ID: 1188357724

View in Genome Browser
Species Human (GRCh38)
Location X:29212964-29212986
Sequence CTGAATATACAGTTGACTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188357724_1188357725 13 Left 1188357724 X:29212964-29212986 CCGAGAGTCAACTGTATATTCAG 0: 1
1: 0
2: 2
3: 28
4: 208
Right 1188357725 X:29213000-29213022 TTTTTTTTCTTTTTTTGACATGG 0: 14
1: 2436
2: 91554
3: 87797
4: 110211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188357724 Original CRISPR CTGAATATACAGTTGACTCT CGG (reversed) Intronic
900377357 1:2361699-2361721 CTGGAAATGCAGTTGACCCTTGG + Intronic
902885949 1:19404952-19404974 CTGAATATCTAGGTGACCCTCGG - Intronic
904356312 1:29942408-29942430 CTGAGTGCACAGTTGACACTCGG + Intergenic
905052692 1:35065556-35065578 CTTTAAATACAGTTGACTCTTGG - Intronic
907611628 1:55876904-55876926 ATGAAAATAAAGTTGACTCAAGG + Intergenic
907639671 1:56174677-56174699 CTGAAAATTGAGTTGACTATAGG + Intergenic
907874738 1:58474551-58474573 AGGAACATACAGTTGACCCTTGG - Intronic
908630262 1:66097608-66097630 CTAAATTTCCAGTTGGCTCTTGG + Intronic
908691690 1:66787187-66787209 CTAAAAATTCAGTTAACTCTGGG + Intergenic
909879390 1:80854285-80854307 CTCAATCTTCAGTTGACTCCAGG + Intergenic
911197102 1:95005705-95005727 CAGACTATACAGTGAACTCTAGG - Intronic
911467039 1:98268473-98268495 TTTAATATCCAGTTGCCTCTGGG + Intergenic
912398038 1:109363875-109363897 CTGAAACAACAGTTGCCTCTTGG + Intronic
912868270 1:113278955-113278977 CTGAATATACACTAGAGCCTTGG + Intergenic
913136784 1:115898478-115898500 ATGTATGTACATTTGACTCTTGG + Intergenic
914698375 1:150107222-150107244 CTGAATATACAGATGTCTAGTGG + Intronic
916948149 1:169750312-169750334 TTGTATATACAGTGGTCTCTGGG - Intronic
917087833 1:171321314-171321336 ATATATATACAGTTGTCTCTTGG + Intronic
918497782 1:185158392-185158414 CTGAATGTGTAGTTGACTCATGG + Intronic
918783829 1:188737742-188737764 TTTAAAATACAGTTGACCCTTGG + Intergenic
919577239 1:199326125-199326147 CTGAATATAGTGTTGGCTATGGG - Intergenic
921662141 1:217816582-217816604 CTGAATATAAAGTTTGCTATTGG + Intronic
923314045 1:232762193-232762215 GATAATATACAGTTGACTCTTGG + Intergenic
1063281277 10:4632025-4632047 CTGAAGAAACAGATGATTCTAGG + Intergenic
1066640916 10:37553332-37553354 CTGCATTAACAGATGACTCTAGG + Intergenic
1067363762 10:45606089-45606111 CAGAATATACAGTTGTCTCTTGG + Intergenic
1067999370 10:51313641-51313663 CTATATATACAGTTGTCCCTTGG + Intronic
1068531547 10:58193108-58193130 CTGAAAATACATTTGTTTCTAGG - Exonic
1069102480 10:64339700-64339722 CTGAATCAAAATTTGACTCTAGG + Intergenic
1069207696 10:65713034-65713056 CTCAAAATACAATTGACTCCAGG + Intergenic
1070206688 10:74270698-74270720 TTGAATTTACAGTAGAGTCTGGG + Intronic
1070494130 10:77005991-77006013 CTGATTATCCATTTGACTCAAGG - Intronic
1070524968 10:77288253-77288275 CTGAATAAACTGTTTGCTCTTGG - Intronic
1073542117 10:104323024-104323046 CAGAATATAGAGTTGAATTTAGG + Intronic
1076249563 10:128974776-128974798 CTGAGTTTGCAGCTGACTCTAGG - Intergenic
1078883319 11:15475014-15475036 CTGAAAATACAGTCATCTCTTGG - Intergenic
1079509319 11:21192610-21192632 CTTATTTTTCAGTTGACTCTTGG + Intronic
1079593715 11:22214334-22214356 CTGGGTACACAGTTGATTCTAGG - Intronic
1081088508 11:38831304-38831326 ATTTCTATACAGTTGACTCTAGG - Intergenic
1082890584 11:58134519-58134541 CTAACTATGCAGTAGACTCTTGG - Intronic
1084884037 11:72191773-72191795 CAGAATATACACTTGATTATTGG + Intronic
1086235485 11:84625159-84625181 TTGAATAAAAGGTTGACTCTCGG - Intronic
1087778548 11:102278934-102278956 TTGCAAATACAGTTGTCTCTTGG - Intergenic
1088131269 11:106494609-106494631 CTGAGTATACAGATAACTGTTGG + Intergenic
1089030739 11:115325750-115325772 CTGAATACACAGTCCACTCATGG + Intronic
1091206139 11:133822679-133822701 CTGCATATCCAGTTGTCCCTCGG - Intergenic
1091516758 12:1191937-1191959 CTGAATAAACAGTAGAATCATGG + Intronic
1092855486 12:12669571-12669593 ATGTATATACAGTTGGCTCAGGG - Intronic
1093125234 12:15321400-15321422 CTGTACATACCGTTGACACTTGG + Intronic
1093304709 12:17500550-17500572 TTGAAAATACAGTTGTCCCTTGG + Intergenic
1094357973 12:29598458-29598480 CTGAATCTATAGATCACTCTGGG + Intronic
1094457262 12:30650439-30650461 ATGTAAATACAGTTGACTCTTGG - Intronic
1098265160 12:68710914-68710936 CAGAATATACATTTGTCTCTTGG - Intronic
1098387198 12:69931972-69931994 CTGTATATACAGATATCTCTGGG - Intronic
1098613318 12:72488692-72488714 CTGAATATACATTCTTCTCTAGG + Intronic
1099519944 12:83648378-83648400 TTGAACATACAGTTGATGCTTGG - Intergenic
1099885523 12:88525397-88525419 ATGAATAAACATTTAACTCTTGG - Intronic
1099913640 12:88864555-88864577 ATGAAAATACATTTGTCTCTTGG - Intergenic
1101461617 12:104902483-104902505 CTGAATTTTCAGTTGCCTTTTGG - Intronic
1104681277 12:130753650-130753672 ATGAATATACAGTTGACCCATGG + Intergenic
1105730217 13:23206889-23206911 CTGAATCTACAGATCACTTTTGG - Intronic
1107137637 13:36961612-36961634 ATATATATACAGTTGTCTCTTGG - Intronic
1107843739 13:44488859-44488881 CTGAATCTACAGATGAATTTGGG - Intronic
1109705704 13:66089226-66089248 CTGAATATAGCATTGTCTCTAGG - Intergenic
1110298203 13:73894782-73894804 TTAAATATACTGTTGACTATGGG + Intronic
1110546910 13:76766012-76766034 CTGAATGTACAATTGGCTCTTGG + Intergenic
1112354252 13:98660991-98661013 CTGAATATACAGATGGCTCGTGG - Intergenic
1112666408 13:101579651-101579673 CTGAATAAACAGTTAACTTAGGG + Intronic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1117553226 14:56857081-56857103 CTTAATTTACAGTTGCCTTTGGG + Intergenic
1117851593 14:59977125-59977147 CAGAACATACAGTTTAGTCTTGG + Intronic
1118932132 14:70252674-70252696 ATGAAGATACAGTTGAGTGTGGG - Intergenic
1119673913 14:76539489-76539511 TTGGATGTTCAGTTGACTCTTGG + Intergenic
1121354485 14:93202245-93202267 CTGAAAAAAAAGTTGACCCTGGG + Intronic
1123959018 15:25374723-25374745 CTTAAAATACAATTGCCTCTGGG + Intronic
1125477393 15:40056194-40056216 CTGAGTACACAGTGGACTCCTGG - Intergenic
1125873039 15:43119885-43119907 TTAAATATACAGTTGTCCCTTGG + Intronic
1126008055 15:44277396-44277418 CTGACTCTACAGTAGACTTTTGG - Intergenic
1127849418 15:62900056-62900078 CAGAATATACAGTTCAGGCTTGG - Intergenic
1129203246 15:74018857-74018879 CTGAAGATACGGTTAAGTCTGGG + Intronic
1135375885 16:21946956-21946978 CTTCACATACAGTTGAATCTGGG - Intergenic
1135687556 16:24510297-24510319 ATTTATATACAGTTGACCCTTGG - Intergenic
1136925127 16:34364720-34364742 CTGAAAATACAGTTGCGTTTGGG + Intergenic
1136979446 16:35047086-35047108 CTGAAAATACAGTTGCGTTTGGG - Intergenic
1147047093 17:37760885-37760907 CTTAATAGACAGTTGAAGCTGGG - Intergenic
1149392080 17:56202205-56202227 CTGATTATATAATTTACTCTGGG - Intronic
1150415134 17:64981441-64981463 CTAAATATACAAATGACCCTTGG + Intergenic
1153217037 18:2830277-2830299 TTGAATAAACACTTGACACTTGG - Intergenic
1155060834 18:22227049-22227071 CAGAGAATGCAGTTGACTCTTGG + Intergenic
1155076753 18:22364147-22364169 CAGAATATACAGCTGACCCTTGG + Intergenic
1155615917 18:27721282-27721304 AAAAATATACAGTTGTCTCTGGG - Intergenic
1158054509 18:53262281-53262303 CTGTATATAGAGTTGATTTTAGG - Intronic
1158702918 18:59765247-59765269 TTGAATATATTGTTGAATCTTGG + Intergenic
1159067647 18:63588049-63588071 CTGCATACAAACTTGACTCTGGG - Intronic
1161519938 19:4718312-4718334 CTGAATCTACAGTTCCTTCTAGG - Intronic
1162025036 19:7888852-7888874 CTGAAGATAAACTTGACTTTGGG + Intronic
1163889748 19:20000253-20000275 CTGGATACAGAGTTGTCTCTAGG - Intronic
1165038657 19:33053342-33053364 CTGGAAATACAGTTGATTCATGG - Intronic
1165093614 19:33398944-33398966 ATGAATATACAGGTGTCTCCAGG - Intronic
1165897645 19:39152827-39152849 CTGTATATATAGTTGGCCCTGGG + Intronic
925488983 2:4370589-4370611 CTGTGTGTACAGTTGACTTTCGG - Intergenic
928474108 2:31607165-31607187 CTACATATACATTTGACTGTTGG - Intergenic
929227358 2:39524605-39524627 CTGAATATACAGTTGAGACATGG + Intergenic
931427282 2:62182777-62182799 CTGTATATCCAGTTGCCTCATGG + Intergenic
931483839 2:62670657-62670679 CTGGATATAACGTTTACTCTAGG - Intergenic
933061010 2:77736147-77736169 ATATATATACAGTTGACCCTTGG - Intergenic
933076138 2:77929076-77929098 CTGAATCTACAGATCACTCTGGG + Intergenic
933827806 2:86179345-86179367 TTGAAAATACAGTTGTCTTTTGG - Intronic
935004643 2:99060518-99060540 TTGAATATACAGTTCAGTATGGG - Intronic
935220769 2:101010582-101010604 CTGAAAAAACAGTTAATTCTCGG + Intronic
935497592 2:103801116-103801138 CTGAAAATATTATTGACTCTAGG - Intergenic
937666410 2:124492643-124492665 TTAAATATACAGATGACTTTGGG + Intronic
938609036 2:132927431-132927453 CTGAATATACAGATTGCTTTAGG + Intronic
943213480 2:184999947-184999969 CAGAATAGACAGTACACTCTGGG + Intergenic
943535083 2:189138631-189138653 TTGAATAAACAGCTGATTCTAGG + Intronic
944995878 2:205292723-205292745 ATGAACATACAGTTGAATTTGGG + Intronic
1172040673 20:32042557-32042579 CTGAGTGTGCACTTGACTCTGGG - Intergenic
1173054024 20:39594037-39594059 CTTAAATTACAGTTGATTCTAGG + Intergenic
1173664163 20:44753329-44753351 CTGAACACACAGGTGACTCCAGG + Intronic
1174122682 20:48278427-48278449 CTGGATCTCCAGTTGGCTCTAGG - Intergenic
1175012980 20:55758587-55758609 CTGAAATTACAGTTGATCCTTGG - Intergenic
1177150864 21:17454349-17454371 CTGAAAATACAGTGGAATCAAGG - Intergenic
1178943859 21:36929968-36929990 CTGAATATACTCTTGACACAGGG + Intronic
1182017973 22:27056590-27056612 CTGAAGATACAGGTTCCTCTGGG + Intergenic
1183133288 22:35860752-35860774 CTGAATCTACAGATCACTTTGGG + Intronic
1183876573 22:40787370-40787392 GAGAATAAACAGTTCACTCTTGG + Intronic
1184964620 22:47962138-47962160 TTGAATATACAGATGAATCTGGG - Intergenic
950955466 3:17048256-17048278 TTGAAAATACAGTTGACCCTTGG + Intronic
951120350 3:18919446-18919468 GAGAATCTGCAGTTGACTCTAGG + Intergenic
953011747 3:39032656-39032678 CTTATGAGACAGTTGACTCTAGG + Intergenic
954272963 3:49523832-49523854 CTGATTTTACAGATGACACTGGG + Intronic
955340912 3:58124353-58124375 CCGACTTTACAGTTGACTCTCGG + Exonic
955765780 3:62342778-62342800 CTGAATCAACACTTGACACTTGG + Intergenic
958092853 3:88899055-88899077 CAGAATATGCAGTAGAATCTTGG - Intergenic
958170374 3:89932592-89932614 CTGAAAACACAGTTTACTATGGG + Intergenic
958860740 3:99442652-99442674 CTGTATATATAGTTGAGTGTAGG - Intergenic
961025903 3:123557207-123557229 TTGAATGCACAGTTGACACTAGG - Intronic
963157676 3:142116871-142116893 CTGTAAGTTCAGTTGACTCTTGG + Intronic
963305371 3:143645865-143645887 CTCATTAAACAGCTGACTCTTGG - Intronic
965911820 3:173787238-173787260 AAAAATATACAGTTGACTTTAGG - Intronic
971280029 4:25234856-25234878 CAGAATATCCAGTTGCCACTGGG + Intronic
972071572 4:35025473-35025495 TTGAAACTACAGTTGCCTCTAGG - Intergenic
972635016 4:40876520-40876542 CTGTATATACCGTTGTCGCTTGG + Intronic
972849199 4:43027414-43027436 ATGAAGAAACAGTAGACTCTTGG + Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
979071311 4:116210806-116210828 TTGAATTTAGAGTTTACTCTTGG - Intergenic
979221044 4:118225233-118225255 CAGCATATTCAGATGACTCTGGG + Intronic
980458988 4:133080686-133080708 CTGAATAAACAGTTAAACCTAGG - Intergenic
986205236 5:5618477-5618499 CTGAATATACAATTAACGATAGG + Intergenic
986524613 5:8660130-8660152 CTGACTATACAGCTGAGTATAGG - Intergenic
987148063 5:15011968-15011990 CTGAAAATTCAGTTAATTCTTGG + Intergenic
988243846 5:28651434-28651456 CTGAATATGTAGTTCACTTTGGG - Intergenic
988887741 5:35577207-35577229 TTGAATTTACTGTTCACTCTTGG + Intergenic
989467513 5:41774429-41774451 TTGAAGAAAAAGTTGACTCTAGG + Intronic
990159230 5:52918426-52918448 CCCAAAATACAGTTGATTCTGGG + Intronic
990727075 5:58767918-58767940 CTTAATCTACAGCTGCCTCTTGG - Intronic
991374552 5:65953199-65953221 CTCTGCATACAGTTGACTCTTGG + Intronic
991512112 5:67390100-67390122 TTGAATATACAGATTACTTTGGG + Intergenic
992858616 5:80889827-80889849 CAGAATATACACTTGAAGCTCGG - Intergenic
993418570 5:87669684-87669706 CTGGATATACAGTGGTCTCTTGG + Intergenic
994808953 5:104488566-104488588 ATGAATGTACAGTTGTCCCTTGG + Intergenic
995249977 5:109982391-109982413 TTGATTATCCAGTTGACTCTAGG + Intergenic
995450022 5:112290264-112290286 CTGAAAATACACTGGATTCTAGG + Intronic
996255406 5:121396670-121396692 ATAAATATACAGTTAACTTTAGG - Intergenic
997875892 5:137546463-137546485 TTGAATGTAGAGTTGATTCTGGG + Intronic
998629744 5:143884820-143884842 GTGAATATACAGGTGAATGTAGG - Intergenic
998890937 5:146744965-146744987 CTGAATATAAATTTGACTCTTGG - Intronic
1000983215 5:167839283-167839305 CTGAATAAACAGTTGCCTTCGGG - Intronic
1001748321 5:174108994-174109016 ATGAATTTACAGGTGACTCAGGG - Exonic
1002141587 5:177144164-177144186 TCAAATATACATTTGACTCTTGG - Intronic
1003066404 6:2906953-2906975 CAGCAAATACAGTTGTCTCTTGG - Intergenic
1003845225 6:10166838-10166860 CTGAATGGGCAGTTGACTCCTGG + Intronic
1004034536 6:11910453-11910475 AGAAATATACAGTTGACCCTTGG + Intergenic
1004759503 6:18650600-18650622 CTGAGTATACAGTTTACATTAGG + Intergenic
1006329425 6:33379571-33379593 GAGAATATACAGTTGAGGCTGGG + Intergenic
1006977709 6:38119061-38119083 CTGAATGCCCAGCTGACTCTAGG - Intronic
1007520352 6:42447198-42447220 CTGAAGAAACAGATGATTCTTGG - Intronic
1009035437 6:58112281-58112303 ATGAATATACAGTTGTCCCTTGG + Intergenic
1009211252 6:60865873-60865895 ATGAATATACAGTTGTCCCTTGG + Intergenic
1009612682 6:65966267-65966289 CTGTATCTACAGTTGCCTCTGGG - Intergenic
1011414484 6:87103193-87103215 CTGAAAATACATTTGACCCTTGG + Intergenic
1013320548 6:108983808-108983830 TTGAATCTACAGGTCACTCTGGG + Intergenic
1014189067 6:118471137-118471159 GTGAATATACTGTGAACTCTGGG + Intronic
1016516475 6:144897840-144897862 CTGATTCTATAGTTGACTATGGG - Intergenic
1020857839 7:13451477-13451499 CGTAATATTCTGTTGACTCTTGG - Intergenic
1021819873 7:24486228-24486250 ATGTATATACAGTTGTCCCTAGG - Intergenic
1023448783 7:40259257-40259279 CTTAATGTACAGTTGACCCTTGG + Intronic
1024659216 7:51476885-51476907 GTCAATATACTGATGACTCTGGG - Intergenic
1027611145 7:80362214-80362236 CTGCATAAACAGCTGGCTCTTGG - Intergenic
1028086391 7:86642828-86642850 CTTGATATACAGTTGTCTATTGG + Intergenic
1028307446 7:89283771-89283793 ATACATATACAGTTGACCCTAGG + Intronic
1030137884 7:106275185-106275207 CTGACTCTGCTGTTGACTCTGGG - Intronic
1031497541 7:122469310-122469332 CTGATTATACAGTTTGCTTTGGG + Intronic
1031828739 7:126600234-126600256 CTGGAAATACAGTTGACCCTTGG + Intronic
1034047830 7:147948681-147948703 ATATATATACAGTTGACCCTTGG + Intronic
1034927758 7:155136418-155136440 CTGAATGTATACTGGACTCTGGG + Intergenic
1035311378 7:157971340-157971362 CAGAATATCCAGGTGAGTCTGGG + Intronic
1036100757 8:5781552-5781574 CTGAATATATAGATAAGTCTGGG + Intergenic
1041587146 8:59534637-59534659 CTGGATAAACAGCTGATTCTAGG - Intergenic
1042285156 8:67101365-67101387 CTGACTGTACAGTTGACCCTTGG - Intronic
1043000327 8:74751839-74751861 CTGTATAAACAGATGACTGTAGG + Intronic
1043122167 8:76340231-76340253 GTGACTATACAGTTTATTCTAGG - Intergenic
1043323976 8:79026750-79026772 CAGAGTTTTCAGTTGACTCTTGG + Intergenic
1045851874 8:106710017-106710039 CTGAATATATAGGTGAATTTAGG - Intronic
1046086864 8:109447950-109447972 ATTAATATACAGTAGACTGTAGG + Intronic
1046183433 8:110682769-110682791 ATCTATATACAGTTGATTCTGGG + Intergenic
1046576730 8:116039309-116039331 CTGAATGGACAGTTGCCTCTTGG - Intergenic
1046957854 8:120080203-120080225 GGGAATATACAGTTGAATGTAGG + Intronic
1047530745 8:125672420-125672442 CTGAATATATAGTTTGCTTTTGG + Intergenic
1048415258 8:134221072-134221094 CTGAATCTACAGATCACTTTGGG - Intergenic
1050647245 9:7733337-7733359 CTATATATACAGTTGTCCCTCGG + Intergenic
1050653325 9:7796986-7797008 ATATATATACAGTTGACCCTTGG - Exonic
1052462420 9:28783195-28783217 ATGAATATACAGTTGTCCCTTGG + Intergenic
1054447884 9:65386574-65386596 GTGAATTTTCAGCTGACTCTAGG + Intergenic
1054664511 9:67723257-67723279 GTGAATTTTCAGCTGACTCTAGG - Intergenic
1055459497 9:76504732-76504754 ATGAATATACAGGTGACATTAGG - Exonic
1058345829 9:103960492-103960514 CTCATTATACAGTTAACTCTTGG + Intergenic
1060002001 9:119967309-119967331 CTGAAGATACAGTTGTTTGTTGG + Intergenic
1062095885 9:134703130-134703152 CTGAACGTGCAGTTGGCTCTGGG + Intronic
1185884702 X:3772067-3772089 CTGAATTTACAAATGACTCAAGG + Intergenic
1185981136 X:4780143-4780165 GTGAATACACAGTTGAAGCTTGG + Intergenic
1186190877 X:7066515-7066537 CTGCATGTACAGTTCACACTAGG + Intronic
1187121678 X:16413828-16413850 ATGTAAATACAGTTGACTCTTGG - Intergenic
1187933786 X:24316613-24316635 CTGAAGATACCGTTGCCTCCTGG + Intergenic
1187995800 X:24925077-24925099 GTGAAGATACAGTTAAATCTAGG - Intronic
1188357724 X:29212964-29212986 CTGAATATACAGTTGACTCTCGG - Intronic
1189404745 X:40711066-40711088 TTTAATATACAGTTGACCCTTGG - Intronic
1189712873 X:43832778-43832800 CTTCATAAACAGTTGACTCTTGG - Intronic
1195136226 X:101909476-101909498 CTGATTCTAGAGTTGACTGTTGG + Intronic
1195279189 X:103313526-103313548 CTGAATTTACAGATGAATTTGGG - Intergenic
1195636697 X:107125006-107125028 AACGATATACAGTTGACTCTTGG + Intronic
1195705441 X:107734984-107735006 TTGAGGATCCAGTTGACTCTAGG + Intronic
1195958007 X:110354582-110354604 TTTAATATACAGTTATCTCTTGG - Intronic
1196370174 X:114968822-114968844 CTGAATATATAGATTACTTTGGG - Intergenic
1196528443 X:116754680-116754702 CTGCATATATAGTTGATTATAGG - Intergenic
1198327893 X:135592525-135592547 CTGAAAATAAAGTTAAATCTTGG + Intergenic
1199336964 X:146629821-146629843 CTTAATATACAGTTGTCCCCTGG + Intergenic
1199937830 X:152594008-152594030 CTGAATCTACAGATCAATCTGGG + Intergenic
1200228717 X:154433439-154433461 CTGAAGCCACAGTTGTCTCTGGG + Intronic