ID: 1188348154

View in Genome Browser
Species Human (GRCh38)
Location X:29093878-29093900
Sequence GTCCCAAGAAACCAAAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 3, 3: 4, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188348148_1188348154 8 Left 1188348148 X:29093847-29093869 CCTGAACTTTGGCTCCAGGCCTG 0: 1
1: 0
2: 3
3: 18
4: 207
Right 1188348154 X:29093878-29093900 GTCCCAAGAAACCAAAGTGTAGG 0: 1
1: 0
2: 3
3: 4
4: 141
1188348146_1188348154 15 Left 1188348146 X:29093840-29093862 CCAAAATCCTGAACTTTGGCTCC 0: 1
1: 0
2: 1
3: 35
4: 275
Right 1188348154 X:29093878-29093900 GTCCCAAGAAACCAAAGTGTAGG 0: 1
1: 0
2: 3
3: 4
4: 141
1188348152_1188348154 -6 Left 1188348152 X:29093861-29093883 CCAGGCCTGGTCTGTGGGTCCCA 0: 1
1: 0
2: 2
3: 47
4: 326
Right 1188348154 X:29093878-29093900 GTCCCAAGAAACCAAAGTGTAGG 0: 1
1: 0
2: 3
3: 4
4: 141
1188348145_1188348154 16 Left 1188348145 X:29093839-29093861 CCCAAAATCCTGAACTTTGGCTC 0: 1
1: 0
2: 2
3: 11
4: 174
Right 1188348154 X:29093878-29093900 GTCCCAAGAAACCAAAGTGTAGG 0: 1
1: 0
2: 3
3: 4
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188348154 Original CRISPR GTCCCAAGAAACCAAAGTGT AGG Intronic
900511265 1:3062212-3062234 GGCCCAGGGACCCAAAGTGTGGG + Intergenic
900537101 1:3184240-3184262 TTCAAAAGAAACCAAAGTCTTGG - Intronic
901926798 1:12571185-12571207 GGCCCAAGAAAACTGAGTGTGGG + Intronic
903307194 1:22421223-22421245 GTCCCACGAAATCAAACTGTTGG + Intergenic
906111753 1:43328398-43328420 GTCTCAAAAAAACAAAGAGTTGG + Intergenic
916441630 1:164831703-164831725 GACACAAGAAAACAAAGGGTAGG - Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
917214123 1:172660225-172660247 GTGTACAGAAACCAAAGTGTGGG - Intronic
921439421 1:215166852-215166874 GTCCTAAGTAAAGAAAGTGTAGG + Intronic
922491515 1:226020813-226020835 GTCCCAACAAAACAAACTCTTGG - Intergenic
1063541592 10:6939540-6939562 ATCCCAGGAAACCACTGTGTGGG + Intergenic
1064917865 10:20481812-20481834 GTCCCAAGAATACAAAATGGTGG - Intergenic
1067059917 10:43073020-43073042 TTCACAAGAGAACAAAGTGTGGG + Intergenic
1068908524 10:62353249-62353271 GAACCAAGAATCCAGAGTGTGGG - Intergenic
1073588745 10:104735792-104735814 GTTCCAAGAAACCTAAGTCCTGG - Intronic
1073716123 10:106109271-106109293 ATCCCAAGAACCCAGAGTGAGGG - Intergenic
1075844369 10:125533801-125533823 GTCCCAAGTGACCAAAATGCAGG + Intergenic
1077164527 11:1129132-1129154 GTCCCAAGCCACCCGAGTGTTGG - Intergenic
1080053301 11:27879096-27879118 TTGCCAAGTAACCAAAGTCTTGG + Intergenic
1081418706 11:42846318-42846340 GTACCCAGAAACCACAGGGTAGG - Intergenic
1081527131 11:43934918-43934940 CTGCCCAGAAGCCAAAGTGTGGG + Intronic
1084340451 11:68495985-68496007 GTCTCAAAAAACAAAAGTGCTGG - Intronic
1084569311 11:69949936-69949958 ATCCCAGGAAAACAAAGTGCCGG + Intergenic
1085493289 11:76942810-76942832 CTCCCAACAAAACAAAGTCTAGG - Intronic
1086470421 11:87103338-87103360 GTCAAAAGATAACAAAGTGTTGG - Intronic
1091125816 11:133095358-133095380 GACCTAAGAAACCAAAGGGAAGG + Intronic
1091890821 12:4052875-4052897 GTGCCAAGTGACGAAAGTGTCGG + Intergenic
1095739272 12:45589266-45589288 GTCCCTAGAAACCAAATATTCGG - Intergenic
1098413737 12:70209186-70209208 GTGCCAAGAAAACACAGTGGGGG - Intergenic
1099214772 12:79839952-79839974 TTCCAAAGAAACAAAAGTATAGG - Intronic
1101306356 12:103531504-103531526 GTCAAAAGAAAGCAAAGAGTTGG + Intergenic
1101497943 12:105273347-105273369 TTCCCAAGAAACAAAACGGTTGG + Intronic
1103303559 12:119946476-119946498 ATCCCAGGAAACAACAGTGTGGG - Intergenic
1103623282 12:122201400-122201422 GGCCAAAGGAACCAAAGGGTGGG + Intronic
1103785011 12:123426056-123426078 GTCCCAAACTCCCAAAGTGTTGG + Intronic
1107129259 13:36877957-36877979 ATCCCAGGAAACCAAAGCGCTGG - Intronic
1109208452 13:59507528-59507550 GTGCCCAGAAAACCAAGTGTGGG + Intergenic
1109340350 13:61050497-61050519 GTCACAAGAATTCAAAGTGGAGG - Intergenic
1117947275 14:61041647-61041669 GTCCCAGGCTCCCAAAGTGTGGG - Intronic
1118919401 14:70136379-70136401 GTCCCAAGAAACCAACACGCAGG + Intronic
1119486428 14:74990999-74991021 GTCCCAACATGCCAAAGTGCTGG + Intergenic
1121305245 14:92902512-92902534 ATGCCAGGAAACCAAAGTGAGGG + Intergenic
1121615640 14:95311769-95311791 GTCCCATGAACCCACAGGGTAGG - Intronic
1125096259 15:35855800-35855822 GTCACTGGAAACCAAATTGTGGG + Intergenic
1125270743 15:37936047-37936069 TTCTCAAGAAACCAGAGTGAAGG + Intronic
1127621022 15:60734594-60734616 GTCCCAAGAAATCTAACAGTGGG - Intronic
1133294678 16:4745549-4745571 GTGCGGAGCAACCAAAGTGTGGG - Intronic
1135886030 16:26308868-26308890 GCCCGAAGAAAACAAAATGTTGG + Intergenic
1138925480 16:61585179-61585201 TTCCAAAGAAACCACAGTGAAGG - Intergenic
1139841762 16:69887396-69887418 GTCTCAAAAAAAAAAAGTGTTGG - Intronic
1146680045 17:34800514-34800536 ATCCCAAGAAACCAGAGGGAGGG + Intergenic
1147606252 17:41775440-41775462 CTCACAAGAAACAAAAGTGCTGG + Intronic
1148196823 17:45720008-45720030 CTCCCAGGAAACCACAGTGTGGG + Intergenic
1148801138 17:50226753-50226775 ATACCTAGAAACCAAAATGTAGG - Intergenic
1149692436 17:58589260-58589282 TTCCAAAGAAAAAAAAGTGTAGG + Intronic
1150548276 17:66185618-66185640 ATCCCAAAAATCAAAAGTGTAGG + Intronic
1151426736 17:74035574-74035596 ATCCCAAGGAACCACAGTGAAGG - Intergenic
1152209711 17:78996559-78996581 GTAACATGAAACCAAAGTCTGGG + Intronic
1153016267 18:584918-584940 GTCTCAAGAAAAAAAAGTGGGGG - Intergenic
1153242292 18:3042023-3042045 GTCACAACAAAGCAAAGTGAAGG + Intergenic
1155712759 18:28903333-28903355 GACCAAAGAAAGCCAAGTGTGGG - Intergenic
1156006578 18:32449658-32449680 GTCTCAAAAAAACAAAGGGTTGG + Intronic
1157200010 18:45652091-45652113 GACCCAAGAAAACAAAGTTTAGG - Intronic
1159746657 18:72243783-72243805 AACCCAAGGAACCAAGGTGTGGG - Intergenic
1162396967 19:10422863-10422885 GTCCTAAGACACCAAGGGGTGGG + Intronic
1165742929 19:38214207-38214229 GTTGCATGAAACCGAAGTGTGGG - Intronic
1166377422 19:42335348-42335370 GTCCCAAGACTCCCAGGTGTTGG - Exonic
1167659351 19:50786936-50786958 GTCTCACTTAACCAAAGTGTTGG - Intergenic
1168396289 19:56051601-56051623 CTCCCAAGAAACCAAAACTTTGG + Intronic
925519393 2:4725067-4725089 GTCTCAAGAAAAGAAAGTATAGG - Intergenic
925926902 2:8677324-8677346 GTTCAAAGAAAGCAAAGTTTGGG - Intergenic
927734144 2:25503238-25503260 GTCTCAACCTACCAAAGTGTTGG - Intronic
929868144 2:45735654-45735676 GTGGCAGGAAAGCAAAGTGTTGG + Intronic
930638842 2:53834823-53834845 GACCAAAGACAACAAAGTGTTGG + Intergenic
931077851 2:58736266-58736288 ATCCCAGGAAGCCAAAGTGAAGG - Intergenic
931256731 2:60580826-60580848 GTCCCAAGAACCCAATGTGTGGG + Intergenic
933855286 2:86407790-86407812 GTCTCAAGCTCCCAAAGTGTTGG - Intergenic
941678406 2:168368835-168368857 TTCCCAGGAAACTAAAATGTTGG + Intergenic
942808611 2:179968017-179968039 GTCCAAAAAAATCTAAGTGTCGG - Intronic
943281441 2:185939174-185939196 CTCCCAACAAAGAAAAGTGTAGG - Intergenic
1170060172 20:12250634-12250656 GTCCCAAGAAAACCAACTGATGG - Intergenic
1170363453 20:15573666-15573688 GGCCTAAGGAACCAAAGGGTAGG - Intronic
1171181223 20:23092105-23092127 GCCCCAAGAAGTGAAAGTGTTGG - Intergenic
1172249640 20:33469936-33469958 GGCCCAAGAAACCAAGATGAAGG - Intergenic
1174163070 20:48565346-48565368 GGTCCCAGATACCAAAGTGTCGG - Intergenic
1175419345 20:58821588-58821610 GTGCCAAGAAGCCTGAGTGTGGG + Intergenic
1175946796 20:62562677-62562699 GTCCCAAGAACACGAATTGTGGG + Intronic
1177372931 21:20229306-20229328 TTCCCATCAAACCAAAGGGTGGG + Intergenic
1178421414 21:32446537-32446559 CAGCCAAGAAACCAAGGTGTGGG + Intronic
1183235218 22:36611677-36611699 CTCCCCAGCAACTAAAGTGTGGG + Intronic
1183324022 22:37181683-37181705 GTCTCAAGAAAAAAAAATGTTGG + Exonic
952183529 3:30944115-30944137 GTCCTCAGAAACAAAACTGTTGG - Intergenic
954237765 3:49269977-49269999 GCCCGAACAAACCAAAGAGTTGG - Exonic
955262224 3:57404413-57404435 GTTCTAAGAAACAAAAGTTTCGG + Intronic
957049975 3:75403988-75404010 CAGCCAAGAAACCAAGGTGTGGG - Intergenic
959549164 3:107635088-107635110 GTCACAAGGAACCCAAGAGTTGG - Intronic
960023348 3:112980465-112980487 TTCCCAAGAAACCAAATTAATGG + Intergenic
961882292 3:130070428-130070450 CAGCCAAGAAACCAAGGTGTGGG - Intergenic
963709797 3:148734190-148734212 TTCCCAAGAAGCTAAAATGTGGG + Intronic
963919017 3:150888102-150888124 GTCTCAAAAAACAAAAGAGTAGG + Intronic
964506468 3:157405359-157405381 TTCCCAAGAAACTAAAGAGCTGG - Intronic
965980369 3:174682174-174682196 GTCACAAAAAAGAAAAGTGTGGG + Intronic
968387289 4:152701-152723 TTCCCCACAAACCAAAGTGCTGG + Intronic
970061342 4:12037879-12037901 GTCTCAAAAAACCACAGTCTGGG - Intergenic
971631163 4:28995572-28995594 CTCCACAGAAACCAAGGTGTGGG - Intergenic
972400163 4:38694228-38694250 GTCTCAGGAAACCACATTGTAGG - Intronic
976402394 4:84622255-84622277 ATCACATGAAACAAAAGTGTTGG - Intronic
981432869 4:144682348-144682370 TTCCCATGAAAACAAAGTGAAGG + Intronic
984224293 4:177015859-177015881 GTCCTAAGAAAACAAAGGCTGGG - Intergenic
987737840 5:21868379-21868401 GTCTCAAGAAACCAAACTGTAGG + Intronic
988331451 5:29845903-29845925 GCCCCAACACACCAAAGTTTAGG + Intergenic
995942925 5:117607063-117607085 GTCCCAAGCTAACAAAGTGGAGG - Intergenic
997832346 5:137161458-137161480 GCCCAAAGAAACCCAAGTGTGGG - Intronic
1000975139 5:167756478-167756500 GTCCAGAGAAAACAAAGTGATGG + Intronic
1001454232 5:171848490-171848512 TGACCAATAAACCAAAGTGTGGG + Intergenic
1002110527 5:176907135-176907157 GTTCCAAGAAACTAAGGAGTCGG + Exonic
1002953623 6:1840642-1840664 ACTCTAAGAAACCAAAGTGTGGG + Intronic
1006643958 6:35503642-35503664 TTCCCAGGAAACCAACGTGCTGG - Exonic
1006647901 6:35527752-35527774 GAGCCAAGACACCAAGGTGTTGG - Intergenic
1010581734 6:77607285-77607307 ACCCCATGAAAACAAAGTGTGGG - Intergenic
1014807265 6:125844040-125844062 GACCCCGGTAACCAAAGTGTGGG - Intronic
1017526040 6:155242109-155242131 GCCCTAAGAAAACAAAGTGCAGG - Intronic
1021214116 7:17894671-17894693 TTACCAATAAAGCAAAGTGTTGG + Intronic
1022957323 7:35393169-35393191 GTCCCAAGAAAGCCAAGTGTTGG + Intergenic
1026138142 7:67681559-67681581 CTCCAAAGATATCAAAGTGTTGG + Intergenic
1028900919 7:96099844-96099866 GTGCCAAGAAACCTAGGTGGAGG - Intronic
1032311312 7:130789968-130789990 GTCACAGGAAACCACAGTCTTGG - Intergenic
1033806621 7:144961629-144961651 GTCTTTAGAAACCAAAATGTGGG + Intergenic
1035638454 8:1164212-1164234 GTCCCCACAAACCAAAATGACGG - Intergenic
1035752614 8:2007259-2007281 TTCCCTAGGAACCAAAGTCTAGG - Intergenic
1036488334 8:9200194-9200216 GTCTCAAAAAAAAAAAGTGTTGG - Intergenic
1038006127 8:23431987-23432009 ATCCCAAGAAACCAGCGTGAGGG - Exonic
1038214115 8:25545949-25545971 TTCTCAAGAAAACAAAGAGTGGG - Intergenic
1039381245 8:37087453-37087475 CTCCCAAGAATTCAAAGGGTAGG - Intergenic
1039794279 8:40898648-40898670 GTCAGAATAAACCAAAGTGAGGG - Intergenic
1043739060 8:83785717-83785739 GTTCCCAGAAATCAAAGAGTTGG + Intergenic
1044870754 8:96617623-96617645 TTCCCAAGAAGCCAATGTGGTGG - Intergenic
1047283387 8:123465033-123465055 GTCTCAGGAAAAAAAAGTGTGGG + Intronic
1048700641 8:137084886-137084908 GTCACCAGAAAGCAAAGTGCAGG - Intergenic
1060744619 9:126123148-126123170 GACCCCAGAAACCAGAGTGATGG - Intergenic
1061565834 9:131439238-131439260 ATCCAAAGAAACCAAAGAGCTGG - Intronic
1187006646 X:15239346-15239368 GAGACAAGAAACCAGAGTGTGGG + Intronic
1187830133 X:23372687-23372709 GTCCCAAGGAACCAAATGTTTGG - Intronic
1188348154 X:29093878-29093900 GTCCCAAGAAACCAAAGTGTAGG + Intronic
1189196894 X:39160843-39160865 GTCCCAGGAAACCATAGCCTGGG + Intergenic
1189624428 X:42880694-42880716 GTAACAAGAAACCGAATTGTGGG - Intergenic
1191173325 X:57472511-57472533 ATTCCAAAAAATCAAAGTGTAGG - Intronic
1195404095 X:104493896-104493918 TTCCCAATATTCCAAAGTGTTGG + Intergenic
1202149015 Y:21828083-21828105 GTACCAAGAAATCACAGTGGGGG - Intergenic