ID: 1188359412

View in Genome Browser
Species Human (GRCh38)
Location X:29234059-29234081
Sequence CTGCATTTATTTATGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 322}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188359412_1188359420 22 Left 1188359412 X:29234059-29234081 CCAAGCTCCATAAATAAATGCAG 0: 1
1: 0
2: 4
3: 29
4: 322
Right 1188359420 X:29234104-29234126 CTTCGTGAGACTCGGAGCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 171
1188359412_1188359418 20 Left 1188359412 X:29234059-29234081 CCAAGCTCCATAAATAAATGCAG 0: 1
1: 0
2: 4
3: 29
4: 322
Right 1188359418 X:29234102-29234124 TGCTTCGTGAGACTCGGAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 57
1188359412_1188359419 21 Left 1188359412 X:29234059-29234081 CCAAGCTCCATAAATAAATGCAG 0: 1
1: 0
2: 4
3: 29
4: 322
Right 1188359419 X:29234103-29234125 GCTTCGTGAGACTCGGAGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1188359412_1188359417 14 Left 1188359412 X:29234059-29234081 CCAAGCTCCATAAATAAATGCAG 0: 1
1: 0
2: 4
3: 29
4: 322
Right 1188359417 X:29234096-29234118 CAATACTGCTTCGTGAGACTCGG 0: 1
1: 0
2: 0
3: 4
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188359412 Original CRISPR CTGCATTTATTTATGGAGCT TGG (reversed) Intronic
900644572 1:3703129-3703151 CTGCAGTTATGAATGCAGCTGGG - Intronic
902129851 1:14250628-14250650 ATGAATATATTTATAGAGCTTGG + Intergenic
904329313 1:29747542-29747564 CCCCATCTATTCATGGAGCTTGG + Intergenic
904431859 1:30469470-30469492 ATTTATTTATTTATGGAGCTGGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
904925608 1:34045558-34045580 GTGCATTTATTTTTGGAGGCTGG + Intronic
904984355 1:34532613-34532635 ATGTATTTATATATAGAGCTAGG + Intergenic
907780056 1:57558671-57558693 CTGCATTTAATGTTGCAGCTTGG + Intronic
909595903 1:77405839-77405861 CTGTGTTTATTAATGAAGCTGGG + Intronic
909991111 1:82223716-82223738 CTTCATTTTTTTATGGAGACGGG + Intergenic
910119126 1:83765304-83765326 TAGCATTTATTTATGGGGCAGGG + Intergenic
910639260 1:89442127-89442149 CTGCATTTAATGTTGCAGCTTGG - Intergenic
911704606 1:100997002-100997024 CTGCTTTTGTTAATGGAGCAAGG + Intronic
911735953 1:101336810-101336832 CTGCATTTAATACTGCAGCTTGG + Intergenic
911883290 1:103268310-103268332 CTGCATTTAATGTTGAAGCTCGG + Intergenic
912124249 1:106513456-106513478 CTGCATTTTCTTCTGGAGCTTGG + Intergenic
912130187 1:106590216-106590238 CTGCATTTAATCTTGCAGCTTGG - Intergenic
912252117 1:108021974-108021996 CTGCATTTAATGTTGCAGCTTGG - Intergenic
912478040 1:109954392-109954414 CTGCATTCTTTTATGGAGCTCGG - Intergenic
913039624 1:115009782-115009804 CTGCATTTAATGTTGCAGCTTGG + Intergenic
913172872 1:116248110-116248132 CTGCTCATATTTATTGAGCTGGG + Intergenic
917027808 1:170661758-170661780 ATGCATTTAATTAAGGAACTGGG - Intergenic
917112967 1:171570610-171570632 CTGCCTTTATCTCTGGATCTTGG - Intronic
917217501 1:172693072-172693094 CTGCATTTAATGTTGCAGCTTGG - Intergenic
918756005 1:188339958-188339980 CTGCATTTAATATTGCAGCTAGG - Intergenic
919601665 1:199630797-199630819 CTACATTTATTTATGCAGCAGGG - Intergenic
920705279 1:208246035-208246057 CTCCATTTGTTCATGGAGTTTGG + Intergenic
920794532 1:209125829-209125851 CTCCAATTATTTATGGAGGATGG - Intergenic
921622862 1:217345444-217345466 CTGCATATATTTTAGGAGCTGGG - Intergenic
921912314 1:220562996-220563018 CTGCATTTAAGTAGGTAGCTTGG + Intronic
924051066 1:240080014-240080036 TTGCAATTATTTATGTAGCTAGG - Intronic
924309374 1:242724207-242724229 CTGCAGTTAGTTCTGGTGCTGGG - Intergenic
1064458520 10:15510724-15510746 CTACATTTCTTTATGGATTTTGG + Intergenic
1065526781 10:26630376-26630398 TTGCATTTTTTCATGGAGATGGG + Intergenic
1065754275 10:28916797-28916819 CTGCATTTTTTGGTGGGGCTGGG + Intergenic
1067281627 10:44877741-44877763 GTGTATTTATTTGTGGGGCTGGG + Intergenic
1068754233 10:60632713-60632735 CTGAATTTTTTTATAGAGGTGGG - Intronic
1069192605 10:65508535-65508557 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1071133278 10:82421016-82421038 AGGCATTTCTTTATGGTGCTGGG + Intronic
1072209553 10:93233854-93233876 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1073557047 10:104463739-104463761 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1075187970 10:120280219-120280241 CCACTTTTATTTATGGTGCTGGG + Intergenic
1077780763 11:5326971-5326993 CTGTATGTATTTATGCATCTTGG - Intronic
1078424319 11:11236991-11237013 CAGCTTTTATTTATGAAGCAAGG + Intergenic
1079192375 11:18290749-18290771 CTTCATTTTTTTATAGAGATGGG - Intronic
1081110181 11:39126211-39126233 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1081590096 11:44416628-44416650 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1082612657 11:55320474-55320496 CTGTATTTATGTATGGTGCAGGG + Intergenic
1082895772 11:58188414-58188436 CTGCATCAATCTATGGAGGTGGG + Intergenic
1084771376 11:71344776-71344798 CTGCATTTATTTTAGGAGGTGGG + Intergenic
1085685675 11:78620004-78620026 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1085747288 11:79126058-79126080 CTGCATTTAATGTTGCAGCTTGG + Intronic
1086028941 11:82329148-82329170 ATGCATGTATTTTTGGAGATCGG - Intergenic
1088191969 11:107236685-107236707 CTGCATTTAAGGTTGGAGCTTGG - Intergenic
1089903339 11:122011449-122011471 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1090280723 11:125454011-125454033 CAGCATTTATTTAGGGGGTTAGG - Intronic
1092948526 12:13478882-13478904 ATGGATATATTTATGGTGCTGGG - Intergenic
1092983330 12:13819873-13819895 CTCCATTTATGTATGGACCCTGG - Intronic
1093098158 12:14995454-14995476 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1093545602 12:20342622-20342644 CTCCCTTTATATATAGAGCTTGG - Intergenic
1096053260 12:48629486-48629508 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1096723210 12:53539895-53539917 TTGCATTTATTTTTAGAGATGGG - Intronic
1097821723 12:64134689-64134711 CTGCATTTAATGTTGCAGCTCGG - Intronic
1098730782 12:74035188-74035210 CTGCATTTAATGTTGCAGCTCGG + Intergenic
1098749559 12:74277310-74277332 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1099375362 12:81891792-81891814 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1099379946 12:81940926-81940948 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1099577808 12:84403262-84403284 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1099821508 12:87716973-87716995 CTGCATTTAATGTTGGAACTTGG - Intergenic
1100083038 12:90876049-90876071 CTGCATTTAATGTTGCAGCTCGG + Intergenic
1100147085 12:91691177-91691199 CTCCATTTAGTTTTGGAGGTGGG - Intergenic
1100977826 12:100141046-100141068 CTGTATTTTCTTGTGGAGCTGGG + Intronic
1101114408 12:101518149-101518171 ATTCATTTATTTATTGAGATAGG + Intergenic
1102843611 12:116153427-116153449 CTGCAATTATTTGTGGTGGTGGG - Intronic
1103396226 12:120609268-120609290 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1104392243 12:128400779-128400801 TTGCATTTTTTTGTGGAGATGGG + Intronic
1105858381 13:24390399-24390421 CTGCATTTATTTCCGTAGCTGGG - Intergenic
1108757131 13:53517146-53517168 ATGTATTTATTTATTGAGATAGG - Intergenic
1109292934 13:60497962-60497984 CTGCATTTAATATTGCAGCTCGG + Intronic
1109459981 13:62643922-62643944 CTGCATTTAATTTTGCAGCTTGG + Intergenic
1110304289 13:73967117-73967139 ATGCATTTAATTATGGATTTGGG - Intronic
1110555821 13:76857993-76858015 AGGCATTTTTTTGTGGAGCTGGG - Intergenic
1110823209 13:79940760-79940782 TTGGATTTTTTTATGAAGCTTGG + Intergenic
1111576030 13:90154948-90154970 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1111887434 13:94039900-94039922 CTGCATTTAATTAAAGAGGTTGG - Intronic
1112154165 13:96799059-96799081 CTGTATTTAGATATGGAGATAGG - Intronic
1113075019 13:106459728-106459750 CGTCATTTATTTGTGGGGCTTGG + Intergenic
1113207734 13:107936755-107936777 CTGTATTTATTTCTGGAGTGTGG + Intergenic
1115423815 14:33230069-33230091 CTGCATTTATCTCTTTAGCTGGG - Intronic
1116248890 14:42456098-42456120 CTGCATTTAATATTGCAGCTCGG + Intergenic
1118815516 14:69310907-69310929 TTTTATTTATTTATTGAGCTGGG - Intronic
1118950850 14:70435266-70435288 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1119698385 14:76732867-76732889 CTACATTTTTTTATGGAGGAAGG - Intergenic
1120001118 14:79304127-79304149 CTGCATTTAGTCATAGAGATTGG + Intronic
1120337975 14:83183285-83183307 CTGCATTTATTTCTGTTGATTGG + Intergenic
1120785301 14:88528848-88528870 CTGAATTCATTTATCGATCTAGG + Intronic
1120973369 14:90228278-90228300 CTGCATTTAATGCTGCAGCTTGG + Intergenic
1121371084 14:93359109-93359131 CTGCATTTAATGTTGTAGCTTGG + Intronic
1121571056 14:94946851-94946873 CTGCATGGAGTTCTGGAGCTGGG + Intergenic
1124509359 15:30309950-30309972 CTGCATTTAATATTGTAGCTTGG + Intergenic
1124734201 15:32228712-32228734 CTGCATTTAATATTGTAGCTTGG - Intergenic
1126757804 15:51941260-51941282 CTGCATTTATATATGACACTGGG - Intronic
1126764618 15:51999943-51999965 CTATATTTATTTATTGAGATGGG + Intronic
1128256106 15:66198051-66198073 ATGTATTTATTTATTGAGATGGG - Intronic
1128268221 15:66285785-66285807 CTGCAATCACTTCTGGAGCTTGG - Intergenic
1129646472 15:77438554-77438576 CTGCATTTTCTTATATAGCTTGG + Intronic
1130623371 15:85487569-85487591 TTTTATTTATTTATGGAGATGGG + Intronic
1130788455 15:87125772-87125794 CTACAGTTATTGATGGAGATTGG - Intergenic
1130813505 15:87406481-87406503 CTTCATTTATTTATTGAACAAGG - Intergenic
1133447540 16:5874939-5874961 ATGCATTTATTTATGGGGGACGG - Intergenic
1134386943 16:13782143-13782165 CTGCATTTTTATTTTGAGCTTGG - Intergenic
1135658005 16:24268390-24268412 CTGCCTTAATTTAAGGACCTGGG + Intronic
1137751431 16:50863710-50863732 CTGCATTTATTCGTGAGGCTGGG + Intergenic
1138110601 16:54320787-54320809 CTCCATTTATTTGTGAGGCTGGG - Intergenic
1140073370 16:71672930-71672952 GTGCATATATTTATGTAGATAGG - Intronic
1143141203 17:4742742-4742764 CTGCAGTTAGTGGTGGAGCTGGG - Intronic
1145993321 17:29092049-29092071 CTGCCTTTATTTATGGTGTTGGG + Intronic
1146753541 17:35405380-35405402 GTTTATTTATTTATGGAGATAGG + Intergenic
1146850638 17:36218842-36218864 CTGCATTTAATGTTGCAGCTTGG + Intronic
1149032949 17:52104373-52104395 TTGCATTTATTTGTGGAGACTGG + Intronic
1149509271 17:57225072-57225094 TTGTATTTATTTATAGAGCTGGG + Intergenic
1150631892 17:66885620-66885642 CTGCATCTGTGTAAGGAGCTTGG - Intergenic
1150694055 17:67389068-67389090 CTGCCTTTCTTTCTGGAGCTTGG + Intronic
1151728474 17:75897484-75897506 CTGCACTTTTTCCTGGAGCTGGG + Intergenic
1153131551 18:1859872-1859894 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1153383181 18:4460976-4460998 TTGTATATATTTATGGAGCATGG + Intergenic
1153513337 18:5879355-5879377 CTGAATTCTTTTATGTAGCTAGG - Intergenic
1153980705 18:10307128-10307150 GTGCATTTATTTACACAGCTAGG - Intergenic
1155135382 18:22986589-22986611 CGGCATTTATTTATGTTGATAGG + Intronic
1155426624 18:25714038-25714060 CTGCATTTCTTGCTGGAGCAAGG - Intergenic
1156822558 18:41390401-41390423 GTGGTTTTATTTATGCAGCTTGG - Intergenic
1156877363 18:42031105-42031127 CTGCATTTCTTCATGGTGCCAGG - Intronic
1157094611 18:44676589-44676611 CAGCAAATATTTATGGAGCATGG - Intergenic
1157231111 18:45916872-45916894 CTGCCTTTATTCATGGAGTTGGG - Intronic
1158705317 18:59787354-59787376 TTGCATTTCTTTATGGAACGGGG - Intergenic
1159389952 18:67778490-67778512 ATGCATTTAATTATGTAGATTGG + Intergenic
1163291937 19:16384670-16384692 CTGCATTTATTCAAGGAGGCCGG + Intronic
1164097410 19:22023848-22023870 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1164117593 19:22237297-22237319 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1164825691 19:31283325-31283347 ATGTATTTATTTTTGGAGATAGG - Intronic
1165144850 19:33724501-33724523 CTTCAATTATTCATGGAGCCTGG - Intronic
1167305878 19:48709116-48709138 CTGCATTTTTTTATAGAGACAGG - Intergenic
1168330360 19:55564368-55564390 CAGCAAATATTTATGGAGCCAGG + Intergenic
925656482 2:6155499-6155521 CTGAATTTCTTTTTGGAGCTGGG - Intergenic
926122003 2:10246463-10246485 TTGCATTTTTTCATGGAGATGGG - Intergenic
927534112 2:23838785-23838807 GTGCATTTATTTATGGCTCTGGG + Intronic
928702382 2:33912165-33912187 CTGTATTTATCCATGGACCTTGG + Intergenic
930107654 2:47652753-47652775 TTGCATTTATTAATAGAGCAGGG + Intergenic
932609547 2:73188478-73188500 CTCCATCTATTTATGGCACTTGG + Intergenic
933265986 2:80180905-80180927 CTGCATTTAATGTTGCAGCTTGG - Intronic
933578837 2:84101906-84101928 CTGCATATATTTGTAGAGCTGGG - Intergenic
936530634 2:113274690-113274712 CTGTAATTATTGATGGAGTTGGG - Intronic
937824119 2:126345967-126345989 ATGCATTTATTTATGGAGTCAGG - Intergenic
937852841 2:126650902-126650924 CTGCATTTAATGTTGCAGCTTGG - Intergenic
939805966 2:146776287-146776309 CTGCATTTAATGTTGTAGCTCGG + Intergenic
941667718 2:168258994-168259016 CTGCATTTAATGTTGCAGCTTGG + Intergenic
942212040 2:173681030-173681052 CTGCAGTTGTTTCTGGAACTGGG - Intergenic
942506076 2:176642886-176642908 CTGTATTTATGTAGTGAGCTCGG - Intergenic
942593657 2:177571823-177571845 CAGCACTTATTTAAGGAGCTTGG + Intergenic
942997361 2:182279313-182279335 CTCTATTTTTTTATGGTGCTGGG - Intronic
943392187 2:187283988-187284010 CTGCATTTAATGTTGCAGCTTGG - Intergenic
943400210 2:187399372-187399394 TTGCATTTACTTTTTGAGCTGGG - Intronic
944066140 2:195620994-195621016 CTCTATTTATTTTTGGAGCAAGG - Intronic
945544601 2:211135987-211136009 CTGCATTTAATGTTGCAGCTGGG + Intergenic
947017327 2:225635730-225635752 CTGCATTTATAGATGGAATTTGG + Intronic
947649388 2:231772425-231772447 CTGCTTATAATTTTGGAGCTGGG - Intronic
948432687 2:237930074-237930096 CTGCATTCATTTATATCGCTGGG + Intergenic
1171296412 20:24020912-24020934 CTGCATTTAATATTGCAGCTTGG + Intergenic
1173389945 20:42622978-42623000 GTGCATTTCTTTCTGGAGCCTGG - Intronic
1174228739 20:49026445-49026467 TTGTATTTATTTTTGGAGGTAGG - Intronic
1175272038 20:57740902-57740924 CTGCACTATTTTCTGGAGCTTGG - Intergenic
1177330728 21:19657763-19657785 CTGCCTTCCTTTGTGGAGCTTGG - Intergenic
1177363445 21:20103667-20103689 CTGCATTTAATGTTGCAGCTCGG + Intergenic
1178061026 21:28853334-28853356 CTGCATTTAATGTTGTAGCTTGG - Intergenic
1178153735 21:29827162-29827184 CTGCATTTCTTTATTAAGTTAGG - Intronic
1178668576 21:34570105-34570127 CTGCATTTATATAGGGATTTAGG - Intronic
1178764110 21:35433119-35433141 CTGCATTTAATGCTGCAGCTCGG - Intronic
1178982351 21:37275753-37275775 ATTAATTTATTTATGGAGCCAGG + Intergenic
1180022542 21:45137602-45137624 CTGCGTTCAGTGATGGAGCTTGG + Intronic
1180709381 22:17829475-17829497 TTGCCTTTCTTTATGGTGCTGGG + Intronic
1181134995 22:20758921-20758943 ATGAATTTATTTTTGCAGCTGGG - Intronic
1182965653 22:34518991-34519013 CTGCATTTAATGTTGCAGCTCGG - Intergenic
1183092587 22:35532968-35532990 CAGCAATAATTGATGGAGCTGGG - Intergenic
1183321878 22:37169878-37169900 CTGCATTTCTTTATGCTGCCTGG + Intronic
1184529557 22:45046256-45046278 TTGCATTTTTTTGTGGAGATGGG - Intergenic
1185048163 22:48539550-48539572 CTGTATTTTTTTAAGAAGCTAGG + Intronic
949245586 3:1922726-1922748 CTGCATTTAATGTTGCAGCTTGG + Intergenic
949638495 3:6010333-6010355 CTGCATTTAATGTTGCAGCTTGG + Intergenic
951978432 3:28540367-28540389 CTGCATTTAATGTTGCAGCTTGG + Intergenic
954053831 3:48005511-48005533 CTGCATTTAATGTTGCAGCTCGG + Intronic
954511827 3:51132167-51132189 CTGCATTTAATATTGCAGCTTGG - Intronic
956509361 3:69978176-69978198 CTGCATTTAATATTGCAGCTTGG + Intergenic
956716001 3:72080521-72080543 CTCCATTCATTTATGGGGTTGGG + Intergenic
957897841 3:86446642-86446664 CTGCATTTAATGTTGCAGCTTGG + Intergenic
958098651 3:88980438-88980460 CTGAATTTATATATGAAGCCAGG - Intergenic
958845814 3:99262736-99262758 CTGCATTTAATGTTGCAGCTTGG - Intergenic
959746297 3:109779439-109779461 CTGCATTTAATGTTGCAGCTCGG - Intergenic
961588243 3:127953406-127953428 CTGCTTTTCTGTATGGAGCCAGG + Intronic
961648693 3:128406637-128406659 TTGCATTTTTTTGTGGAGATGGG - Intronic
963630023 3:147721038-147721060 CTGCATTTAATGTTGCAGCTTGG + Intergenic
963661105 3:148129949-148129971 CTGCATTTAATGTTGTAGCTTGG + Intergenic
964272754 3:154976018-154976040 CAACAATTATTTATGGAGCTAGG + Intergenic
964530546 3:157663160-157663182 ATGCATTTATTTATGAAACAGGG - Intronic
967069898 3:185953365-185953387 CTGCATTTTTTTGTAGAGATAGG + Intergenic
967811414 3:193764205-193764227 CTACTTTTATCTATGGAGGTTGG - Intergenic
970629242 4:17923273-17923295 CTGCATTTAATGTTGCAGCTTGG + Intronic
970873767 4:20845870-20845892 CTGCATTTCTTTCTGGATCGTGG - Intronic
971979574 4:33735049-33735071 CTGCATTTAATGTTGGGGCTTGG - Intergenic
974644893 4:64676962-64676984 CTACATTTAATTTTGCAGCTTGG - Intergenic
975065981 4:70064144-70064166 CTGCATTTTTTTTTCGTGCTAGG - Intergenic
975860236 4:78669370-78669392 CTGCAGTTTTTGATGGAGCTAGG - Intergenic
975982906 4:80179459-80179481 CTGCATTTAATATTGCAGCTTGG - Intergenic
976686618 4:87821394-87821416 CTGCATTTGTTTATGTAAATGGG - Exonic
976714480 4:88108892-88108914 CTGCATTTATTTTGGAAGCTTGG - Intronic
976947233 4:90785207-90785229 TTGTATTTTTTTATGGAGATGGG + Intronic
977335767 4:95696806-95696828 CTGCTTTCATTTACGGAGCCAGG - Intergenic
977702025 4:100032075-100032097 CTGCATTTAATGTTGCAGCTTGG - Intergenic
979600087 4:122577858-122577880 CAATATTTATTTATGGATCTAGG - Intergenic
979713808 4:123812429-123812451 GGGCATTTCTTAATGGAGCTTGG + Intergenic
979790440 4:124773882-124773904 CTGAATTCATTTATCGATCTAGG + Intergenic
980388193 4:132113295-132113317 CTGCATTTAATGTTGCAGCTTGG - Intergenic
980689091 4:136268969-136268991 CTGTATTTGTTTATGGATCCTGG - Intergenic
980957489 4:139444186-139444208 CTGCATTTAATGTTGCAGCTCGG + Intergenic
981158343 4:141467079-141467101 CTGCATCTACGTATGGAGCTAGG + Intergenic
981977201 4:150745131-150745153 CTGCATTTCTTTCTGGAGCTTGG - Intronic
983976908 4:173945631-173945653 TTGAAGCTATTTATGGAGCTTGG + Intergenic
984400862 4:179261972-179261994 CTGCATTTAGTGTTGCAGCTCGG + Intergenic
984415226 4:179449022-179449044 ATTCATTTATTTATTGAGATAGG - Intergenic
985915429 5:2914733-2914755 TTGCATTCTTTCATGGAGCTAGG + Intergenic
985967921 5:3351832-3351854 TGTCATTTATTTATGGTGCTTGG - Intergenic
986955816 5:13148324-13148346 CTGCATTTAATGTTGCAGCTCGG - Intergenic
987424771 5:17760307-17760329 TTGCAGTTATTTCTAGAGCTTGG + Intergenic
987504123 5:18747671-18747693 CTGCATTTAATGTTGCAGCTTGG + Intergenic
988161094 5:27519065-27519087 CTGCATTTAATGTTGCAGCTTGG - Intergenic
989097491 5:37794813-37794835 CTGCATTTAATGTTGCAGCTTGG + Intergenic
990693821 5:58392774-58392796 CTGCATTGATTTGTGGTGCTGGG + Intergenic
992527746 5:77628823-77628845 CTGTGTTTATTTATGGAATTCGG - Exonic
993026931 5:82657757-82657779 CTGCATGTATTTATGGACACAGG - Intergenic
993116029 5:83721631-83721653 CTGGATTTATTTATAGAACGAGG + Intergenic
993724890 5:91355897-91355919 ATGTATTTATTTATTGAGATGGG + Intergenic
994958181 5:106562142-106562164 CTGCATTTAATATTGCAGCTTGG + Intergenic
995428020 5:112045963-112045985 CTGCATTTAATTTTGCAGCTTGG - Intergenic
995776591 5:115729870-115729892 CTGCATTTAATTTTGCAGCTTGG - Intergenic
996165355 5:120215617-120215639 CAGTATTTGCTTATGGAGCTGGG + Intergenic
998290615 5:140910769-140910791 CTGCATTTAATGTTGCAGCTTGG - Intronic
998764499 5:145470564-145470586 CTGCCCTTGCTTATGGAGCTGGG + Intergenic
999159519 5:149483819-149483841 CTTCAATTATTTTTGGAGATGGG - Intergenic
999297631 5:150470094-150470116 ATGTATTTATTTATTGAGATGGG + Intergenic
1000200124 5:159001014-159001036 CTATATATATTTATGAAGCTGGG + Intronic
1000356761 5:160404190-160404212 CTGTATTTTTTTATAGAGCCAGG - Intronic
1000416684 5:160991754-160991776 CTGCATTTAATGTTGCAGCTCGG + Intergenic
1001795266 5:174496915-174496937 CAGCATTATTTCATGGAGCTAGG + Intergenic
1003950957 6:11115351-11115373 CTGCGTTCCTTTCTGGAGCTTGG + Intronic
1004678492 6:17868465-17868487 CTGCATGTATATATGAAGTTCGG + Intronic
1005196327 6:23288495-23288517 TTTCATATATTTATGGGGCTTGG - Intergenic
1005297600 6:24441810-24441832 CTGCATTTTTATTTGGAACTGGG + Intronic
1006001214 6:30966585-30966607 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1006057343 6:31395210-31395232 GTGCTTTTATTTCAGGAGCTGGG - Intergenic
1008399999 6:51053296-51053318 CTGCATTTAATATTGCAGCTTGG + Intergenic
1008612809 6:53199884-53199906 CTGCTTTTATTTAAGGTGCAGGG + Intergenic
1010152800 6:72755257-72755279 GTGCATTTATTTATAGAGTTGGG + Intronic
1010581004 6:77595931-77595953 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1010616961 6:78024715-78024737 CTTCATTTATTTTTGTACCTTGG + Intergenic
1010818310 6:80385916-80385938 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1010958801 6:82121989-82122011 CTGTATTTTTTTATAGAGATGGG - Intergenic
1012942798 6:105433791-105433813 CTGCCTGTATTTAAGAAGCTGGG + Intergenic
1014310788 6:119798698-119798720 TTGCATTTATTTCTGTAGCCAGG + Intergenic
1015010371 6:128339098-128339120 CTGTATTTTATTATGGAGCATGG + Intronic
1015233759 6:130947025-130947047 CTGCAGTAATTTAAGGGGCTGGG - Intronic
1015467214 6:133560423-133560445 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1015475449 6:133655129-133655151 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1016120189 6:140334842-140334864 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1016822602 6:148360734-148360756 CTGCAGTTATTTATGGAGCATGG + Intronic
1017051408 6:150397395-150397417 TTGTATTTATTTATAGAGATGGG - Intronic
1017228104 6:152043278-152043300 CTGCATTTAATGTTGCAGCTTGG - Intronic
1017533599 6:155322852-155322874 CTGCAGATTTTTATTGAGCTTGG + Intergenic
1017808858 6:157969477-157969499 CTGCATTTCTTAAGGGATCTTGG + Intergenic
1017977404 6:159370254-159370276 CTGCATTTATTGTTGCAGCTTGG - Intergenic
1018107621 6:160503993-160504015 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1018123259 6:160657720-160657742 CTGCATTTAATGTTGCAGCTCGG - Intronic
1018513524 6:164552934-164552956 CTGCATTTATTTATATTGTTAGG + Intergenic
1018569680 6:165195891-165195913 CTGCATTTAATGTTGTAGCTTGG + Intergenic
1018955372 6:168406522-168406544 CTGCATTTAATGCTGGAGTTTGG - Intergenic
1020537515 7:9419621-9419643 CTTTATTTATTTATCGAGATGGG - Intergenic
1020567649 7:9817929-9817951 CTGCATTTAATCTTGGAGCCTGG - Intergenic
1021111772 7:16703225-16703247 CTGGATTTACTTATAGAGCCTGG - Intronic
1022349323 7:29552561-29552583 CTGCATTCCTTTATGGAGGCTGG + Intergenic
1022648593 7:32254537-32254559 CTGCATTTATTTATTGCTTTTGG - Intronic
1022989160 7:35691141-35691163 CTTCATTTATTTATATAACTAGG - Intronic
1023663098 7:42490878-42490900 TTGCCTTTATTTATGGGGGTGGG - Intergenic
1024614186 7:51094550-51094572 CAGCTTTTATTTATCTAGCTAGG - Intronic
1024958543 7:54951268-54951290 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1027564916 7:79779638-79779660 ATGTATGTATTTATGGAGATGGG + Intergenic
1028011852 7:85655495-85655517 CTGCATTTTGTCATGGAGCTCGG - Intergenic
1028141460 7:87279786-87279808 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1028270774 7:88786110-88786132 CTGCATTTAGTTATTCAGCAAGG - Intronic
1031124102 7:117753996-117754018 CTGTAGTTATTTGTGGAACTGGG + Intronic
1031931798 7:127693252-127693274 CTGATTTTATTTTTGGAGATTGG + Intronic
1032410632 7:131691355-131691377 CTGCTTTTATCTATGGACCTTGG + Intergenic
1033075928 7:138250513-138250535 CTGCATTTAATGTTGCAGCTCGG + Intergenic
1033313573 7:140280068-140280090 CTGCATTTGTTTATGTGGTTTGG + Intergenic
1036142087 8:6217998-6218020 CTACATTTATTGCTGTAGCTTGG + Intergenic
1036979858 8:13458307-13458329 GTGCTCTTATTTATGGAGCAAGG - Intronic
1037147262 8:15587453-15587475 CTGTATATATTTATGGAGTACGG + Intronic
1037317845 8:17615967-17615989 CTGAACTTGTTTACGGAGCTTGG + Intronic
1038164210 8:25069044-25069066 CTCAAATTATTTATTGAGCTTGG + Intergenic
1038628038 8:29213422-29213444 CTGTATTTAATTGTGGACCTTGG - Intronic
1038868327 8:31464355-31464377 ATTTATTTATTTATAGAGCTGGG - Intergenic
1039578925 8:38648121-38648143 CTGCTGTCCTTTATGGAGCTTGG - Intergenic
1039951157 8:42173782-42173804 CTGCATTTATTTACTGGCCTAGG + Intergenic
1041237187 8:55815951-55815973 ATTTATTTATTTATGGAGATAGG + Intronic
1041985902 8:63922289-63922311 CTGCATTTAATGCTGCAGCTTGG + Intergenic
1042126204 8:65539553-65539575 ATGCATTTATTTTTGGAGTCAGG - Intergenic
1043655144 8:82655065-82655087 GTGCATTTATTTATTGTGCCTGG + Intergenic
1044150523 8:88770903-88770925 CTGCATTTAATGTTGCAGCTGGG + Intergenic
1046010368 8:108539154-108539176 CTGAATTTATTTCTGGAGCTTGG + Intergenic
1046291600 8:112169419-112169441 CTATATTTATTTAGGGAGCTAGG + Intergenic
1046355761 8:113082322-113082344 ATGCATTTATTTGTGGAGACTGG - Intronic
1047938570 8:129805687-129805709 GTGCCTTTGTTTATGGGGCTTGG - Intergenic
1052848297 9:33357535-33357557 ATGTATTTATTTATTGAGATAGG + Intronic
1052926682 9:34022739-34022761 ATGTATTTATTTAAGGAGATAGG - Intronic
1053570754 9:39303394-39303416 CTTCTTTTATTTATGTAGATTGG - Intergenic
1053836698 9:42144312-42144334 CTTCTTTTATTTATGTAGATTGG - Intergenic
1054092375 9:60862413-60862435 CTTCTTTTATTTATGTAGATTGG - Intergenic
1054113789 9:61138006-61138028 CTTCTTTTATTTATGTAGATTGG - Intergenic
1054126391 9:61315618-61315640 CTTCTTTTATTTATGTAGATTGG + Intergenic
1054593908 9:67044183-67044205 CTTCTTTTATTTATGTAGATTGG + Intergenic
1056867457 9:90241887-90241909 CTGCATTTCTTCTTGCAGCTGGG + Intergenic
1057316636 9:93973237-93973259 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1058273219 9:103002650-103002672 CTGCATTTACTCTTGTAGCTTGG + Intronic
1058829991 9:108807693-108807715 CTGCATTTTTCTTAGGAGCTTGG - Intergenic
1059613372 9:115923102-115923124 CTGCTTATATTTATGGAGGCTGG + Intergenic
1060805670 9:126574584-126574606 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1185567905 X:1109695-1109717 ATGCATTTATTTTTTGAGATGGG + Intergenic
1185831428 X:3306549-3306571 CTGCATGTATTTATCTAGCACGG + Intergenic
1186279353 X:7975962-7975984 CTGCTTTTAATTTTGCAGCTGGG + Intergenic
1187604597 X:20869870-20869892 CTGCATTTAATATTGTAGCTCGG + Intergenic
1188015394 X:25102671-25102693 CTGCACTTAATTATGTTGCTAGG + Intergenic
1188359412 X:29234059-29234081 CTGCATTTATTTATGGAGCTTGG - Intronic
1190200348 X:48355641-48355663 CTTCCTTTATTTATTGAGCGGGG - Intronic
1191719528 X:64217850-64217872 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1191769777 X:64742290-64742312 CTGCATTTAATGTTGCAGCTCGG - Intergenic
1193251436 X:79295866-79295888 CTGGATTCCTTTATGGATCTAGG - Intergenic
1193877007 X:86873108-86873130 CTGCATTTAATATTGCAGCTTGG + Intergenic
1194833653 X:98656602-98656624 CTGCATTTAGTGTTGCAGCTCGG + Intergenic
1195749134 X:108146869-108146891 CTGCATTTAATGTTGCAGCTCGG - Intronic
1196372613 X:114996295-114996317 CTGCATTTAATGTTGCAGCTCGG - Intergenic
1196934747 X:120718580-120718602 TTGCATTCCTTTTTGGAGCTTGG + Intergenic
1197074330 X:122337092-122337114 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1197497747 X:127207165-127207187 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1198404892 X:136302523-136302545 CTGCATTTAATGTTGCAGCTGGG - Intronic
1198933684 X:141885342-141885364 CTGCATTTAATGTTGCAGCTTGG + Intronic
1199742507 X:150748822-150748844 ATGCATTTATTTATTTAGATAGG - Intronic
1200019327 X:153188591-153188613 GTGCATTTCTTTATGGAGGCAGG + Intergenic
1200340578 X:155391279-155391301 CTGCATTTAATGTTGCAGCTCGG - Intergenic
1201701031 Y:16882519-16882541 CTTAATTTATTTATAGAGATCGG - Intergenic