ID: 1188358728

View in Genome Browser
Species Human (GRCh38)
Location X:29225822-29225844
Sequence AGAATTTCCTAGGTTGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188358725_1188358728 -8 Left 1188358725 X:29225807-29225829 CCAGGTCCTTGAGAAAGAATTTC 0: 1
1: 1
2: 60
3: 196
4: 451
Right 1188358728 X:29225822-29225844 AGAATTTCCTAGGTTGTAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 167
1188358724_1188358728 -7 Left 1188358724 X:29225806-29225828 CCCAGGTCCTTGAGAAAGAATTT 0: 1
1: 1
2: 65
3: 149
4: 440
Right 1188358728 X:29225822-29225844 AGAATTTCCTAGGTTGTAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188358728 Original CRISPR AGAATTTCCTAGGTTGTAGA AGG Intronic
903029136 1:20450396-20450418 GGAATTTCCTAGGTTACAGGAGG + Intergenic
904279296 1:29407547-29407569 AGAATTACCTAGGTTGACGAGGG + Intergenic
906354978 1:45097318-45097340 AGAATTTCCTTATTTGGAGAGGG - Intronic
911245801 1:95515749-95515771 ATAATTACCTTGGTTGTAAAAGG - Intergenic
911785900 1:101947416-101947438 AGAAGTTCCTAGTTTGTTTAGGG + Intronic
911811519 1:102288476-102288498 AAAATTTCCAAGGTTGAAGCAGG + Intergenic
912396350 1:109347410-109347432 AGAATTTTCTGGGTTGTGCAAGG - Intronic
916484018 1:165241812-165241834 AACAGTTCCAAGGTTGTAGAAGG + Intronic
916689644 1:167178176-167178198 AGAAGTGCTTGGGTTGTAGATGG + Intergenic
918050099 1:180966182-180966204 AGAATTTCCCAGCTTATTGATGG - Intergenic
918199080 1:182249937-182249959 GGCATTTCCTAGGTTGGAGAGGG + Intergenic
922601333 1:226857101-226857123 AGAATTTCCTGGGTGATAGAAGG + Intergenic
924491587 1:244543300-244543322 AGAATTTCCTTCTTTTTAGAAGG - Intronic
1064245146 10:13662107-13662129 AGAGATTCCTTGGTAGTAGAGGG - Intronic
1066101346 10:32121420-32121442 AGAATTTCATAGATTGGAGCTGG + Intergenic
1066111420 10:32200500-32200522 GGAATTTCATAGGTAGAAGAGGG + Intergenic
1066482187 10:35807761-35807783 AGAATTTTCTACTTTGTAGTCGG - Intergenic
1071121549 10:82284840-82284862 ATAACTTCCTAGGATGTAAATGG - Intronic
1071525694 10:86356872-86356894 AGCATTTCCTGGGCAGTAGAAGG + Intronic
1071738473 10:88328581-88328603 ATAATTTCCAAGATAGTAGAAGG - Intronic
1075440705 10:122477378-122477400 AGAATTTCCTGGGGTGTATGTGG - Intronic
1076034047 10:127184231-127184253 AGAATCTACTAAGTTGGAGATGG - Intronic
1078400471 11:11021933-11021955 AGAATTACCTAGGTGGTAAGTGG - Intergenic
1079509181 11:21190568-21190590 AGAATTTCCTAGCATGTTGCAGG + Intronic
1080101432 11:28464514-28464536 TGAATTTTCTAGATTGGAGATGG - Intergenic
1080789376 11:35508057-35508079 AGAATTTCCAGGGCTGTGGATGG + Intronic
1086588542 11:88484758-88484780 ATAAATTCCTTGGTTATAGATGG + Intergenic
1088876162 11:113938227-113938249 AGACTCTACTAGGTTGAAGAGGG - Intronic
1089451426 11:118600317-118600339 TGAATTTCATAGGTTATACAGGG + Intronic
1090683806 11:129092331-129092353 AAAATGTCTTAGGTTGTAGAGGG + Intronic
1091435965 12:473284-473306 ACAAGTTCCTGGGATGTAGAAGG - Intronic
1095174050 12:39069795-39069817 AGAATTGCCTAAGAGGTAGAAGG - Intergenic
1095796296 12:46222532-46222554 AAAATCTCCTAGGTTGTAACGGG - Intronic
1099185918 12:79515387-79515409 AGAATTTCCCAGGTTAGAGAAGG - Intergenic
1100137845 12:91576250-91576272 AGAACTTTCTAGGTTAAAGAAGG + Intergenic
1103763186 12:123265806-123265828 AGCATTTCCCAGGATGCAGATGG + Intronic
1109174705 13:59140963-59140985 AGAATTTCCTTGGTTATGGCAGG + Intergenic
1109349353 13:61157516-61157538 TGGATTTCCGAGGTTCTAGATGG + Intergenic
1109560696 13:64045803-64045825 AAAGTTTCCTAGATTGTACAAGG + Intergenic
1109650023 13:65312778-65312800 AGAATTGTCTAGGTTGTCAAGGG - Intergenic
1113049421 13:106192883-106192905 AGAATTTCTGAGCTTGAAGATGG + Intergenic
1114619466 14:24086612-24086634 ACAATTTCCCTGGTTGAAGAAGG + Intronic
1116403933 14:44545012-44545034 AGAATTTCCTGAGTTGCACATGG + Intergenic
1116606307 14:47000845-47000867 AGAATTACTTAGGTTTTAAATGG - Intronic
1117302790 14:54445004-54445026 ATCATTTCCCAAGTTGTAGATGG - Intergenic
1120010294 14:79405969-79405991 AGCATTTACTAGAATGTAGAAGG - Intronic
1120452351 14:84684095-84684117 AGTATTTCCTAGGTTTTCTAGGG + Intergenic
1121618428 14:95329805-95329827 ACATTTTCCTACTTTGTAGATGG + Intergenic
1125314556 15:38417302-38417324 AGAGTTTACTAGATAGTAGAGGG - Intergenic
1126188443 15:45853786-45853808 AGAATTTCTTAGGTTGGAGGTGG + Intergenic
1126189885 15:45868274-45868296 AGAATTTCCTATGATGTATAAGG + Intergenic
1127743229 15:61935390-61935412 AGAATTTTCTAACTTGGAGAAGG - Intronic
1128125388 15:65188607-65188629 AGAATTACTTTGGTTGTAGCCGG + Intergenic
1133850123 16:9495583-9495605 TGAATTTTCTAGCTTGCAGATGG + Intergenic
1139537125 16:67583357-67583379 AAAATGTCCTAGGTTGCTGAGGG + Intronic
1141216522 16:82030230-82030252 AGAATTTCCTTGTTTTTTGATGG + Intergenic
1141850901 16:86645381-86645403 AGAACCTCCTAGGTTTTAGAGGG + Intergenic
1150714665 17:67561620-67561642 AGAATTTGCTAGGTTGGTGAAGG + Intronic
1153340838 18:3973171-3973193 ATAATTTCCTAGATTCTATAAGG + Intronic
1153383818 18:4469869-4469891 AGAAGTTCGTAGATTGTAGCTGG - Intergenic
1153968034 18:10199570-10199592 AGAATGTCCTGGGATGTACATGG - Intergenic
1156488197 18:37479954-37479976 AGACATTCCTCAGTTGTAGATGG - Intronic
1161229412 19:3165576-3165598 TGAATTTCCTGGGTTGTACTAGG - Intergenic
1161718743 19:5891997-5892019 AACATTTACTAGGTTGTGGAGGG - Exonic
1164280388 19:23763372-23763394 AGTATTTCCCAGGTTGTTCAGGG + Intronic
1164742293 19:30584753-30584775 ACAATTTCCTAAGCTGCAGAAGG - Intronic
1168570545 19:57464909-57464931 AGAATATTCTTGGTTGAAGATGG + Intronic
931660199 2:64553852-64553874 TGAATTTCCTAGGTCTTTGATGG - Intronic
932042648 2:68317676-68317698 AGAATTTCTGATGGTGTAGAAGG - Intronic
932451066 2:71811201-71811223 AGAATGACCTAGGTTCTAGTGGG + Intergenic
933416999 2:81998873-81998895 ACATTTTTTTAGGTTGTAGATGG + Intergenic
933563051 2:83913210-83913232 AGAATGTCAAAGGTAGTAGAAGG + Intergenic
936635515 2:114252099-114252121 GCAAGTACCTAGGTTGTAGAGGG + Intergenic
940254361 2:151713460-151713482 AGAATTTCCATGGTTTTAGAGGG + Intronic
940316514 2:152333166-152333188 AGAATTTCCTAAGATTTTGATGG + Intergenic
942301466 2:174566932-174566954 GGAATTTACTAGAATGTAGATGG + Intronic
942751972 2:179298228-179298250 AGAAGTTCCTAGGTCTTGGATGG - Intergenic
943428696 2:187770372-187770394 AGAATTTCCTTGGTTTTATTAGG + Intergenic
945205853 2:207331397-207331419 AGTATTTCATAGGGTGTGGAAGG - Intergenic
1170474381 20:16700598-16700620 ATTATTTTCTAGGTTCTAGATGG - Intergenic
1170990168 20:21293980-21294002 AGACTTTCCTAGGGTGTTTATGG + Intergenic
1177097611 21:16857057-16857079 AGAATTTTCTAAATTGTATAAGG + Intergenic
1179203987 21:39255818-39255840 ATATTTTCCTAGGTTTTAGAAGG - Exonic
1180237425 21:46471753-46471775 AGGATTTCCTGGGTTCTTGAAGG + Intronic
1182507640 22:30796156-30796178 AGAACTTCCTAGGATCTAGGAGG + Intronic
1183176487 22:36228147-36228169 AGAGTTTCCTCGGTTGAAAAGGG - Exonic
1183759835 22:39806041-39806063 TGAAATTAGTAGGTTGTAGAGGG - Intronic
1183904227 22:41028037-41028059 AAAATTTCCTAGATTGGGGACGG + Intergenic
1184931353 22:47683500-47683522 ATACATTCCTGGGTTGTAGAAGG - Intergenic
949856775 3:8469144-8469166 ATAATATCCTAGGATGTATATGG - Intergenic
951359387 3:21706507-21706529 AGCTTTTCCTAAGTTGTAGCTGG + Intronic
953350500 3:42211919-42211941 AGAATTACCTAGGTTGCCAAAGG + Intronic
955157275 3:56428957-56428979 ACATTTTCCTAGGTTGTGCATGG - Intronic
957387322 3:79513524-79513546 TGAATTTACTAGGGTGTAGGGGG - Intronic
958105358 3:89065730-89065752 AGAATTTTTTAGGTTGTTGTAGG - Intergenic
959185830 3:103047252-103047274 ATGATTTCCTAGGTTAAAGACGG + Intergenic
963726926 3:148933317-148933339 AGAATTTCCTGGGTTTGAGATGG - Intergenic
965917657 3:173870905-173870927 AGAATTTCCTAGGTGATATGAGG + Intronic
967597791 3:191348190-191348212 TGAATTTTCTAGATGGTAGAGGG + Intronic
967928384 3:194671548-194671570 ATATTTTACTAGGTTATAGAAGG - Intronic
970475186 4:16414978-16415000 AAAATTTCCCAGGTTTTAAAGGG + Intergenic
970946670 4:21701069-21701091 AGAATTTCCTAATTTGTATAAGG - Intronic
972786723 4:42333133-42333155 AGAATTCCTTGGCTTGTAGATGG - Intergenic
973622967 4:52745611-52745633 AGAATTTTCCAGGTTGAGGAGGG + Exonic
974201056 4:58641120-58641142 TGAAGTTCCTATGTTTTAGAAGG + Intergenic
975472621 4:74787854-74787876 AGGCTTTCTTAGGTTGGAGATGG - Intronic
978501604 4:109416124-109416146 ATACCTTCCTAGGTTGTAGTTGG + Intergenic
978554444 4:109963754-109963776 AGAATTTCCATGGCTGTTGAAGG - Intronic
981186519 4:141810116-141810138 AGAAGTTCTTATGTTGGAGAGGG + Intergenic
984010910 4:174370502-174370524 AATATTTACTAGGTTGCAGAAGG + Intergenic
984424790 4:179569476-179569498 AGAATTTGTTAGCTTGAAGAAGG - Intergenic
984667601 4:182445860-182445882 AGAATTGCTTAAGTTATAGAAGG + Intronic
986557229 5:9023933-9023955 AGAATTTCAGAGCTTGAAGATGG - Intergenic
988935061 5:36073679-36073701 ATGGGTTCCTAGGTTGTAGATGG + Intergenic
989555671 5:42791876-42791898 AGAATTATCTAGGTTGTACTGGG - Intronic
990227336 5:53669387-53669409 AGTATTAACGAGGTTGTAGAGGG - Intronic
990231557 5:53717895-53717917 AGAATTTGCTTGTTTGTAAAGGG - Intergenic
993503593 5:88687388-88687410 TAAATTTCCCAGGTTGTAAATGG - Intergenic
993572430 5:89558111-89558133 AGCATTTACTAGAATGTAGAGGG - Intergenic
995169098 5:109085700-109085722 AGAACTTCCTAGGTCCTAAAAGG - Intronic
1000451081 5:161387590-161387612 AGCAGTTACTAGGTAGTAGATGG - Intronic
1008156157 6:48017270-48017292 AGAAATACCTAGTTTGTACAAGG + Intronic
1008254854 6:49284723-49284745 AGAATTACCTGGATTGAAGAGGG - Intergenic
1009359551 6:62795009-62795031 AGGAGTTGCTATGTTGTAGAAGG - Intergenic
1009387810 6:63107999-63108021 AGAATTTCCTACTTTTTAAATGG + Intergenic
1010679065 6:78778532-78778554 AGAATTTTTTAGCTTTTAGAAGG + Intergenic
1011394037 6:86887428-86887450 AGAGTTTCATAGGCTGTATAGGG + Intergenic
1011534942 6:88366562-88366584 AGCATTTCCCAGCCTGTAGATGG + Intergenic
1012071958 6:94632997-94633019 AGATATTCCTGGGTTGTAGGAGG - Intergenic
1012696542 6:102391377-102391399 TGAGATTCCTTGGTTGTAGATGG - Intergenic
1012929426 6:105301459-105301481 AGAACTTCCTAGGACTTAGAGGG + Intronic
1013896106 6:115090346-115090368 TGAACTTCCTAGGTTGTACTAGG - Intergenic
1014742059 6:125157150-125157172 AGAATTACCTAGAGTGGAGATGG + Intronic
1014884299 6:126760831-126760853 AGAATATCCTAGATTGTACCTGG + Intergenic
1016178568 6:141113128-141113150 TTAATTTACTAGGTTTTAGAGGG + Intergenic
1016623650 6:146141616-146141638 AGAATTTATTAGCTTGAAGACGG - Intronic
1018476426 6:164146449-164146471 AGTATTTCCTGGTTTGTTGAGGG - Intergenic
1020547240 7:9547892-9547914 AGAATTTCATAGTTTGTATATGG + Intergenic
1020632669 7:10658303-10658325 AGCATTTCTTAGATTGGAGAAGG - Intergenic
1021930162 7:25572656-25572678 AGAATATCCTTGTTAGTAGAGGG - Intergenic
1022013353 7:26328336-26328358 AGAATTGTCTAGGGTGTGGATGG + Intronic
1024960077 7:54964729-54964751 AGAATTTCCCAGCCTCTAGAAGG + Intergenic
1028572734 7:92309423-92309445 AGAATCTCCTAGGATTTGGAGGG + Intronic
1029853893 7:103493745-103493767 AGAATTCCACAGGTTGAAGAGGG + Intronic
1033666316 7:143443971-143443993 TGACATTCCAAGGTTGTAGATGG - Exonic
1035897436 8:3419550-3419572 AGAATTTCCTAGTTAGCTGAGGG - Intronic
1035972373 8:4263596-4263618 ACAATTTCCTGGATTGTTGAAGG - Intronic
1038235830 8:25753462-25753484 ACAATTTCCTTAGTTGTATATGG + Intergenic
1038291308 8:26252195-26252217 TGCATTTCCTGGTTTGTAGATGG + Intergenic
1039138979 8:34361272-34361294 AGAGTTTCCAGGGATGTAGATGG + Intergenic
1039490937 8:37947019-37947041 AGAATTTCCCAAGCTTTAGAAGG + Intergenic
1041388026 8:57325140-57325162 AGAATTTGCTTGTCTGTAGAGGG + Intergenic
1042572524 8:70181955-70181977 AGCATCTCCAAGGTTCTAGAAGG + Intronic
1042818447 8:72903814-72903836 TGGATTACCTAGGTTTTAGAAGG + Intronic
1045733862 8:105272647-105272669 ACAATTTCAGAGATTGTAGATGG + Intronic
1047749351 8:127868096-127868118 AGAGTTACCTAGCTTCTAGAAGG - Intergenic
1048080124 8:131117829-131117851 AGAATTTCCAGGGCTGGAGATGG + Intergenic
1050687914 9:8192054-8192076 AGAATTTCAGAGCTTGAAGATGG + Intergenic
1050728125 9:8675782-8675804 AAAATTGCCCTGGTTGTAGAAGG - Intronic
1050745882 9:8875411-8875433 AGAATTTCCTGGTTTGTAGCTGG - Intronic
1050917228 9:11152104-11152126 AGAATTTACTAATTTTTAGAAGG - Intergenic
1052263186 9:26541190-26541212 AGAATTTCAGAGCTTGAAGATGG + Intergenic
1056218177 9:84425179-84425201 AACATTTCCTGGGTTGTAAATGG + Intergenic
1056717126 9:89041121-89041143 AGAATTTTATAGGCTGAAGAGGG - Intronic
1056784954 9:89584908-89584930 AGTATTTCCTAGGTTGAGAAGGG - Intergenic
1058636260 9:107041438-107041460 AGAATTTCCCTGGGTGGAGAAGG - Intergenic
1059367074 9:113794668-113794690 GGCATTTCACAGGTTGTAGAGGG - Intergenic
1185822591 X:3219563-3219585 AGAGTTTCCTAGGGTGTCCAGGG - Intergenic
1187073425 X:15911128-15911150 AGAATCACCTGGGTGGTAGAAGG + Intergenic
1187240747 X:17510960-17510982 AGATTGTCCCTGGTTGTAGATGG + Intronic
1187488491 X:19727079-19727101 AGAATTTCTTAGCTGGTAGTGGG + Intronic
1187669195 X:21651637-21651659 AGAATTTCCCAGGTGGAAGGTGG - Intronic
1188274676 X:28185073-28185095 GGAATTTCCTAGGTGATAGGAGG - Intergenic
1188358728 X:29225822-29225844 AGAATTTCCTAGGTTGTAGAAGG + Intronic
1188482717 X:30651785-30651807 AGGATTTTCTTGGTTCTAGAAGG - Intergenic
1188562606 X:31486505-31486527 AGAAATCACTAGGTTGAAGAAGG - Intronic
1192199085 X:69052764-69052786 AGAATTTCCCAGGTTTCCGAGGG - Intergenic
1192339088 X:70247513-70247535 AAAATTTCCTACATTGTTGATGG - Intergenic
1193006632 X:76626319-76626341 TGATTTTCCTTGGCTGTAGATGG - Intergenic
1194613648 X:96074782-96074804 AGAAATTCCAAGGTTGGGGATGG - Intergenic
1194717708 X:97306234-97306256 AGGATATACTACGTTGTAGATGG + Intronic
1194997251 X:100604330-100604352 TGAAGTTCCCAGGTTGGAGATGG + Intergenic
1197924992 X:131636861-131636883 AGAATTTGCTAGGTTGGAGTAGG - Intergenic
1201735484 Y:17256195-17256217 AGTATTTCCTAGGTAGTATTAGG + Intergenic