ID: 1188344582

View in Genome Browser
Species Human (GRCh38)
Location X:29047900-29047922
Sequence ATTATGTAAGAGATTATAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188344582_1188344586 25 Left 1188344582 X:29047900-29047922 CCCCCTATAATCTCTTACATAAT 0: 1
1: 0
2: 1
3: 16
4: 188
Right 1188344586 X:29047948-29047970 ATTACATACCACCCTTGTATTGG 0: 1
1: 0
2: 0
3: 2
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188344582 Original CRISPR ATTATGTAAGAGATTATAGG GGG (reversed) Intronic
901657483 1:10778436-10778458 ATTCTGTATGAGATTGTATGAGG - Intronic
907869486 1:58430429-58430451 ATAATGTAAGAGATCATATCAGG + Intronic
908089003 1:60666722-60666744 ATTATGACATAGATTATAAGGGG + Intergenic
908309161 1:62858494-62858516 ATTAAGGAAGAGAATATAGAAGG + Intronic
908341735 1:63187742-63187764 ATGATGTAAGAGACTATAACAGG - Intergenic
909636521 1:77822790-77822812 ATTATGGATAAGATTATAGGCGG + Intronic
910286516 1:85561555-85561577 ATTATGTAAGAGATCACAGTAGG - Intronic
910658602 1:89644731-89644753 ATTTGGTAAGAGTTTATATGCGG - Intronic
917758559 1:178130433-178130455 ATTATGTAAGATTTTCTACGGGG - Intronic
919253408 1:195090009-195090031 ATTATGAAAGCGATTGTATGGGG - Intergenic
919418292 1:197339172-197339194 ATGTTGTAAGAGATTAAACGTGG - Intronic
920001080 1:202799319-202799341 ATTATGTAAAAGAGGACAGGAGG - Intronic
920262320 1:204697507-204697529 GTTATGTAAGATATTACTGGTGG + Intergenic
920285620 1:204877148-204877170 TATATTTAATAGATTATAGGAGG + Intronic
923501452 1:234568626-234568648 ATTGGGTTAGAGATTATAGGAGG - Intergenic
1063267520 10:4470815-4470837 TTTATTAGAGAGATTATAGGTGG - Intergenic
1063799633 10:9559593-9559615 ATTTTGTAAGAGAAAATAGAGGG - Intergenic
1065110298 10:22434658-22434680 ATTATGTAACAGTTTTTAAGTGG + Intronic
1074714543 10:116206253-116206275 ATAATGTAAGACATTATCAGGGG + Intronic
1078851025 11:15163886-15163908 ATGAAGAAAGAGATTAAAGGAGG - Intronic
1080728945 11:34928092-34928114 CTTAGGTGAGAGATTATAGCAGG + Intronic
1080973950 11:37312544-37312566 CAGATGTAAGAGATTATGGGGGG - Intergenic
1082036261 11:47647720-47647742 GTTTTGGGAGAGATTATAGGAGG - Intergenic
1082813092 11:57490479-57490501 ATTATGTGAGAGAAGATACGGGG + Intronic
1085065474 11:73491550-73491572 ATTATGTAACATATTCAAGGAGG + Intronic
1087183588 11:95162257-95162279 CTTCTGTCAGAGATTATAAGAGG + Intergenic
1087734162 11:101813029-101813051 ATTATGTCAGTGTTTATTGGTGG - Intronic
1088147670 11:106702415-106702437 GTTTTGTAAGAGATGATATGTGG + Intronic
1088866586 11:113853500-113853522 AATATCTACGAGAGTATAGGAGG - Intronic
1096142167 12:49251319-49251341 ATTATTTCAGAAATTAGAGGAGG + Intronic
1096729942 12:53601416-53601438 ATTAATTAAGGGATTATAGGAGG + Intronic
1097200986 12:57278403-57278425 TCTAGGTATGAGATTATAGGTGG + Intronic
1097605751 12:61751578-61751600 CTTATTTAAGACATTATAGAGGG - Intronic
1099536343 12:83849647-83849669 ATTATGTGAAAGATTATAGGTGG + Intergenic
1105953711 13:25259180-25259202 ATTATATGAGAGATTATTGGAGG + Intronic
1106151858 13:27112203-27112225 ATTATTTAAGAAATTCTAAGAGG - Intronic
1107190097 13:37571742-37571764 ATTATGCAAAATATTATATGTGG + Intronic
1108805729 13:54153473-54153495 ATCTTGAAAGAGATTATACGTGG + Intergenic
1111035904 13:82673873-82673895 ATTTTGTAAGAGATAATAAAAGG - Intergenic
1112215431 13:97426031-97426053 TTTATTTAACAGATTGTAGGAGG - Intergenic
1112852289 13:103721101-103721123 ATTATCTAAGAGGTTATACATGG + Intergenic
1113859862 13:113474410-113474432 ATGATGTAAGAGAAGATGGGGGG + Intronic
1115871157 14:37804255-37804277 ATTATGTCAGATATTATCAGTGG + Intronic
1117778684 14:59209143-59209165 AGTATTTAACAGATTATAGGAGG - Intronic
1118079086 14:62337389-62337411 CTAGTCTAAGAGATTATAGGGGG + Intergenic
1118352756 14:64985339-64985361 TGTATGTAGGAGATTATAGAAGG - Intronic
1118542897 14:66850243-66850265 ATTGTGTAAGAGTTTATATTTGG - Intronic
1122395197 14:101422573-101422595 ATTTTGGAAGAAATTATAGAAGG + Intergenic
1125047417 15:35258354-35258376 GTAATGTAAGACATTAAAGGAGG + Intronic
1126451946 15:48818111-48818133 GTTTTGTAAGATATTATTGGTGG - Intergenic
1127610916 15:60635461-60635483 ATTATGTAATAAATTGTAGGAGG + Intronic
1127613711 15:60662214-60662236 ATTAAGTAGGAGATTAGTGGTGG - Intronic
1127940091 15:63686219-63686241 ATTATGTAAGATAATATAAATGG - Intronic
1128748910 15:70134561-70134583 ATTATCGGAGACATTATAGGAGG - Intergenic
1129662821 15:77562561-77562583 ATTATGAAAAAGATCACAGGGGG - Intergenic
1129863702 15:78885158-78885180 ATTATATAAGAGGTCAGAGGTGG + Intronic
1131103835 15:89716199-89716221 ATTCTGTAATAGCTTAGAGGAGG - Intronic
1131712755 15:95073762-95073784 ATTCTGTAAAAGATTGTAGATGG - Intergenic
1133106706 16:3515340-3515362 ATAATGGAAGACATTATAGGAGG + Intronic
1133835702 16:9365591-9365613 TTTATGTAAGTTATAATAGGGGG + Intergenic
1134652711 16:15923127-15923149 ATTATTTAAAATATTATAGAAGG + Intergenic
1139069331 16:63360685-63360707 ATTATTTAAAAAATTCTAGGAGG - Intergenic
1141034790 16:80617781-80617803 TTTATGCAAGAGAGTAAAGGTGG - Intronic
1144801715 17:17933375-17933397 ACTAAGTAAGAGAATATAGCTGG + Intronic
1148377759 17:47164458-47164480 GTTATGTCAGATATTATTGGGGG - Intronic
1151085742 17:71378563-71378585 AGTTTGTAAGAGATTATACCAGG + Intergenic
1151859364 17:76748251-76748273 ATTATGTAAGCCAAGATAGGAGG + Intronic
1152310087 17:79544735-79544757 GTTATGTAAGAGCTTCGAGGAGG - Intergenic
1156559282 18:38103953-38103975 ATTAAATGAAAGATTATAGGAGG + Intergenic
1159446544 18:68547578-68547600 ATTATGTAAGAAACTATAGTTGG + Intergenic
1159846433 18:73466261-73466283 ATTATTTAACAAATTAAAGGAGG + Intergenic
1167297418 19:48659790-48659812 ATTATGTAACATTTTATTGGTGG + Intergenic
928741114 2:34353469-34353491 AATATGTAATAGTCTATAGGAGG - Intergenic
929130445 2:38563827-38563849 ATTGTGTAAGAGATTAATGCAGG - Exonic
930269526 2:49240101-49240123 ATTTTGAAAAAGACTATAGGAGG - Intergenic
931725357 2:65105018-65105040 CTGATGTTAGAGATCATAGGTGG - Intronic
932029422 2:68168167-68168189 CTTATTTAACAGGTTATAGGAGG + Intronic
932963548 2:76443610-76443632 AGTAGGTAAAAGATTACAGGTGG - Intergenic
934143900 2:89073510-89073532 ATTATGAACGATATTACAGGGGG - Intergenic
934225340 2:90127048-90127070 ATTATGAACGATATTACAGGGGG + Intergenic
935640205 2:105282955-105282977 ATTTTGTAAGAGAATAGATGTGG - Intronic
936907860 2:117557833-117557855 ATGTTGTAAGAGCTTAGAGGAGG + Intergenic
938880340 2:135579856-135579878 ATTTTGTAACACATTATAAGGGG + Intronic
939311682 2:140486922-140486944 ATTATGTATGATATTATAGATGG + Intronic
939533828 2:143399591-143399613 ATTATGAATGAGATAATACGTGG - Intronic
940278012 2:151959828-151959850 ATTATGCAAGATATTATAACAGG - Intronic
940333042 2:152496062-152496084 ATTATGTGAGACATTATTTGGGG - Intronic
940681330 2:156789045-156789067 ATATTGTAAGATATTACAGGGGG + Intergenic
940843703 2:158616307-158616329 ATTCTGGAAGAGAACATAGGTGG - Intronic
941002389 2:160215645-160215667 ATTATTTCAGAGATAAAAGGAGG - Intronic
941594894 2:167464040-167464062 ATTATATAAAAGATTAAAGATGG - Intergenic
942838062 2:180324792-180324814 ATTATGTTAGATACTATAGAAGG - Intergenic
943497790 2:188645888-188645910 ATTATGTAAGAAATTAAAACAGG + Intergenic
944406473 2:199390542-199390564 ATTATTGAAGATATTTTAGGGGG - Intronic
944407963 2:199406867-199406889 ATTATGAAAAAGAAGATAGGTGG + Intronic
946512808 2:220377927-220377949 TTTATGTGAGGGATTACAGGAGG - Intergenic
1168898088 20:1337777-1337799 ATTATGATAGAGATTAAAAGGGG - Intronic
1170667454 20:18399205-18399227 ATTAGGTAAGTTATTGTAGGTGG - Intronic
1171165346 20:22965491-22965513 ATAATGTAAGAGCAAATAGGAGG + Intergenic
1175744793 20:61448465-61448487 ATTATGAAGGAGATTGGAGGAGG - Intronic
1177614194 21:23495982-23496004 TTTATGTAAGTGATAATAGTAGG + Intergenic
1177672131 21:24246012-24246034 ATGAACTAAGAGATTTTAGGCGG - Intergenic
1181842113 22:25672567-25672589 TTTATGTAAGATATTTTAAGAGG + Intronic
1182190468 22:28455144-28455166 ATTTTGTTAGATGTTATAGGTGG - Intronic
1182526147 22:30921494-30921516 AAAATGTAAGAGAATATCGGGGG + Intergenic
1182949284 22:34356737-34356759 AGTATGTAGGAGATCATAGCAGG + Intergenic
949091644 3:36310-36332 ATTAAGTAAGAGATTCAAGTTGG - Intergenic
950296439 3:11836372-11836394 TTTATGTAACAGCTAATAGGTGG + Intronic
951656817 3:25018341-25018363 AGTTTGTGAGAGATTAGAGGGGG - Intergenic
955717709 3:61847886-61847908 ATTATGTAAGAGTTTAACAGTGG - Intronic
957992566 3:87645961-87645983 ACTGTGTAATAGATTATAAGAGG - Intergenic
959243028 3:103824296-103824318 ATTTTGTGAGAGAACATAGGAGG - Intergenic
959599181 3:108159883-108159905 ATTATGTAAGACATTTTACAAGG - Intergenic
959905398 3:111705578-111705600 ATTATGGAAGACAGTATGGGGGG - Intronic
960313382 3:116144890-116144912 ATTATGTAAAATAATATAGTTGG + Intronic
964037231 3:152214338-152214360 ATGAGGTAAGAAATTATAGGGGG + Intergenic
964578634 3:158204863-158204885 ATTATATAAAACATTATATGGGG + Intronic
965461677 3:168972885-168972907 ATTTTTGAAGAAATTATAGGAGG + Intergenic
967068228 3:185939274-185939296 ATTTCGTAAGAGAATATAGTTGG + Intergenic
967472886 3:189883476-189883498 ACTATGTAAGAATTAATAGGAGG - Intronic
972596608 4:40535096-40535118 ATTATGGAAGAGATCAAATGAGG + Intronic
972969545 4:44555822-44555844 ATTAGATAAAAGATTATAGCAGG - Intergenic
974632740 4:64515315-64515337 CTTATCTAAGAGAGTAAAGGTGG - Intergenic
975162190 4:71136780-71136802 ATTATTTCAGGGATTATAGAGGG - Intergenic
975623911 4:76323086-76323108 ATTAGATAAGAGAGTATAGCAGG + Intronic
975667591 4:76748259-76748281 ATTAAGTTAGAGATTATATATGG + Intronic
976012432 4:80507168-80507190 AGCATGTAAGAGATTGCAGGTGG + Intronic
979903737 4:126257176-126257198 ATTATGAAGGAGATAATAGAGGG - Intergenic
982905170 4:161059215-161059237 ATTATGGGAGAGATTTTAGCAGG - Intergenic
984241180 4:177221052-177221074 ATTATTTATGTGATTATAGTTGG + Intergenic
984579004 4:181488040-181488062 ATTATTTCAGAGATTCTAGAGGG + Intergenic
990618783 5:57537661-57537683 ATTATGTAGGAGTTCAGAGGAGG + Intergenic
990735028 5:58851020-58851042 GGTAGGTAAGAGATTAGAGGTGG - Intronic
990938925 5:61180764-61180786 ATTCTATAAGTGATTATTGGGGG + Intergenic
991335691 5:65544458-65544480 ATTATGGAAAATAGTATAGGTGG + Intronic
993506247 5:88712295-88712317 ATTATGTAAGAAATAGTAGTAGG - Intergenic
993706482 5:91177487-91177509 ATAATGTCAGAGATAAAAGGCGG - Intergenic
994319845 5:98381306-98381328 ATTATATTAGAGGTTATAGATGG + Intergenic
995174838 5:109164070-109164092 ATAATGTTTGAGATTATAGCTGG + Intronic
995266409 5:110166801-110166823 AATATCTAAGACATTAGAGGGGG - Intergenic
995431286 5:112080976-112080998 ATTATGTAACGGTATATAGGAGG + Intergenic
999476349 5:151902663-151902685 ATATTGTCAGAGATTATAGTAGG + Intronic
999552921 5:152709173-152709195 CTGATGTGAGAGATTATATGAGG - Intergenic
1000413729 5:160961470-160961492 ATAATGGAAGAGATTAGGGGAGG - Intergenic
1002014973 5:176313875-176313897 AAGAGGTAAGGGATTATAGGTGG + Intronic
1003488484 6:6600071-6600093 AATATGTAAGAGATCACTGGGGG + Intronic
1004435340 6:15587113-15587135 TATCTGTAAGACATTATAGGTGG - Intronic
1004435441 6:15588461-15588483 ATTATGTAATAAATTAGAGCAGG - Intronic
1004573145 6:16867540-16867562 AATATTTAATAGATAATAGGGGG - Intergenic
1005068282 6:21840294-21840316 ATTATGGCTGAGATTAAAGGAGG - Intergenic
1010110369 6:72221251-72221273 ATTATGTCAGAGATTATGGTAGG + Intronic
1010283218 6:74044298-74044320 ATTACATAGGAGATTATAGTTGG - Intergenic
1010730740 6:79388359-79388381 ATTATCTATGAGATTATACTTGG + Intergenic
1010745238 6:79553107-79553129 ATTATGTAAGTGATTCTCGTAGG - Intergenic
1013095290 6:106939406-106939428 ATTATGTACTAGATAATATGAGG + Intergenic
1013781936 6:113738419-113738441 TTTATGTAAAAGAATATTGGTGG - Intergenic
1013982247 6:116145488-116145510 CTTATTTAAGAGATTAAAGTGGG + Intronic
1014041620 6:116833744-116833766 ATTAAGTAAGAAATGCTAGGGGG - Intergenic
1014365831 6:120540549-120540571 AGTATGTATGAGAGTAGAGGTGG + Intergenic
1015174232 6:130288977-130288999 ATGAAATAAGAGATTATAGAAGG - Intronic
1015597332 6:134878234-134878256 ATTATCTGACAAATTATAGGTGG + Intergenic
1016629600 6:146213060-146213082 ATTCTGTAAGAGAATATATGGGG + Intronic
1018490014 6:164282761-164282783 ATTAAGTAAAAGATTCCAGGAGG - Intergenic
1021864835 7:24945086-24945108 ATTACTTAAGATAATATAGGTGG - Intronic
1030816968 7:114050451-114050473 ATTACTTAAGACATTATGGGTGG - Intronic
1030919811 7:115368956-115368978 ATTATGTCAGAAAATAGAGGAGG + Intergenic
1030968184 7:116019780-116019802 ATCAGATAAGAGATTATAGAAGG - Intronic
1031780719 7:125959902-125959924 ATTATGTAGGAAATTATATTCGG - Intergenic
1033006284 7:137567932-137567954 ATAATGGAAGAGGTTGTAGGTGG + Intronic
1034061438 7:148094964-148094986 AATATTTAAGAGATAATAAGAGG + Intronic
1035610301 8:957824-957846 ATTATGAAAGAAATTATATATGG + Intergenic
1036914830 8:12795277-12795299 CTTATGTAAGAGCTTAGATGTGG - Intergenic
1038576786 8:28711470-28711492 ATTAAGTAAGATATTATAGATGG - Intronic
1040547731 8:48412653-48412675 ATCATGTAAGAAATTAAAAGTGG - Intergenic
1041748134 8:61231619-61231641 ATTATTTAAGATATTATGGATGG + Intronic
1044454556 8:92377982-92378004 ATTCTGTAATTGATTAGAGGTGG + Intergenic
1046089911 8:109489489-109489511 ATTCTGAAAGAGATTATAAAAGG + Intronic
1047870160 8:129073467-129073489 ATTCTATCAGAGATTATCGGAGG - Intergenic
1052066371 9:24026269-24026291 ATTATGTCACAAATTATAGATGG - Intergenic
1052516394 9:29486116-29486138 TTTATGTCAGACATTATTGGGGG - Intergenic
1053485930 9:38456308-38456330 ATAATGTAAGACATTTTAGAAGG - Intergenic
1057382567 9:94582318-94582340 CATATTTAACAGATTATAGGAGG - Intronic
1057734950 9:97648391-97648413 ATTATGCAAGAAATTATATTTGG + Intronic
1058185981 9:101855411-101855433 GTTATCTAGGAGATTATAGAGGG - Intergenic
1058267698 9:102926388-102926410 ATTATGAATGAGATTTTAGAGGG + Intergenic
1061340357 9:129975467-129975489 TTTATGGAATAAATTATAGGTGG - Intronic
1188344582 X:29047900-29047922 ATTATGTAAGAGATTATAGGGGG - Intronic
1188965796 X:36549327-36549349 GATGTGTAACAGATTATAGGTGG + Intergenic
1189152356 X:38721372-38721394 ACTATGAAAGTCATTATAGGAGG + Intergenic
1189176946 X:38967034-38967056 ATTTTGTATGAGATGACAGGAGG + Intergenic
1189695713 X:43659781-43659803 ATTATGTCAAAAATTATAGAAGG - Intronic
1189724132 X:43951588-43951610 ATGATGTCAGAGATAATAGCTGG - Intronic
1190453638 X:50604762-50604784 AATAGGGAAGTGATTATAGGTGG + Intronic
1192108917 X:68344313-68344335 TTTATGTAAGAAATAATAGCTGG + Intronic
1193871267 X:86801643-86801665 CTCATGAAAGAGTTTATAGGAGG + Intronic
1194241847 X:91458923-91458945 ATTATGTGATAGATTATTGTAGG + Intergenic
1194705824 X:97174373-97174395 ATTATGTTAGAAATTATACTTGG + Intronic
1195493383 X:105500670-105500692 GTTATGTAAGAGATTAAATCAGG - Intronic
1195958914 X:110364818-110364840 ATCATCTAAGAGCTTACAGGGGG + Intronic
1197387346 X:125817365-125817387 ATCTTGTAAGAGATAATTGGAGG + Intergenic
1197985356 X:132260959-132260981 ATTATGTAAAACAGTATAGAAGG + Intergenic
1198408667 X:136342977-136342999 ATTATGGAACAGATTAGAGGGGG + Intronic
1198812673 X:140551524-140551546 ATTAGGTAATTGATTATTGGGGG - Intergenic
1199521674 X:148742433-148742455 ATTATGTATGAGTTTGTAGGAGG + Intronic
1199700428 X:150371451-150371473 ATTTTGGAAGAGATCATTGGAGG + Intronic
1200544527 Y:4503484-4503506 CTGGAGTAAGAGATTATAGGTGG - Intergenic