ID: 1188346792

View in Genome Browser
Species Human (GRCh38)
Location X:29077216-29077238
Sequence GGGAGTACACAGATTTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188346792 Original CRISPR GGGAGTACACAGATTTGGCT GGG Intronic
900161449 1:1226015-1226037 GGCAGAACACAGATGTGACTGGG + Intronic
907906201 1:58784926-58784948 GGGGGTTCACAGCTTTGCCTCGG + Intergenic
916832270 1:168505207-168505229 GGGACTAGACAGACTGGGCTTGG + Intergenic
922053543 1:222018364-222018386 GGGAGTGCAATGTTTTGGCTGGG - Intergenic
923472734 1:234306738-234306760 GGTAGGGCACAGATATGGCTTGG - Intronic
1069882375 10:71601898-71601920 GGGAGAACAGAGATCTGCCTGGG - Intronic
1071586744 10:86830318-86830340 GGAAGTACACAGATAGGCCTGGG + Intronic
1074954896 10:118379231-118379253 GGGAGTACACAGCTACGACTGGG + Intergenic
1076392838 10:130116506-130116528 GTGAGTACAGAGCTTTCGCTTGG + Intergenic
1077331958 11:1987769-1987791 GGGAGCAGACAGACTGGGCTGGG - Intergenic
1078310225 11:10233401-10233423 GGCAGTACAAAGATTTTGGTGGG - Intronic
1079513790 11:21242485-21242507 GGGAGAACACAGATATTGTTTGG + Intronic
1079526681 11:21398458-21398480 GGGAGTAGACACTTTTGTCTTGG + Intronic
1080136486 11:28860544-28860566 AGGACTGGACAGATTTGGCTAGG - Intergenic
1084098212 11:66927311-66927333 GGGAGTACACTGGTGTGGCTGGG - Intronic
1087177944 11:95112153-95112175 GGGAGGAGAAAGCTTTGGCTAGG - Intronic
1087660966 11:100987513-100987535 AGGAGTACATGGCTTTGGCTTGG - Exonic
1087814993 11:102648586-102648608 GTGAGAACATAGATTTGGCATGG + Intergenic
1087827920 11:102787171-102787193 AAGAGTACTCAGATTTGGCAAGG - Intergenic
1202814939 11_KI270721v1_random:42945-42967 GGGAGCAGACAGACTGGGCTGGG - Intergenic
1091636611 12:2201906-2201928 GGGAGTGCCCAGATTTTGTTTGG - Intronic
1095674215 12:44897757-44897779 GGGAGTAAACAGTTCTGTCTCGG - Intronic
1096449087 12:51722061-51722083 GGAAGAACACAGAAATGGCTGGG - Intronic
1099443257 12:82723825-82723847 TGTAGTACACAGAGTAGGCTAGG - Intronic
1100950377 12:99842427-99842449 GGAAGTACACAGATGGGCCTAGG - Intronic
1102637480 12:114336756-114336778 GGAAGTACACAGATTGGCCCAGG - Intergenic
1104346384 12:128003427-128003449 GAGAATACACAGAATTGGCCAGG + Intergenic
1107409089 13:40141803-40141825 GGGACCACACAGGTTTGCCTGGG + Intergenic
1107594314 13:41946834-41946856 GGAAGTACACAGGTGTGTCTAGG - Intronic
1108701876 13:52950658-52950680 GGGAATAGACAGTTTTGGCTAGG - Intergenic
1108903209 13:55437918-55437940 AGGAATACACAGATTTTGTTTGG - Intergenic
1110006087 13:70272148-70272170 GGGAAGACACAGATTAGGATAGG + Intergenic
1113102788 13:106738241-106738263 GGAAGTACACACATTTGGGCCGG + Intergenic
1114035575 14:18623990-18624012 AGGAGTACATGGCTTTGGCTTGG + Intergenic
1114123062 14:19691032-19691054 AGGAGTACATGGCTTTGGCTTGG - Intergenic
1114455494 14:22850928-22850950 AGGTGTACTCAGATTTGGGTTGG - Intergenic
1115013164 14:28575110-28575132 GGGATTACACAGCTTAGTCTAGG - Intergenic
1115437015 14:33386765-33386787 GGAAGTTCACAGATTTTGCAAGG + Intronic
1117152739 14:52905758-52905780 GGGAGCACAGAGATTTGGAAAGG + Intronic
1117744463 14:58854204-58854226 GGGAGTACAGAGATCGGGCCGGG - Intergenic
1119168265 14:72513720-72513742 GGGAGGACAAAGATTTGTGTAGG - Intronic
1119928934 14:78525519-78525541 GGCAGTGCACAGATAGGGCTGGG - Intronic
1119971482 14:78975527-78975549 AGGAGGACAGAGATTTGGGTTGG + Intronic
1121421841 14:93821465-93821487 GAGAGGACACAGATCTGCCTAGG + Intergenic
1122386386 14:101351145-101351167 GGGAGGACACACATTTTGTTGGG - Intergenic
1129902210 15:79159703-79159725 GGGGGTAATCAGATTTGTCTTGG + Intergenic
1131358749 15:91770268-91770290 GGAAGGACACAGATTTGTCAGGG + Intergenic
1132177567 15:99727560-99727582 GAGAGCACAGACATTTGGCTGGG + Exonic
1133356711 16:5142156-5142178 GGAAGAACACAGTCTTGGCTAGG + Intergenic
1134235369 16:12460934-12460956 AGAAGTTCACACATTTGGCTGGG - Intronic
1135716987 16:24779782-24779804 GGGAGAACATAGTGTTGGCTTGG + Intronic
1135758564 16:25118208-25118230 GGAAGTACACAGAGCAGGCTGGG - Intronic
1135895109 16:26393783-26393805 GGGGTTAGACAGATTTGGATTGG + Intergenic
1138314086 16:56053342-56053364 GGAAGAACACAGATTTAGATGGG + Intergenic
1147845938 17:43403888-43403910 GGGAGTACAAAGACCTGGCCTGG - Intergenic
1147855685 17:43478007-43478029 GGGAGGACTCAGACTTGGCATGG + Intergenic
1150068909 17:62135855-62135877 GGGAGTACACAGTTCTGTTTAGG + Intergenic
1154149688 18:11896597-11896619 GGGAGGACACAGATGTGGGTTGG - Intronic
1157461121 18:47894933-47894955 CGAAGTAAACAGATTTGGCATGG - Intronic
1159140916 18:64393173-64393195 GGAAGTTCACAGATGTGCCTAGG - Intergenic
1159547741 18:69861391-69861413 TGGAGTACACAGTTTTGTCAGGG - Exonic
1162979847 19:14231558-14231580 GGGAGTAAACGGATGGGGCTGGG - Intergenic
1163762148 19:19143318-19143340 TGGAGTTCACAGATTTGGACAGG - Intergenic
1165046946 19:33112264-33112286 GGGATTAAAAATATTTGGCTCGG - Intronic
1167195479 19:48025308-48025330 GGGAAATCACAGATTTGGGTGGG + Intergenic
1167667255 19:50830047-50830069 GTGACTCCACAGATCTGGCTTGG - Intronic
1167792885 19:51691879-51691901 GGGAGGACAGAGATGGGGCTGGG + Intergenic
1168630284 19:57950728-57950750 GAGGGCACACACATTTGGCTGGG + Intergenic
925773783 2:7311435-7311457 AGAGGTAGACAGATTTGGCTTGG - Intergenic
927281548 2:21313093-21313115 GGGAGTAAATAGATTAGCCTTGG - Intergenic
927500953 2:23582834-23582856 GGGTGGACATATATTTGGCTGGG - Intronic
928252497 2:29694087-29694109 GGGAGTCCCAAGATTTGGCTTGG + Intronic
931936671 2:67205774-67205796 GGGAGTATACAGGTTTGGGGTGG - Intergenic
932396333 2:71451332-71451354 TGGAGAAAACAGTTTTGGCTCGG - Intergenic
933037497 2:77418829-77418851 AGGAGTACACAGATGTGGCTTGG - Intronic
937658430 2:124403551-124403573 AAAAGTACACATATTTGGCTTGG + Intronic
938182874 2:129199543-129199565 GGAAGTACACAGATGGGCCTAGG - Intergenic
938274822 2:130008960-130008982 AGGAGTACATGGCTTTGGCTTGG - Intergenic
938440550 2:131328318-131328340 AGGAGTACATGGCTTTGGCTTGG + Intronic
946494739 2:220184476-220184498 GGAAGTACACAGATGGGCCTGGG - Intergenic
947192319 2:227519948-227519970 GTCTGTAAACAGATTTGGCTAGG + Exonic
948056994 2:235016007-235016029 TGGGGGACACACATTTGGCTGGG + Intronic
1172639031 20:36430013-36430035 GGGAGTACCAAGACTTGGTTTGG - Intronic
1175382992 20:58576583-58576605 GGGAGGACACAGCACTGGCTGGG + Intergenic
1176044858 20:63087325-63087347 GGGTGTACACAGATGCGTCTGGG + Intergenic
1177168802 21:17632918-17632940 GAGGGTGCTCAGATTTGGCTAGG + Intergenic
1179111364 21:38448701-38448723 GGGAGGACAAAGATGTGGCAGGG - Intronic
1180177953 21:46099101-46099123 GGGATAACACAGCTCTGGCTTGG + Intronic
1180459697 22:15551044-15551066 AGGAGTACATGGCTTTGGCTTGG + Intergenic
1181298011 22:21857610-21857632 AGAAGTACAAATATTTGGCTTGG - Intronic
1182320565 22:29476222-29476244 GGGACTACACAGCTCGGGCTGGG + Intergenic
1184910833 22:47532885-47532907 GGAAGTGCACAGATGGGGCTAGG + Intergenic
1184997792 22:48223164-48223186 GGGAGGCCACAGATTGAGCTGGG + Intergenic
949392915 3:3582677-3582699 GGCAGTACATACATTTGTCTTGG - Intergenic
949915873 3:8964078-8964100 GGAAGTACACAGATTGGCCTAGG - Intergenic
953067955 3:39492021-39492043 GTGACTGCACAGCTTTGGCTGGG + Intronic
956706933 3:72007221-72007243 GGAAGTACACAGATGGGGCCAGG - Intergenic
957404228 3:79756254-79756276 AGAAGTACACATATTGGGCTGGG + Intronic
958168902 3:89914505-89914527 GGGAGCACACAGATTAGCCAGGG + Intergenic
958778334 3:98511749-98511771 TGGAGTAAACAGACCTGGCTTGG - Intronic
958873159 3:99585018-99585040 AGGTGAACACAGATTTGACTTGG - Intergenic
962473862 3:135738824-135738846 GGGAGATCTCAGATTTGGCTAGG - Intergenic
963437490 3:145289529-145289551 TGGAGTACACAGCTTTAGCTTGG + Intergenic
965613801 3:170572119-170572141 AGGAGTTCACAGATTTGGTATGG - Intronic
967367640 3:188705806-188705828 GGGGTTTCACAGTTTTGGCTAGG + Intronic
969850072 4:9948970-9948992 GGAAGTACACAGATGGGCCTAGG - Intronic
972358684 4:38305993-38306015 GCGAGTACAAAGCCTTGGCTAGG - Intergenic
972950484 4:44316516-44316538 GTGAGAAAACACATTTGGCTCGG - Intronic
973129951 4:46638030-46638052 GGGAGTTAACAGTGTTGGCTGGG - Intergenic
974494839 4:62614201-62614223 GTGAGGACACAGATTTGGAGGGG - Intergenic
980933019 4:139199413-139199435 GGAAGTACACAGATGAGCCTAGG - Intergenic
982022649 4:151219107-151219129 GGAAGTACACAGATGGGACTAGG - Intronic
982489177 4:156006944-156006966 GGGAGCACCCAAATCTGGCTTGG + Intergenic
983576792 4:169270157-169270179 GGGAGTAAAAAGATTTGGCTGGG + Intronic
984719882 4:182959638-182959660 GGAAGTACACAGATGGGCCTAGG + Intergenic
985918784 5:2949618-2949640 GGGAGTACATTCATTTGCCTTGG + Intergenic
990200045 5:53361862-53361884 GGGAGTTCACAGTTTTTGTTAGG - Intergenic
991140467 5:63234947-63234969 GGGAGCAGTCAGTTTTGGCTGGG + Intergenic
991257811 5:64634351-64634373 GGAAGTACACAGATGGGCCTAGG + Intergenic
992480584 5:77147828-77147850 CGGACTTCAGAGATTTGGCTGGG - Intergenic
994411522 5:99412270-99412292 GGTATTACAAAGATTTGGCAGGG - Intergenic
994482306 5:100352979-100353001 GGTATTACAAAGATTTGGCAGGG + Intergenic
995283798 5:110364234-110364256 GCAAGTACACAGATGGGGCTAGG - Intronic
995560415 5:113375054-113375076 GGGAGTACATAGCTGTGGTTGGG - Intronic
995774163 5:115707646-115707668 GGGAGTCCACAGACCTGGCTGGG + Intergenic
998063246 5:139135606-139135628 GGGAGTACAGAGAAAGGGCTAGG - Intronic
1001866289 5:175108516-175108538 TGGAGTAAACAGACTTGTCTGGG + Intergenic
1003423377 6:5978133-5978155 GAGAGTAAACATATTTGGCCGGG + Intergenic
1005476787 6:26215789-26215811 AGGAGTTAACAGATTTGCCTGGG - Intergenic
1007759973 6:44127856-44127878 TGGAGGACTCACATTTGGCTCGG - Intronic
1008683954 6:53903666-53903688 TGGAGTGCACAGATGTGGGTGGG + Intronic
1012328800 6:97958528-97958550 GGGACTACCCAGCTTTGGGTAGG - Intergenic
1014004146 6:116397570-116397592 GGCAGCACACAGAAATGGCTGGG - Intronic
1016480894 6:144480163-144480185 AGGAGTCCACATATTTGGCTTGG + Intronic
1016758923 6:147716267-147716289 GGGTGTGCACACATCTGGCTGGG + Intronic
1019214078 6:170431083-170431105 GTGAGTACACATTTTTGCCTGGG - Intergenic
1022378841 7:29841029-29841051 GGGAGTGCACAGATGGGCCTGGG + Intronic
1023166884 7:37351721-37351743 GGCAGTAAACAGATATGGTTAGG - Intronic
1025862921 7:65349317-65349339 AAGAGCACACAGATTTGGCTGGG - Intergenic
1026275533 7:68872543-68872565 GGGAGGACACAGCTTTTGCAAGG - Intergenic
1027546638 7:79535116-79535138 TGGTGGACAGAGATTTGGCTAGG + Intergenic
1030056924 7:105591271-105591293 GAGAGTACACAGCTTCTGCTTGG + Intronic
1030196664 7:106859485-106859507 GGAAGGAAACAGATTTGGTTCGG + Intergenic
1032801346 7:135319533-135319555 AGGAGAAGACAGATTAGGCTTGG + Intergenic
1033661316 7:143405068-143405090 GGGAGTTCAAAGATTGGGCAAGG + Intronic
1034432993 7:151050260-151050282 GGGAGCACACAAATGAGGCTGGG + Intronic
1035862665 8:3046764-3046786 GTGAGCACACAGATGTGGCTGGG - Intronic
1038424777 8:27458065-27458087 GGGCTTACACAGGGTTGGCTGGG + Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1042182857 8:66109281-66109303 GGGAGGACACAGGATTGGGTAGG - Intergenic
1042584307 8:70318329-70318351 GGAAGTACACAGATGAGCCTAGG - Intronic
1044188246 8:89282177-89282199 AGGGGTACACTGATTTGGCCTGG - Intergenic
1047757241 8:127928084-127928106 GGAAGTACACAGATGGGCCTAGG - Intergenic
1056036042 9:82606912-82606934 GGGAGTAGTCAGATTTAGCAGGG + Intergenic
1059327639 9:113513925-113513947 GGGAGGAAACAGATTGGGCTGGG + Intronic
1060013534 9:120065880-120065902 GGAAGTACACAGATGTGCCTTGG + Intergenic
1061350003 9:130056628-130056650 GAAAGTTCACAAATTTGGCTGGG + Intronic
1061691115 9:132331800-132331822 GGGACTACAAAGTTTTGGCAGGG - Intronic
1185994669 X:4932333-4932355 GGGAATACACAGATCTCTCTGGG - Intergenic
1188346792 X:29077216-29077238 GGGAGTACACAGATTTGGCTGGG + Intronic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1195011639 X:100737916-100737938 GGGAGTTCACAGAATGGGGTAGG + Intergenic
1195914721 X:109924795-109924817 GGGAGTAGACAGATCTCACTAGG - Intergenic