ID: 1188364300

View in Genome Browser
Species Human (GRCh38)
Location X:29295737-29295759
Sequence TGATGGACAGAGTTTCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188364300_1188364304 25 Left 1188364300 X:29295737-29295759 CCAAGATGAAACTCTGTCCATCA 0: 1
1: 0
2: 4
3: 13
4: 157
Right 1188364304 X:29295785-29295807 GTGTAGACTGAAAGGAACAAAGG 0: 1
1: 0
2: 0
3: 20
4: 249
1188364300_1188364302 3 Left 1188364300 X:29295737-29295759 CCAAGATGAAACTCTGTCCATCA 0: 1
1: 0
2: 4
3: 13
4: 157
Right 1188364302 X:29295763-29295785 CTACGCTATTACAAGCTCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 11
1188364300_1188364303 17 Left 1188364300 X:29295737-29295759 CCAAGATGAAACTCTGTCCATCA 0: 1
1: 0
2: 4
3: 13
4: 157
Right 1188364303 X:29295777-29295799 GCTCGAAGGTGTAGACTGAAAGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188364300 Original CRISPR TGATGGACAGAGTTTCATCT TGG (reversed) Intronic
900936413 1:5768980-5769002 CGAGAGACAGGGTTTCATCTGGG + Intergenic
901205360 1:7491805-7491827 TGATGGGCAGAGCTTCCTCTGGG + Intronic
902702050 1:18179167-18179189 TGATGGACAGAGTCCCCTCTCGG - Intronic
904282218 1:29428572-29428594 ACATGGACAGAGCCTCATCTGGG + Intergenic
905774218 1:40658137-40658159 TGATGAAAAGAGTTACATCTTGG + Intronic
906891326 1:49718418-49718440 TGAAGAAAAGAGTTTTATCTTGG - Intronic
907076018 1:51579200-51579222 TAAGGTACAGAGTTTCTTCTGGG + Intronic
909132331 1:71753547-71753569 TGATGGAAAGAGTAGTATCTAGG - Intronic
909281886 1:73767154-73767176 TTCTGGACATAGTCTCATCTTGG + Intergenic
910798594 1:91122696-91122718 CCATGGAAAGAGTTGCATCTTGG + Intergenic
911051995 1:93679504-93679526 AGATGGCCAGAGTCTCACCTGGG - Intronic
912783780 1:112579023-112579045 TCATAGACATAATTTCATCTCGG - Intronic
913131846 1:115845790-115845812 TAATCAGCAGAGTTTCATCTTGG + Intergenic
915096429 1:153465855-153465877 TCAGGGCCAGAGTTTCATCCTGG - Intergenic
915417551 1:155753542-155753564 TTGTTGACAGAGTTTCAACTGGG + Intronic
915893794 1:159795340-159795362 AGAGGGACAGAGTTTTATTTTGG + Intergenic
920604592 1:207369050-207369072 TGATGGAATGAGGTTTATCTGGG + Intergenic
922309962 1:224379130-224379152 TGATGAACTGAGCTGCATCTTGG - Exonic
923263101 1:232286017-232286039 TGATTGACAGAGTCCCAGCTTGG + Intergenic
1063241153 10:4170454-4170476 GGATGGACAGAGTCTCAACAGGG + Intergenic
1064424800 10:15221183-15221205 AGATGGCCAAAGTGTCATCTAGG + Intronic
1068434273 10:56970530-56970552 AGATGGACAGATTTTTATTTAGG - Intergenic
1070432828 10:76358404-76358426 TTATGCACAGCGTTTCCTCTTGG + Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072479614 10:95798016-95798038 TGATCCACAGCGTTCCATCTTGG - Intronic
1073069625 10:100785003-100785025 TGATGGACAGCCTGTCTTCTGGG - Intronic
1073164145 10:101429224-101429246 TGATGGATAAAATTTCATCCTGG + Intronic
1076121855 10:127942742-127942764 AGAGGGACAGAGTTTCAGTTTGG + Intronic
1078032980 11:7772248-7772270 TGATGGTCATAGTTTGATATAGG + Intergenic
1078173437 11:8948993-8949015 TGAGCGACAGAGTCTTATCTTGG + Intronic
1080702336 11:34654529-34654551 TGATGGAAAGATTTTTATTTGGG + Intronic
1083704892 11:64507284-64507306 TAATGGACAGAGCTTCAGTTTGG - Intergenic
1084120777 11:67067744-67067766 TGATGATCAGAGTTTCTTGTTGG + Intronic
1084874411 11:72120231-72120253 TAATGGATACAGTTTCAGCTGGG + Intronic
1086178159 11:83917558-83917580 TGATGCACATAGTTTCCCCTGGG - Intronic
1087274247 11:96144737-96144759 TGAGAGATAGGGTTTCATCTCGG + Intronic
1088155271 11:106795424-106795446 TGATAGTCAGAGTTTAATATTGG - Intronic
1088773460 11:113058848-113058870 TGACAGACACACTTTCATCTGGG + Intronic
1092701157 12:11232300-11232322 TAATGGAAAGATTTTCATATTGG + Intergenic
1095601265 12:44015911-44015933 TGATGTAGAGAGTTTTATTTTGG + Intronic
1097450767 12:59734259-59734281 TGATGCACAGAGTTTCAGAGGGG + Intronic
1097952462 12:65447102-65447124 TGATGGACAAGGCTTCATCCTGG - Intronic
1098240451 12:68462080-68462102 TTATGGACAGAGCTTTATATCGG - Intergenic
1098426746 12:70372892-70372914 GGATGAACAGAGTTTCATCTTGG + Intronic
1100378234 12:94037586-94037608 TGTTGGCCAGGGTTTCATCAGGG - Intergenic
1103315942 12:120055465-120055487 TGTTGGTCAGAGTACCATCTAGG - Intronic
1105430012 13:20327721-20327743 TGCTGGAGAGAGTGACATCTAGG + Intergenic
1106420546 13:29582116-29582138 TGAGGCACAGAGTTGCATGTGGG + Intronic
1111330629 13:86759515-86759537 TGAAGAAATGAGTTTCATCTGGG + Intergenic
1113453349 13:110428886-110428908 TGATGGACAGAATTTTGTCAAGG - Intronic
1115141728 14:30179504-30179526 TGATGGATAGAGTATGAGCTGGG + Intronic
1116825504 14:49669668-49669690 TTAAGGACAGTGTTTCATCAGGG - Intronic
1117290532 14:54327815-54327837 TTATGGATAGAGTTTCATCTGGG - Intergenic
1117842406 14:59873413-59873435 GGCTGGAAAGAATTTCATCTTGG - Intergenic
1120907278 14:89631417-89631439 TGTTGTACAAAGATTCATCTGGG + Exonic
1121266182 14:92604064-92604086 TGAAGGACATAGTTACATTTTGG - Intronic
1125108386 15:36001444-36001466 TGTTGGAAAGGATTTCATCTTGG + Intergenic
1125610569 15:40966578-40966600 TCATGTAGATAGTTTCATCTTGG + Intergenic
1126353015 15:47764695-47764717 TGAATGACAGAGTTTCATCCGGG - Exonic
1129186353 15:73909487-73909509 TGAAGGACAGAGTTTCATCAGGG + Intergenic
1131316140 15:91339511-91339533 TGATGGCCACAGTTTCCTCCTGG + Intergenic
1134026751 16:10959938-10959960 AGATGGACAGGGTGTCATCTTGG - Intronic
1135713563 16:24740038-24740060 TGTTGAAAAGACTTTCATCTTGG + Intronic
1137788812 16:51157205-51157227 TGATGGAGAGAGGTGCTTCTTGG + Intergenic
1138380506 16:56598575-56598597 TTATGGATAGAGTTTCAGTTTGG - Intergenic
1139941014 16:70605479-70605501 TAATGGGTAGAGTTTCATTTGGG - Intronic
1141399687 16:83736673-83736695 TGATTGACATAGTTTCCGCTAGG - Intronic
1143572281 17:7767033-7767055 TAATGGGCAGAGTTTCCTTTAGG - Intronic
1143831645 17:9656761-9656783 TAATGAATAGAGTTTCATTTTGG + Intronic
1144053688 17:11519517-11519539 TTGGGGACAGAGTTTCAGCTAGG + Intronic
1146108594 17:30065707-30065729 TGGTGAACCGAGTTTCTTCTAGG - Intronic
1146797471 17:35793256-35793278 AGATGGAGAGAATTTCATCTTGG - Intronic
1147860320 17:43517247-43517269 TGGTGGTCAGCATTTCATCTCGG - Exonic
1147962336 17:44175591-44175613 TGATTATCAGAGTTTCATCGAGG + Intronic
1149115492 17:53090077-53090099 TGATGGACATATTTTCATTGCGG - Intergenic
1155532314 18:26779856-26779878 TGATTAACAGAGATTCATTTTGG - Intergenic
1155645039 18:28067326-28067348 TGAGGGGCAGAGTTTCTTTTCGG - Intronic
1156742756 18:40352321-40352343 TGATGGAGAGAGTGACATGTTGG + Intergenic
1157936279 18:51876249-51876271 TGATTCACAGAGTTACATGTTGG + Intergenic
1162221158 19:9177658-9177680 TACGGGACAGAGTTTCAGCTTGG + Intergenic
1165548468 19:36562352-36562374 TAAAGGGCAGAGTCTCATCTAGG - Intronic
1166960198 19:46492520-46492542 TGAGGGACAGAGGCTCACCTGGG - Exonic
925678527 2:6391815-6391837 TGATGGAGAGGTTTTCTTCTGGG - Intergenic
925678699 2:6394191-6394213 TGATAGAAAGAGTTTCTCCTAGG + Intergenic
927431045 2:23026342-23026364 TGATGAACAGATTTTCAATTTGG - Intergenic
927860800 2:26558901-26558923 AGCTGGACAGAGCTTTATCTGGG - Intergenic
929870024 2:45751263-45751285 TTATGTACAGTGTATCATCTCGG - Intronic
931146283 2:59522625-59522647 AAATGGACATAGTTTCTTCTCGG - Intergenic
932479962 2:72033175-72033197 GGATGATCAGAGTTTCATATTGG - Intergenic
939011282 2:136848668-136848690 TGATTGACAGATTTACTTCTAGG - Intronic
944267129 2:197740766-197740788 GGGTGCACAGAGTTTCAACTTGG + Intronic
946217126 2:218193149-218193171 TGAGAGACTGAGTTTCTTCTGGG - Intergenic
946280076 2:218660079-218660101 AGATGGGCAGATTTTCATTTGGG + Exonic
947860258 2:233353442-233353464 AGATGGACAGCATTTCCTCTGGG + Intergenic
948007688 2:234623872-234623894 TGGTGGGTAGAGTTTCATCTGGG + Intergenic
948552851 2:238786228-238786250 TGGGGGACAGAGTCTCATTTGGG - Intergenic
1169550510 20:6697133-6697155 TGAGGCAAAGAGTATCATCTGGG + Intergenic
1169670627 20:8096926-8096948 TAATGGATAGAGTTTCTTTTAGG - Intergenic
1172996603 20:39074965-39074987 TCATGGACTGAGTTTTATTTAGG - Intergenic
1173449159 20:43147188-43147210 AGGAGGACACAGTTTCATCTTGG - Intronic
1175287470 20:57846576-57846598 GGATGGTCAGTGTTTGATCTAGG - Intergenic
1183655253 22:39180682-39180704 TGATGGGCAGAGCTTGGTCTGGG + Intergenic
1183929237 22:41226666-41226688 TGAGGCACAGACTTTCAACTGGG + Exonic
1185211242 22:49571715-49571737 TCCTGGCCTGAGTTTCATCTGGG - Intronic
952165330 3:30742135-30742157 TGATGTCTAGAGTCTCATCTGGG - Intronic
953867274 3:46595296-46595318 TGATGAACAAAGTGTCATCAGGG - Intronic
959401497 3:105907658-105907680 TAATGGACAGAGTTTCCTGGTGG - Intergenic
960688754 3:120321726-120321748 TGTTGGAAAGTGTTTCCTCTGGG - Intergenic
960848360 3:122025597-122025619 TCATAGACACAGTTTCAACTAGG - Intergenic
963372788 3:144422899-144422921 AGATTGAAAGAGTCTCATCTAGG + Intergenic
964257322 3:154790702-154790724 TGAAGGACAGAGTGTCCTCATGG - Intergenic
967893123 3:194377178-194377200 TTAGGGACAGAGTTTCAGTTTGG + Intergenic
967945581 3:194801438-194801460 TGATGGACAGACTCAGATCTGGG + Intergenic
970043422 4:11822384-11822406 TGAGTGAAAGAGTTTCCTCTTGG - Intergenic
972912636 4:43836912-43836934 TGAAGGACAGAGATACAGCTGGG - Intergenic
973739804 4:53908879-53908901 TGCTGGACATAGTTTTCTCTTGG - Intronic
973907895 4:55548734-55548756 AGATGGACATGGTTTGATCTTGG - Intergenic
977141458 4:93377455-93377477 TGAAGGACAGGGTTTCGGCTTGG + Intronic
980607884 4:135116645-135116667 TGAAAGACAGAGTTTCAAATGGG - Intergenic
981767133 4:148263767-148263789 TGATGGACAGGGTTTCCAGTGGG - Intronic
982023372 4:151227772-151227794 TTCTGGACAGAGTTTTAGCTCGG - Intronic
982381685 4:154755719-154755741 AGATGGAGAGTGTTTCATATAGG + Intergenic
985713644 5:1444166-1444188 GGATGGACAGGGCTTCATCGCGG + Intronic
987130900 5:14859132-14859154 TGATGGGCATAGTTTCAATTTGG - Intronic
987715466 5:21563663-21563685 TGAAGGCCAGAGTTTCATGTTGG + Intergenic
995381726 5:111542785-111542807 TAATGGCCAGAATTTCCTCTTGG - Intergenic
995701739 5:114943129-114943151 TAATGGGTAGAGTTTCAGCTGGG + Intergenic
996600574 5:125258350-125258372 TCATGGACAGAGTTTAAGTTGGG + Intergenic
998679910 5:144455508-144455530 TGAGTGACAGAGTTCCATGTGGG + Intronic
999341260 5:150775548-150775570 TGATGGAGAGTGTTTTATCATGG - Intergenic
1000064641 5:157683976-157683998 AGATGGACAGAGTCTAGTCTTGG - Intergenic
1001700524 5:173703442-173703464 TCATGGACAGAGTGTCAACTGGG - Intergenic
1003352870 6:5335420-5335442 TGATGGACTCTTTTTCATCTTGG + Intronic
1005802800 6:29444448-29444470 TGATGCAAAGAGTTTGCTCTAGG - Intronic
1005907403 6:30276218-30276240 TGATAAACAGAGTTTCCTTTGGG - Intergenic
1006627049 6:35404874-35404896 TGAAGGGCTGAGTTTCTTCTTGG + Intronic
1008735436 6:54538105-54538127 TGATGGGCAGAGTTTTATCTTGG - Intergenic
1009490927 6:64289692-64289714 TGATGGTCAGATTATCGTCTAGG - Intronic
1009498109 6:64375493-64375515 TGTTGGACAGAGTTTAACCTAGG + Intronic
1010641633 6:78335890-78335912 TGATCTTCAGAGTTTCTTCTAGG - Intergenic
1011966910 6:93171149-93171171 TTATGAACAGGGTTGCATCTGGG + Intergenic
1013669141 6:112379418-112379440 TGATGAACAGAGTTTTGTCTTGG + Intergenic
1016000951 6:139040647-139040669 TGTTGCACAGAGTGTCATGTAGG + Intronic
1016024257 6:139269756-139269778 GGATGCACACAGTATCATCTTGG + Intronic
1016204952 6:141457969-141457991 TGATGGACAGAGCTTTATTCTGG - Intergenic
1017397309 6:154017392-154017414 TGATGGACAGCGTCTCTTGTAGG + Intronic
1020835056 7:13138843-13138865 TGATGTCCAGAGTTTCTACTGGG + Intergenic
1021739873 7:23676156-23676178 TGACAGACAGCCTTTCATCTAGG - Intergenic
1021937212 7:25642896-25642918 TGATGCCAAGAGTTTTATCTGGG + Intergenic
1024213244 7:47225501-47225523 TTATGAGCAGAGTTTCATCTTGG + Intergenic
1025012500 7:55408692-55408714 TGAGGGACATAGTTGCATATTGG + Intronic
1030645207 7:112053475-112053497 GAATGGACAGAGTTACTTCTTGG - Intronic
1034733787 7:153411120-153411142 TGATGGAGAGAGTTTCAGTTTGG + Intergenic
1034852678 7:154510164-154510186 TGTTGCACAGTCTTTCATCTGGG - Intronic
1038269751 8:26065585-26065607 TCATGAACAGAGTGTCCTCTGGG + Intergenic
1049435091 8:142582838-142582860 TACTGGACAGAGTTTCCTCAGGG - Intergenic
1051497575 9:17741903-17741925 TGATGGAGAAGGTGTCATCTGGG + Intronic
1051860041 9:21614348-21614370 TCCTGGACAAAGTGTCATCTTGG + Intergenic
1052239668 9:26255912-26255934 TGAAGGACAGACTTGTATCTGGG - Intergenic
1053513680 9:38711114-38711136 TGATGCGCAGAGAATCATCTTGG - Intergenic
1056293601 9:85169281-85169303 TCAGAGACAGAGTTACATCTTGG - Intergenic
1057068705 9:92077482-92077504 TGATGGGCACAGTTTTATCCTGG - Intronic
1057258827 9:93572772-93572794 TAAGGGACAGAGTTTCCACTGGG + Intergenic
1058335060 9:103817293-103817315 TGATGGTCAGGTTTACATCTAGG + Intergenic
1059291351 9:113227042-113227064 TTATGGTTAGAGTTTCATCATGG + Intronic
1060002013 9:119967389-119967411 TGATGGCTAGAGTTTCTCCTTGG + Intergenic
1060132786 9:121120963-121120985 TGATTCACAAAGTTTCATATTGG + Intronic
1186087693 X:6008806-6008828 TAATGGATAGAGTTTCAGTTTGG - Intronic
1188364300 X:29295737-29295759 TGATGGACAGAGTTTCATCTTGG - Intronic
1192263891 X:69525378-69525400 CTATGGACAGAGACTCATCTTGG + Intronic
1193602097 X:83520046-83520068 TGATGGACATAAATACATCTGGG - Intergenic
1194874589 X:99171205-99171227 TGATGGTCACAGGTTCAGCTTGG - Intergenic
1195748456 X:108141603-108141625 TGAAGGCCAGAGTGTCATCCTGG - Intronic
1197303969 X:124817937-124817959 TGATGCTTGGAGTTTCATCTGGG + Intronic
1201891295 Y:18946561-18946583 TGATGGACACAGCTTTATTTTGG + Intergenic