ID: 1188347355

View in Genome Browser
Species Human (GRCh38)
Location X:29083434-29083456
Sequence CTGGCCATGAAATGTGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188347355_1188347358 -9 Left 1188347355 X:29083434-29083456 CCTGAAACACATTTCATGGCCAG 0: 1
1: 0
2: 2
3: 23
4: 149
Right 1188347358 X:29083448-29083470 CATGGCCAGCACCAAGGTAAGGG 0: 1
1: 0
2: 1
3: 11
4: 215
1188347355_1188347357 -10 Left 1188347355 X:29083434-29083456 CCTGAAACACATTTCATGGCCAG 0: 1
1: 0
2: 2
3: 23
4: 149
Right 1188347357 X:29083447-29083469 TCATGGCCAGCACCAAGGTAAGG 0: 1
1: 0
2: 2
3: 18
4: 202
1188347355_1188347364 29 Left 1188347355 X:29083434-29083456 CCTGAAACACATTTCATGGCCAG 0: 1
1: 0
2: 2
3: 23
4: 149
Right 1188347364 X:29083486-29083508 TATAGAAACATGTACTGTGAAGG 0: 1
1: 0
2: 0
3: 24
4: 251
1188347355_1188347359 -8 Left 1188347355 X:29083434-29083456 CCTGAAACACATTTCATGGCCAG 0: 1
1: 0
2: 2
3: 23
4: 149
Right 1188347359 X:29083449-29083471 ATGGCCAGCACCAAGGTAAGGGG 0: 1
1: 0
2: 1
3: 13
4: 171
1188347355_1188347365 30 Left 1188347355 X:29083434-29083456 CCTGAAACACATTTCATGGCCAG 0: 1
1: 0
2: 2
3: 23
4: 149
Right 1188347365 X:29083487-29083509 ATAGAAACATGTACTGTGAAGGG 0: 1
1: 0
2: 3
3: 20
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188347355 Original CRISPR CTGGCCATGAAATGTGTTTC AGG (reversed) Intronic
901238537 1:7680167-7680189 CTGGCCATGAACTTTGCGTCCGG + Intronic
902212350 1:14913164-14913186 CTGCCCATGCCTTGTGTTTCAGG + Intronic
907392832 1:54169499-54169521 CTGAGCATGAACTGTGTTCCAGG - Intronic
912428281 1:109613425-109613447 CTGGCCAGGAAATTTGTTTTGGG + Exonic
915007686 1:152655418-152655440 CTGCCTATAAAATGTGTGTCAGG + Intergenic
917556231 1:176092285-176092307 CTGACCATGTAATATGTTACTGG + Intronic
918925825 1:190784221-190784243 GTAGCCATGAGATGTGTCTCTGG - Intergenic
919121839 1:193350931-193350953 TTTGCCATGTCATGTGTTTCAGG + Intergenic
919477490 1:198047056-198047078 CAGGACATGAAATGTTCTTCAGG - Intergenic
919574155 1:199285931-199285953 TTGCCCCTGAAATGTATTTCTGG - Intergenic
921807097 1:219467564-219467586 CAGGCACTGAAATGTGTTTTGGG - Intergenic
923433987 1:233951052-233951074 CTGGACATGAAAAGCATTTCTGG - Intronic
923921497 1:238569460-238569482 TGGGCCATGCATTGTGTTTCGGG - Intergenic
1066532837 10:36358916-36358938 CTGGCTTTGAAATGAGTTTGAGG + Intergenic
1067067928 10:43113968-43113990 CTGACCTTGAAATGTGTTCCTGG - Intronic
1070543483 10:77434438-77434460 CTGGCCTTGAGATGTGTGTCGGG - Intronic
1070983891 10:80671708-80671730 CTGGGCACTAAATGTGTGTCAGG + Intergenic
1073319042 10:102602842-102602864 CCAGCCATGAAATCTGTATCTGG + Intronic
1073322412 10:102623442-102623464 GTGGCCAGGAAATGTGTGGCTGG + Intronic
1074129364 10:110559631-110559653 CTTGCAATGAAATATGTTTTTGG - Intergenic
1074708385 10:116156505-116156527 TGGCCCATGCAATGTGTTTCTGG + Intronic
1078582781 11:12551642-12551664 CTGGACATGCCATGTGGTTCTGG + Intergenic
1084488658 11:69465738-69465760 CTGGGCATGAAAAGTTTTTCAGG + Intergenic
1085577358 11:77618590-77618612 CTGACCATGAATTGTGATACTGG - Intronic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1092493138 12:8964932-8964954 CTGCACATGAGATGGGTTTCCGG + Intronic
1095268117 12:40183746-40183768 ATGCCCAAGAAATGTATTTCGGG - Intergenic
1101150064 12:101876333-101876355 GCGCCCATGAAATGTGTTTGTGG + Intergenic
1101188553 12:102307091-102307113 AGGGCCAGGAAATGGGTTTCTGG - Intergenic
1102333867 12:112060103-112060125 CTGGCCAAGACAGGTTTTTCTGG + Intronic
1102666206 12:114575454-114575476 CAAGACATGAAATGTATTTCTGG - Intergenic
1103539783 12:121658264-121658286 CTGAATATTAAATGTGTTTCAGG + Intronic
1104402883 12:128491354-128491376 CTGTCCATGAATTTTGCTTCCGG + Intronic
1105620112 13:22058525-22058547 CTGGCCAGGAGATGTGGCTCTGG - Intergenic
1106922183 13:34575295-34575317 CTGACACTGAAATGTGTTTCTGG + Intergenic
1110627291 13:77665470-77665492 CTGGGCACCAACTGTGTTTCAGG + Intergenic
1114382593 14:22223692-22223714 CTGGCCATATGATGTGGTTCTGG - Intergenic
1115059384 14:29171263-29171285 CTGGCAATAAAATGTGTATTGGG - Intergenic
1115314921 14:32015436-32015458 CTGGCCATGAAATGGCTGGCTGG - Intronic
1118350334 14:64969135-64969157 ATGGTCATGTAATGTGTTTTAGG + Intronic
1119248028 14:73129774-73129796 CTGGGCATAAGATGTGGTTCAGG + Intergenic
1120200742 14:81535404-81535426 ATGGCCATGATATGTGATTCAGG - Intergenic
1124510637 15:30321411-30321433 CTGCTCATGAAACCTGTTTCTGG + Intergenic
1124732251 15:32209116-32209138 CTGCTCATGAAACCTGTTTCTGG - Intergenic
1124993920 15:34704156-34704178 CTGGCCATAAAGTTTGGTTCAGG + Intergenic
1125144202 15:36447397-36447419 CTGAGCTTAAAATGTGTTTCGGG - Intergenic
1127118442 15:55750012-55750034 CTGAGCATAAAATGTGTTTCAGG + Intergenic
1127630979 15:60827547-60827569 CTGGCCATGCAGTGTGGTTCAGG - Intronic
1127846911 15:62878160-62878182 CTGGCAATGGCAGGTGTTTCTGG - Intergenic
1128491047 15:68144872-68144894 CTGGCCATGAAATCTGAGTACGG - Intronic
1130048574 15:80464785-80464807 CTGGCCATGAAGGATGTTCCTGG + Intronic
1133545411 16:6801634-6801656 TTGGGCAGGAAAGGTGTTTCTGG + Intronic
1134768828 16:16786272-16786294 CTGGACATAAAATGTGTGCCAGG - Intergenic
1138203526 16:55107541-55107563 CAGGCCCTGAGATGTGGTTCAGG + Intergenic
1140265695 16:73418494-73418516 CTGACAATGAAATGTGTTCTTGG + Intergenic
1143895938 17:10136267-10136289 CAAACCATGAAATCTGTTTCTGG + Intronic
1156742245 18:40345552-40345574 TTGGCCACGAAATGTGTTCCTGG + Intergenic
1158802633 18:60930670-60930692 ATGGCCATGAACTGTTTTTTGGG + Intergenic
1161875339 19:6904204-6904226 TTGGCAATGGAATCTGTTTCTGG + Intronic
1162045272 19:7995462-7995484 CAGGCCATGATGTGTGTTTCAGG - Intronic
1162181626 19:8873047-8873069 ATGGCCATGAAAACTGTTCCAGG - Intronic
1163776670 19:19222788-19222810 CTGGCCTGGAAATGTGGTCCTGG - Intronic
1163873513 19:19845944-19845966 CTGGCCATAAACTGTGGCTCAGG - Intergenic
1163881339 19:19924920-19924942 CTGACCATAAACTGTGGTTCAGG + Intronic
1163903472 19:20129314-20129336 CTGGCCATGAACTGTGGCTCAGG - Intergenic
1163911964 19:20203581-20203603 CTGGCCATGAACTGTGGCTCAGG - Intergenic
1163925134 19:20333723-20333745 CTGGCCATGAACTGTGGCTCAGG + Intergenic
1163959956 19:20680240-20680262 CTGGCCATGAACTGTGGCTCAGG + Intronic
1164113322 19:22191506-22191528 CTGGCCATGAACTGTGGCTTAGG - Intronic
1164134392 19:22400279-22400301 CTTGCCATGAACTGTGGCTCAGG - Intronic
1164164420 19:22656494-22656516 CTTGCCATGAACTGTGGCTCAGG + Intronic
1164197719 19:22985803-22985825 CTGGCCATGAACTGTGGCTTAGG - Intronic
1164253242 19:23503361-23503383 CCGGCCATGAACTGTGGCTCAGG - Intergenic
1164285351 19:23810639-23810661 CCGGCCATGAACTGTGGCTCAGG + Intronic
1164297175 19:23922343-23922365 CTGGCCATGAACTGTGGCTCAGG + Intronic
1165541415 19:36495188-36495210 CTTACCATTAAAAGTGTTTCGGG + Intergenic
1166322116 19:42024978-42025000 CTGGACATGTCATGTGTTTCTGG + Intronic
925404013 2:3594147-3594169 CTGGCCCTGAAATGTCTTTCTGG + Intergenic
929457664 2:42077525-42077547 CTGCCCATGTCATGGGTTTCAGG - Intergenic
929862469 2:45691426-45691448 CTGTCCATCAAAGGTTTTTCTGG + Intronic
930636222 2:53808689-53808711 CTGGCAATCATATGTGATTCTGG + Intronic
930826639 2:55702227-55702249 CTGGCCATGATATGGGTTATAGG + Intergenic
931818941 2:65932398-65932420 CTGGCTTTGAAATGTGTACCTGG - Intergenic
932044379 2:68332796-68332818 CTGGCCATCAGCTGAGTTTCTGG - Intergenic
932437300 2:71710066-71710088 CTGCCCAGGAAATGTGGTCCAGG + Intergenic
933451222 2:82454755-82454777 CTGGAAATGGAATGTTTTTCTGG - Intergenic
937222828 2:120351938-120351960 CTTGCCATGAGATGTATGTCGGG + Intergenic
938370804 2:130767290-130767312 GCAGCCATGAAATGGGTTTCTGG + Exonic
939098140 2:137860061-137860083 ATGGGCATGAAGTTTGTTTCAGG + Intergenic
943400198 2:187399213-187399235 CTGGGCATGGAATGTGCTTTGGG - Intronic
943986196 2:194622259-194622281 CTGTCCATGAAATATGGTGCCGG - Intergenic
947834598 2:233166367-233166389 CTGCTCATGCAATGTGTGTCAGG - Intronic
947904004 2:233746466-233746488 ATGTCCATGGAAAGTGTTTCTGG - Intronic
948358481 2:237399681-237399703 TAGCCCATGAAATGTGTTTGGGG - Intronic
948422046 2:237865662-237865684 ATGGCCAAGAGAGGTGTTTCTGG + Intronic
1170182091 20:13543300-13543322 GTGGCCAAGAAATCTTTTTCTGG - Intronic
1170742835 20:19073084-19073106 CTGGCCATGAGATGTGGGACAGG + Intergenic
1173671786 20:44804018-44804040 CTGGGCATGAAATGAGATCCTGG - Intronic
1174333813 20:49843121-49843143 GTGGCCATGAATTGTGATTGGGG + Intronic
1174750281 20:53105176-53105198 GTGGCCACGAAATGAGTTCCGGG - Intronic
1177770598 21:25511121-25511143 CTGGCCATGAAATGTGGCCTTGG + Intergenic
1182248824 22:28983281-28983303 CTGGCAATGAAATGTGGCCCAGG + Intronic
1184471746 22:44699972-44699994 CTGGCCATGAAATTTGGTTTGGG + Intronic
953695655 3:45156513-45156535 CTGGACATTAAATGTGATTAAGG - Intergenic
956590113 3:70905724-70905746 CTGGCCATGATTTTTCTTTCTGG - Intergenic
956890825 3:73612641-73612663 CTGGCTGAGAAATGTGTTTTGGG + Intronic
957402122 3:79729909-79729931 TGGGCCATAAAATATGTTTCTGG - Intronic
961432305 3:126891714-126891736 TTGGGCTTGAAATGTGTTTGGGG + Intronic
962554713 3:136536319-136536341 CTGGTCATATAATTTGTTTCTGG - Intronic
962979672 3:140476606-140476628 CTGAACTTGAAATCTGTTTCTGG - Intronic
964822913 3:160793514-160793536 CAGGCCTTCAAATGTGTTTTGGG + Intronic
965129437 3:164676964-164676986 TTGGCCCTAAAATGTGCTTCAGG - Intergenic
966234041 3:177681054-177681076 CTGGTCATGAAGTGTTGTTCTGG - Intergenic
969548612 4:7848801-7848823 CTGCCCATGAAACTAGTTTCTGG - Intronic
970234721 4:13946755-13946777 CTGGGCATTAATTGTGTGTCAGG + Intergenic
973140407 4:46760551-46760573 CTGGTCATGAAATGGGGGTCTGG + Intronic
975712189 4:77171838-77171860 CTGGCCACTTAATATGTTTCAGG + Intronic
976733491 4:88287307-88287329 CTGGCCATGAATTATTTTTGTGG - Intergenic
982618555 4:157674905-157674927 CTGGGCATGAGATGTCTTGCTGG - Intergenic
982631147 4:157830905-157830927 CTTGTGATGAAATGGGTTTCTGG - Intergenic
982698356 4:158630226-158630248 CTGACCACCAAAAGTGTTTCAGG - Intronic
983817312 4:172147388-172147410 TTGGCCATGAAATTTGTTAAAGG + Intronic
985311668 4:188608014-188608036 CTGGCTATAAGATGTGTCTCTGG - Intergenic
990718905 5:58670939-58670961 CTGGCCATCATATGTTTTTCAGG + Intronic
991933932 5:71783275-71783297 CTGGCCGGGAATTGAGTTTCTGG + Intergenic
993379293 5:87187583-87187605 CTGGCAATGAAAGGTGTTTGAGG - Intergenic
994186637 5:96822577-96822599 CTGGCCAAGAAATATTTTACAGG - Intronic
996380709 5:122860159-122860181 ATGGCAAAGAAACGTGTTTCAGG + Intronic
996539778 5:124617935-124617957 CTGGCCATAATGTGTGGTTCAGG - Intergenic
997479935 5:134177213-134177235 CTGGCCTAGAAAGGTCTTTCAGG + Intronic
997525010 5:134547182-134547204 AAGGCCATGTGATGTGTTTCTGG + Intronic
999614020 5:153402806-153402828 CTGGTTATAAAATGTGATTCTGG + Intergenic
999964834 5:156798294-156798316 CTTGCCACTAAACGTGTTTCAGG - Intergenic
1002585396 5:180243694-180243716 CCGCTCAGGAAATGTGTTTCTGG + Intronic
1006896787 6:37476318-37476340 CTTGCCATGAAGTTTGTTTGGGG + Intronic
1008636940 6:53420019-53420041 TTGGCCATGAAATGTGCCTCTGG - Intergenic
1011324615 6:86135985-86136007 CTGGCCAGAAAATTTATTTCTGG + Intergenic
1012864862 6:104606698-104606720 CTGGGCCAGAGATGTGTTTCAGG - Intergenic
1013167920 6:107610323-107610345 CTGGCCATGAAACGTCTTACAGG - Intronic
1014807786 6:125850224-125850246 CTGGAAATCAGATGTGTTTCTGG - Intronic
1016581992 6:145638412-145638434 CTGGCCTTCAAATGTTTTTAAGG + Intronic
1017692227 6:156978243-156978265 TTGGCCTGGAAATGTGTTCCAGG + Intronic
1019273635 7:164525-164547 CAGGCCCTGCAATGTGTTCCAGG - Intergenic
1019595321 7:1855720-1855742 CAGGCCATGAAAGGTGATGCTGG - Intronic
1025773973 7:64541889-64541911 CTGGCCGTGAACTGTGGCTCAGG - Intronic
1025791731 7:64694115-64694137 CTGACCATGAACTGTGGATCAGG + Intronic
1025804442 7:64817150-64817172 CTGGCCATGAACTGTGGCTAAGG + Intronic
1030326926 7:108229719-108229741 CTTGCCATGAAATATCTTACAGG + Intronic
1030894315 7:115038483-115038505 CTGGCCATGAAAAGAGGTGCCGG - Intergenic
1031680337 7:124665189-124665211 GTGGCCAAGAAATATATTTCAGG - Intergenic
1032171552 7:129588685-129588707 CTGGACATTGAAGGTGTTTCTGG - Intergenic
1032786937 7:135208430-135208452 CTGTGCATGAAACGTGTTCCCGG - Intronic
1032816287 7:135478351-135478373 CTGGTTGTGAAATGTTTTTCTGG + Intronic
1035841178 8:2813141-2813163 CTTGCCATGAAAAGTGTATTAGG + Intergenic
1039643159 8:39246186-39246208 GTGTCCAAGAAATGTGATTCAGG - Intronic
1042443530 8:68856911-68856933 CTGGCCATAAAATCTTTTTATGG - Intergenic
1045967892 8:108047091-108047113 CTGGCAAGGAAATGGCTTTCTGG - Intronic
1048435689 8:134415082-134415104 TTGGCTAGGAAATGTGTTCCTGG + Intergenic
1050031173 9:1387440-1387462 CTGCCCATGAAATGTACTCCTGG + Intergenic
1050710387 9:8455279-8455301 CTGGTAATAAAATGTTTTTCTGG - Intronic
1053089753 9:35264160-35264182 ATGGACATGAAAGGTGATTCTGG + Intronic
1054792885 9:69272343-69272365 CTGGCCAAGGAATTTGGTTCGGG - Intergenic
1055329782 9:75171697-75171719 CTTCCCATGAAGTGTGTTTCTGG + Intergenic
1057287662 9:93773209-93773231 ATGGACATTAAATGTGCTTCTGG + Intergenic
1186983790 X:14988061-14988083 CTGGCCATGTTATCTGTTTATGG - Intergenic
1187329618 X:18325126-18325148 CTGGTCATGAAATGTAGATCAGG - Intronic
1188347355 X:29083434-29083456 CTGGCCATGAAATGTGTTTCAGG - Intronic
1189074562 X:37902753-37902775 CTGGCCATGGTAATTGTTTCAGG + Intronic
1190098556 X:47502667-47502689 CTGGACATGATATGTCTTTCTGG + Intergenic
1193969755 X:88037051-88037073 GTGGCCATGAAATTTAATTCTGG + Intergenic
1196289264 X:113919486-113919508 CTGTCCATACAGTGTGTTTCAGG + Intergenic
1197655466 X:129112020-129112042 CTAGCCATGAAAGTTGTTCCAGG + Intergenic
1197756562 X:129999623-129999645 CTTGCCATAAAATGCATTTCAGG - Intronic
1198929300 X:141836691-141836713 TTGGCTGAGAAATGTGTTTCCGG - Intergenic
1199967700 X:152833620-152833642 CTGGCCATGGAATGTCTTTCAGG + Intronic