGGTGGATCTGG - Intergenic
1125742336 15:41973946-41973968 GGATTCTGATTCGGTAGGTATGG + Intergenic
1127284320 15:57519216-57519238 GGATGCTGCTTAAGTATCTCAGG + Intronic
1127478850 15:59359688-59359710 TGATACTGCCTAGGTAGAGCTGG + Intronic
1130097757 15:80868471-80868493 AGATTCTGATTCGGTAGGTCTGG - Intronic
1130475506 15:84262645-84262667 GGGTTCTGCTTAAGGAGATGGGG + Intergenic
1130482924 15:84376699-84376721 GGGTTCTGCTTAAGGAGATGGGG + Intergenic
1132024249 15:98391502-98391524 GGATTCTGACTCAGTAGATCTGG + Intergenic
1134463021 16:14446226-14446248 GGATTCAGCTCAGGCAGACCTGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1138906769 16:61345836-61345858 GGTTTTGGCTTAGGAAGATCAGG - Intergenic
1139962286 16:70724915-70724937 GCATTCTGGGTAGGTGGATCGGG + Intronic
1140246697 16:73256520-73256542 AGATTCTGACTTGGTAGATCTGG + Intergenic
1141730720 16:85821292-85821314 AGATTCTGATTAAGTAGCTCTGG - Intergenic
1142336750 16:89494262-89494284 AGATTCTGATTGAGTAGATCTGG + Intronic
1145900867 17:28489720-28489742 AGTTTCTGATTCGGTAGATCTGG + Intronic
1149644626 17:58231102-58231124 AGATTCTGATTTGGTACATCTGG + Intronic
1150551557 17:66215354-66215376 AGTTTCTGATTTGGTAGATCTGG - Intronic
1151422554 17:74007966-74007988 AGATTCTGATTTGATAGATCTGG - Intergenic
1152064576 17:78103636-78103658 GGATTCTGCTATGGTGGCTCAGG - Intronic
1155032749 18:21998485-21998507 AGATTCTGCTTAGGTTACTCTGG - Intergenic
1155080259 18:22402594-22402616 AGATTCTGATTTAGTAGATCTGG + Intergenic
1156787277 18:40931008-40931030 GGATTCTCCTAAGGTAGAGAGGG - Intergenic
1159359658 18:67383390-67383412 GGAATCTACTCAGGTAGCTCAGG + Intergenic
1164964140 19:32466309-32466331 GGCTTCTGATTCGGTAGGTCTGG - Intronic
1168229976 19:55024735-55024757 GGCTTCTGCTTCAGTAGGTCTGG - Intronic
928595381 2:32854937-32854959 GGATTCTGCATCTGTAGGTCTGG + Intergenic
929123094 2:38499511-38499533 AGATTCTGCTTCTGTAGGTCTGG - Intergenic
929523172 2:42674018-42674040 GGATTCTGCTGAGCTAGACTGGG + Intronic
930332193 2:49999057-49999079 AGATTCTGCTTTGGTAGCTCTGG + Intronic
930546896 2:52779507-52779529 GAATTCTGATTCAGTAGATCTGG - Intergenic
931066506 2:58593984-58594006 AGATTCTGATTCAGTAGATCTGG + Intergenic
931525922 2:63153242-63153264 TGATTCTGATTCAGTAGATCTGG - Intronic
935756588 2:106280963-106280985 GGATTCTGTTTGAGTAGGTCAGG + Intergenic
936683215 2:114798720-114798742 GGATTCTGGTTACATAGATGTGG + Intronic
937024703 2:118688414-118688436 GGATTCTGATTCTGTAGTTCTGG + Intergenic
938412273 2:131074988-131075010 GGCTTCTGCTGAGGTAGAGGGGG - Intronic
939562543 2:143750002-143750024 AGATTCTGATTTGGTAGTTCAGG - Intronic
939959641 2:148555012-148555034 AGATTCTGCTTTGGGAGGTCCGG + Intergenic
940481497 2:154238079-154238101 AGATTCTGATTCAGTAGATCTGG - Intronic
941843227 2:170109678-170109700 AGATTCTGATTTGGTAGTTCTGG + Intergenic
941891980 2:170592129-170592151 GGCTTTGGCTCAGGTAGATCTGG - Intronic
942402065 2:175613081-175613103 AGGCTCTTCTTAGGTAGATCAGG + Intergenic
943501986 2:188703050-188703072 GGATTCAGCTTCCTTAGATCAGG - Intergenic
943810158 2:192175770-192175792 GGATTCTGCTCATGTACAGCAGG + Intronic
944912759 2:204326595-204326617 AGATTCTGATTCAGTAGATCTGG + Intergenic
944961146 2:204875484-204875506 AGATTCTGATTAGGTGGGTCTGG + Intronic
946047070 2:216830072-216830094 GGATTCTGATTCTGTAGGTCTGG - Intergenic
946451249 2:219781810-219781832 GAATTCTGATTCAGTAGATCTGG - Intergenic
946466959 2:219920564-219920586 AGATTCTGATTTGGTAGGTCTGG + Intergenic
946745811 2:222844575-222844597 AGATTCTGATTCAGTAGATCTGG + Intergenic
946759955 2:222983743-222983765 GGATTCTGATTTAGTAGTTCTGG + Intergenic
947243740 2:228023392-228023414 AGATTCTGATTGAGTAGATCTGG - Intronic
947537231 2:230947918-230947940 AGTTTCTGCTTAGGTAGGACAGG - Intronic
1171795633 20:29564115-29564137 AGATTCTGACTAAGTAGATCTGG - Intergenic
1172858039 20:38023354-38023376 TGATTCTGATTCCGTAGATCTGG - Intronic
1172993739 20:39054616-39054638 AGATTCTGGTTCAGTAGATCTGG - Intergenic
1173026200 20:39309753-39309775 GGAATCTGATTAGGTAGGTCTGG + Intergenic
1173882323 20:46424939-46424961 AGATTCTGCTTCAGTAGGTCTGG - Intronic
1175159846 20:57000101-57000123 GGATTCTGATTCAGCAGATCTGG + Intergenic
1175498827 20:59434731-59434753 AGGTTCTGCTTTGGTAGGTCTGG - Intergenic
1176511346 21:7750882-7750904 AGTTTCTGATTGGGTAGATCTGG + Intronic
1176652734 21:9565243-9565265 GGACTCTGCTTTGGGAGACCTGG + Intergenic
1178485776 21:33019590-33019612 GGATTCTGTTTCAGTAGATCTGG + Intergenic
1178645460 21:34381411-34381433 AGTTTCTGATTGGGTAGATCTGG + Intronic
1178722818 21:35025380-35025402 GGATGCTGCTCAGGTTGAACAGG - Intronic
1181927137 22:26369027-26369049 TGATTTTGCTTTGGGAGATCTGG - Intronic
1182182955 22:28370892-28370914 GGATTCTGATTCATTAGATCTGG - Intronic
1182270283 22:29149020-29149042 GGATTCTGATGTGGTAGGTCTGG - Intronic
1183487822 22:38098831-38098853 GGATTCTGCTTGGGAAAGTCAGG - Intronic
1184024691 22:41846455-41846477 GGATTCTCCAAAGGAAGATCAGG + Intronic
949202728 3:1398912-1398934 TGCTTCTGCTTTGGTAGATGAGG + Intronic
950858744 3:16128829-16128851 TGATTCTGGTTTGGTAGGTCTGG + Intergenic
953152674 3:40339380-40339402 GGAATGTGCTTAGGTAGATTTGG - Intergenic
955074971 3:55604944-55604966 AGATTCTGATTCGGTAGGTCTGG + Intronic
956031747 3:65045111-65045133 GGATTTAGCTAAGGTAGATGGGG - Intergenic
956081252 3:65558725-65558747 AAATTCTGATTCGGTAGATCAGG - Intronic
956467521 3:69534071-69534093 AGATTCTGATTCAGTAGATCTGG - Intronic
956655559 3:71547187-71547209 GCATTCTTCTTAGGTAGTTTAGG + Intronic
957027488 3:75199468-75199490 GGATTCTGTTTATGTTTATCTGG + Intergenic
959173101 3:102868235-102868257 AGATTCTGATTCAGTAGATCTGG + Intergenic
960611053 3:119555068-119555090 TGTTTCTGCTTAGGTGGGTCTGG - Intronic
960618503 3:119617809-119617831 GGATTATGCTTATGTATCTCAGG + Intronic
962163818 3:133027889-133027911 GGTTTCTGATTAAGTAGATCTGG - Intergenic
963978182 3:151506270-151506292 GGATTCAGCATGGATAGATCTGG - Intergenic
965016189 3:163160301-163160323 GGATTATACTTAGTTAGCTCAGG - Intergenic
965604462 3:170484891-170484913 GGAGTCTCCTGAGTTAGATCAGG + Intronic
965738984 3:171852885-171852907 AGATTCTGATTCAGTAGATCTGG + Intronic
967743852 3:193032716-193032738 AGATTCTGATTTAGTAGATCTGG - Intergenic
969496745 4:7530529-7530551 GGATTCTGCATCGATAGAGCAGG + Intronic
971448902 4:26781133-26781155 AGATTCTGCTTCAGTAGGTCTGG - Intergenic
972269124 4:37492715-37492737 GACTTCTGCTGAGGTAGAGCAGG + Intronic
972864745 4:43217096-43217118 GGATTCTGATTCAGTAGTTCTGG + Intergenic
973303947 4:48622447-48622469 TGATTCTGCTTTGGCAGAACTGG + Intronic
973320709 4:48807730-48807752 TGATTCTGCTTCAGTAGATTTGG + Intronic
973928733 4:55767369-55767391 AAATTCTGATTAGGTAGCTCTGG + Intergenic
975431281 4:74294245-74294267 TAATTCTGCTTAGATACATCTGG + Intronic
977271948 4:94927783-94927805 GGACTCTGCTTAGGAAGAACTGG + Intronic
977661315 4:99590067-99590089 AGATTCTGATTCAGTAGATCGGG + Intronic
979094405 4:116528116-116528138 TGATTCTATTTAAGTAGATCTGG + Intergenic
984503456 4:180587870-180587892 GGATGCTGCCTGGGTAGATGGGG + Intergenic
989269693 5:39517930-39517952 GGATTTTGATTTAGTAGATCTGG - Intergenic
990329042 5:54707272-54707294 AGATTTTGCATAGGTAGACCAGG + Intergenic
990833929 5:59993180-59993202 AGATTGTGTTTAGGAAGATCTGG - Intronic
991000248 5:61775579-61775601 GAAGTCTGCTTAGGTATTTCAGG - Intergenic
991083570 5:62626792-62626814 GCATTCTCCTTAGGAAGATAGGG - Intronic
991229822 5:64320067-64320089 AGTTTCTGCTTCAGTAGATCTGG - Intronic
991937567 5:71817009-71817031 GCATTCTGGTCAGGTATATCTGG - Intergenic
992559645 5:77938099-77938121 AGATTCTGCTTCGGTTGAACTGG - Intergenic
992957556 5:81925772-81925794 GGATTCTAATGGGGTAGATCTGG + Intergenic
995062371 5:107824795-107824817 TGATTCTGCTTATGTAAATGTGG + Intergenic
996471408 5:123865213-123865235 GGATTCTGATTCAGTAGGTCTGG - Intergenic
997598088 5:135120588-135120610 GGATCCTGCCTAGGGAGGTCAGG + Intronic
1000072478 5:157753657-157753679 AGATTCTGTTTTGGTAGGTCTGG - Intronic
1000862454 5:166472892-166472914 GGATTCTGCCTAGATAGTGCTGG + Intergenic
1003205979 6:4012039-4012061 GGATTCTGATTTAGTAGGTCTGG - Intergenic
1003253812 6:4457102-4457124 AGATGCTGATTTGGTAGATCTGG - Intergenic
1003500267 6:6697296-6697318 GGATTCTGGTTCAGCAGATCTGG - Intergenic
1003530670 6:6934943-6934965 GGATTCTGATTCTGTAGGTCTGG - Intergenic
1004014441 6:11719270-11719292 GGATTCTGATTTAGTGGATCTGG - Intronic
1007080305 6:39096374-39096396 GGATTCTGATTAAATAGGTCTGG - Intergenic
1007887919 6:45253597-45253619 AGGTTCTGCTTAGGTTGCTCAGG - Intronic
1010579349 6:77574985-77575007 GTTTTCTTCTTCGGTAGATCTGG - Intergenic
1012579990 6:100855637-100855659 GGAAACTGCTTAGGTAAGTCAGG - Intronic
1012644981 6:101667243-101667265 GGCTTCTGCTTTGCTAGATCAGG + Intronic
1013975242 6:116069846-116069868 GGATTCTAATTCAGTAGATCTGG + Intergenic
1015024188 6:128513721-128513743 AGATTCTGATTCAGTAGATCTGG + Intronic
1015248086 6:131097741-131097763 GGATTCTGATCAAATAGATCTGG + Intergenic
1017263021 6:152409510-152409532 GTATTCTGCTTTAGTAGATCTGG - Intronic
1017330862 6:153196911-153196933 AGAATCTGATTAGGTATATCTGG - Intergenic
1020887409 7:13835325-13835347 GGATGATGCAGAGGTAGATCGGG + Intergenic
1021767677 7:23965930-23965952 AGATTCTGATTTGGTAGGTCTGG - Intergenic
1023081294 7:36528920-36528942 AGGTTCTGATTAGGTAGGTCTGG + Intronic
1023156222 7:37255335-37255357 GGTTTCTGCTGAGGTTGCTCTGG - Intronic
1023395693 7:39749858-39749880 GGTTTCTGATTCAGTAGATCTGG - Intergenic
1024152118 7:46582490-46582512 GGATTCTGATTTGGTATATCTGG - Intergenic
1025995073 7:66522811-66522833 AGATTCTGCTGCCGTAGATCTGG + Intergenic
1028108545 7:86910110-86910132 GGATTCTGATTTAGTTGATCTGG + Intronic
1030262175 7:107577717-107577739 AGATTCTGATTAGGTAGATCTGG + Exonic
1032505571 7:132431948-132431970 GGTTTCTGCTTAGGTGGAAGTGG + Intronic
1032598092 7:133262682-133262704 AGATTCAGCTCAGGTAGGTCAGG - Intronic
1032835664 7:135670612-135670634 TGATACTCCTTTGGTAGATCCGG + Intronic
1033108561 7:138554730-138554752 GGATTCTGCTTAGGCATTTGTGG - Exonic
1034885870 7:154798394-154798416 GGATTCTGCTTGGAAGGATCTGG - Intronic
1036432693 8:8704736-8704758 AGATTCTGATTCAGTAGATCTGG + Intergenic
1038036410 8:23690446-23690468 AGATTCTGCTTCGGTAGATCTGG + Intergenic
1039580851 8:38665847-38665869 GGATTCTGATTTGGAAGATTTGG + Intergenic
1041772512 8:61487079-61487101 AGATTCTGATTTAGTAGATCTGG + Intronic
1042576951 8:70231519-70231541 GGATTCTGCTTTAGTTGGTCTGG - Intronic
1042691487 8:71504677-71504699 ATATTCTGCTTTGGTAAATCTGG + Intronic
1045918983 8:107507831-107507853 GGTTTCTGATTCAGTAGATCTGG - Intergenic
1046691005 8:117284135-117284157 ATATTCTTCTTAGGTAGAGCTGG - Intergenic
1046705872 8:117451288-117451310 GGATTCTGATTAAGTAGATCTGG + Intergenic
1046810349 8:118526432-118526454 AAATTCTGCTTTGGTAGCTCTGG + Intronic
1047770395 8:128025922-128025944 GGATTCTCATAAGGAAGATCTGG - Intergenic
1047786252 8:128156457-128156479 GAATTCTGATTGGGTAGGTCTGG - Intergenic
1048037036 8:130686653-130686675 AGATTCTGAGTAAGTAGATCTGG + Intergenic
1050291207 9:4156942-4156964 GGTTTCTGATTCGGTAGATATGG - Intronic
1051160247 9:14199455-14199477 GGATCCTGTTTAAGTAGATTAGG - Intronic
1053419388 9:37967707-37967729 GGTTCCTGATTCGGTAGATCCGG - Intronic
1054349731 9:64010406-64010428 AGATTCTGATTCAGTAGATCTGG + Intergenic
1055370243 9:75590666-75590688 GGATTCTGATTCAGTAGGTCTGG - Intergenic
1055522156 9:77092486-77092508 AGATTCTGGTTCAGTAGATCTGG + Intergenic
1055816108 9:80209062-80209084 AGATTCTGATTTAGTAGATCTGG - Intergenic
1058000162 9:99856766-99856788 AGATTCTGGTTAGGTAGGTCTGG + Intronic
1058968385 9:110057797-110057819 AGATTCTGATTAAGTAGGTCTGG - Intronic
1059552766 9:115246162-115246184 GAATTTTGCCTAGGAAGATCAGG - Intronic
1059589805 9:115646440-115646462 AGATTCTGCTTTAGTAGGTCTGG - Intergenic
1203630465 Un_KI270750v1:68784-68806 GGACTCTGCTTTGGGAGACCTGG + Intergenic
1186980446 X:14952677-14952699 AGATTCTGATTCAGTAGATCTGG + Intergenic
1187228053 X:17393383-17393405 GGATTCCTTTTAAGTAGATCGGG - Intronic
1188145997 X:26614456-26614478 GGCTTCTGGTTAAGTAGATTGGG - Intergenic
1188343328 X:29032369-29032391 GGATTCTGCTTAGGTAGATCTGG - Intronic
1189048147 X:37615224-37615246 GGATTCTAATTCAGTAGATCTGG + Intronic
1189121408 X:38399213-38399235 AGATTCTGCTTCAGTAAATCTGG + Intronic
1189228124 X:39430602-39430624 AGATTCTGATTGGGTAGGTCTGG - Intergenic
1190459697 X:50660267-50660289 AGATTCTGATTTAGTAGATCTGG + Intronic
1196468954 X:116003545-116003567 TACTTCTGCTTAGGTAGACCTGG + Intergenic
1198244339 X:134814983-134815005 GGTTTCTGATTAAGTAGATGGGG + Intronic
1198685090 X:139220461-139220483 GGTTTCTGATTCAGTAGATCTGG - Intronic
1198765574 X:140076189-140076211 GGATTCTGATTCAGTAGGTCTGG - Intergenic
1202279757 Y:23170049-23170071 GGAAGCTGCTTTGGTAGATACGG - Exonic
1202280486 Y:23180889-23180911 GGAAGCTGCTTTGGTAGATACGG - Exonic
1202281215 Y:23191737-23191759 GGAAGCTGCTTTGGTAGATACGG - Exonic
1202284676 Y:23226783-23226805 GGAAGCTGCTTTGGTAGATACGG + Exonic
1202375240 Y:24229460-24229482 GGGTTCTGCTTAAGGAGATAGGG - Intergenic
1202432887 Y:24806120-24806142 GGAAGCTGCTTTGGTAGATACGG - Exonic
1202436350 Y:24841170-24841192 GGAAGCTGCTTTGGTAGATACGG + Exonic
1202437078 Y:24852018-24852040 GGAAGCTGCTTTGGTAGATACGG + Intronic
1202495540 Y:25440660-25440682 GGGTTCTGCTTAAGGAGATAGGG + Intergenic