ID: 1188366562

View in Genome Browser
Species Human (GRCh38)
Location X:29322926-29322948
Sequence TATTGGCTAAGGAGAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188366562 Original CRISPR TATTGGCTAAGGAGAGGGGA AGG (reversed) Intronic
900191137 1:1352796-1352818 TACTGGCTGAGGACAGGGGAGGG - Exonic
902527277 1:17067430-17067452 TACTGGCTAGGTAGATGGGAAGG + Exonic
903174091 1:21570369-21570391 TATTGGGTAAGTGGAGGGGGTGG + Exonic
904603351 1:31685573-31685595 GCGGGGCTAAGGAGAGGGGAGGG - Intronic
904983413 1:34525265-34525287 AATTGGGTAATGAGAGGAGATGG - Intergenic
905563297 1:38943912-38943934 CATTGGCTAGGGAGTGGGGGTGG + Intergenic
905942505 1:41875181-41875203 TAAAGGCTGAGGACAGGGGATGG - Intronic
907871653 1:58449122-58449144 AATTGGCCAAGCACAGGGGAAGG + Intronic
908075725 1:60515546-60515568 TATTGTTAAAGGAGAGTGGAAGG - Intergenic
909986926 1:82172709-82172731 TATTGGCACAGGACAGGGGGCGG - Intergenic
910387151 1:86697350-86697372 TATGGGGTAAGGAGCGGGAAGGG - Intergenic
910867652 1:91802872-91802894 CATTGGGTGAGGAGAGGGAAGGG - Intronic
912598494 1:110903371-110903393 TTCTGCTTAAGGAGAGGGGAGGG + Intergenic
912602089 1:110946321-110946343 TATGGCATAAGGAGAGGTGATGG + Intergenic
915895621 1:159808988-159809010 TCGGGGCTCAGGAGAGGGGATGG - Exonic
917452815 1:175161220-175161242 TTTAGGCTTAGGAAAGGGGAAGG + Intronic
918344064 1:183591017-183591039 TATGGGCTCAGAATAGGGGAGGG - Intronic
921258953 1:213368504-213368526 TATTGACTTAGGGGAGGAGATGG + Intergenic
923223059 1:231913865-231913887 AAATGGCTGAGGAGAGGAGATGG - Intronic
923781591 1:237030151-237030173 TATGGGATAATGAGAGGGGTGGG + Intergenic
1064898651 10:20269483-20269505 TTCTGGCTAAGCAGAGAGGAAGG + Intronic
1065589667 10:27251971-27251993 TCCTCGCTAAGGGGAGGGGAGGG - Intergenic
1067342604 10:45417841-45417863 TCTTGGCCAAGAAGTGGGGAGGG - Intronic
1068170464 10:53386913-53386935 TATTTGTTAAGGAGATTGGACGG + Intergenic
1069723448 10:70563545-70563567 AAGTGGCTCAGGAGAGGGGTTGG - Intronic
1069818664 10:71214251-71214273 CTTTGGCTATGGAGGGGGGAAGG - Intronic
1069861651 10:71475419-71475441 TCTTGGCTCCCGAGAGGGGAGGG + Intronic
1070319162 10:75342111-75342133 CCTTGGCACAGGAGAGGGGAAGG - Intergenic
1071258618 10:83898146-83898168 TATTTGCTAAGGAGACTAGAAGG - Intergenic
1073023693 10:100469955-100469977 TAAAGGCTAAGGGGAGGGTATGG - Intronic
1075423307 10:122322369-122322391 TATTGGGTCAGGAGTGGGGGTGG + Intronic
1076394451 10:130128856-130128878 CTTGGGCTAAGGAGAAGGGACGG + Intergenic
1076870160 10:133189052-133189074 AATTGGCTTTGGAGTGGGGAGGG + Intronic
1077281305 11:1747425-1747447 TGATGGCTCAGGAGAGGGAAGGG + Intronic
1077572672 11:3353362-3353384 TATAGGCAAAGGAGAAGGTACGG + Intronic
1077998683 11:7475664-7475686 TATTGGGTGAGGAGGGGAGAAGG + Intergenic
1078634367 11:13035120-13035142 ATTTGGAAAAGGAGAGGGGATGG + Intergenic
1080038827 11:27737620-27737642 TACTGGTTAAGGAAAGAGGAGGG + Intergenic
1081272877 11:41108193-41108215 TAAAGGCTAAGGGTAGGGGAAGG - Intronic
1081468149 11:43344359-43344381 TATTGCCTTAGGAAAGGGAAGGG - Intronic
1084412374 11:69012331-69012353 AAGCGGCTAAGGAGAGGGGCTGG - Intronic
1086158141 11:83691357-83691379 TTATGGCTAAGGACAGGGTAGGG + Intronic
1086288679 11:85279333-85279355 TAAGTGATAAGGAGAGGGGAGGG + Intronic
1086839217 11:91664651-91664673 TATGGGCTGAGCAGGGGGGAAGG + Intergenic
1088354135 11:108923851-108923873 TATTAACTGAGCAGAGGGGAGGG + Intronic
1089401222 11:118165893-118165915 TTTTGGCTACAGAGAGGGAAGGG - Exonic
1090250502 11:125247560-125247582 AAAAGGCTAACGAGAGGGGAAGG - Intronic
1090331860 11:125938917-125938939 AATTAGGTAAGGAGAGGGTAAGG - Intergenic
1091931209 12:4396830-4396852 TAGTGGCTGAGAAGAGGGCATGG + Intergenic
1092659168 12:10721128-10721150 GCTTGGCAAAGGAAAGGGGATGG + Intronic
1093930665 12:24952083-24952105 TATCGGCTCAGAATAGGGGAGGG + Intergenic
1094040589 12:26117085-26117107 TAGTTGCTAAGAATAGGGGAGGG - Intergenic
1095496947 12:42795101-42795123 TATTGGCTAAAGGGAAGGGCAGG + Intergenic
1095716289 12:45350275-45350297 CATTGTCCAAGGAGAGGGGTGGG + Intronic
1096260701 12:50088703-50088725 TAATGTCTAAGGAGATGGGGAGG + Intronic
1099439504 12:82684259-82684281 TATTAACCAAGGAGAGAGGAAGG - Intergenic
1100283141 12:93137879-93137901 TGTGGCCTAATGAGAGGGGATGG + Intergenic
1100880672 12:99013045-99013067 TATTGGCTCAGGAAAGCTGAGGG + Intronic
1102955879 12:117058773-117058795 GCTTGGCTGGGGAGAGGGGAGGG + Intronic
1103152850 12:118656383-118656405 ATTTTGCTAAGCAGAGGGGAAGG + Intergenic
1103241339 12:119415924-119415946 GATTAGATAAGGGGAGGGGAGGG + Intronic
1104578539 12:129990915-129990937 TGCTGGCTGAGGAGAGGGTATGG + Intergenic
1105639708 13:22249782-22249804 TATGGGCACAGGAAAGGGGATGG - Intergenic
1105980054 13:25510315-25510337 TATTGGCTCAGAAAAGGAGAAGG + Intronic
1106252480 13:27993198-27993220 TATAGGCTGAGGTGAGAGGATGG + Intergenic
1106464363 13:29999639-29999661 TATTGGGAAAGGAGGAGGGAAGG - Intergenic
1107314248 13:39114144-39114166 TATTGGGGGAGGGGAGGGGAGGG - Intergenic
1107873163 13:44765223-44765245 CATTGGGTAAGGATAGAGGAAGG - Intergenic
1108746905 13:53405427-53405449 TATGGGCTCAGAATAGGGGAGGG - Intergenic
1109627819 13:65000102-65000124 TGTTGGCTAGGGTGAGGGTAGGG - Intergenic
1110639593 13:77806894-77806916 TCTTGGCTAAGGAGCAGAGAGGG + Intergenic
1112186061 13:97128753-97128775 CATTGACCAAGGAGAAGGGAGGG - Intergenic
1112732327 13:102378264-102378286 TATTGGTAATGGAGAGGTGATGG + Intronic
1114560887 14:23589638-23589660 AATGGGCTAAGGAGGGAGGAGGG - Intergenic
1115745254 14:36429859-36429881 TACAGGCTGAGGTGAGGGGATGG - Intergenic
1116243602 14:42379397-42379419 TGGTCGCTCAGGAGAGGGGAGGG - Intergenic
1119082328 14:71707070-71707092 CATTGGCTAAGGGGAGGGGCAGG - Intronic
1119122010 14:72088485-72088507 GATGGGCTGGGGAGAGGGGAAGG + Intronic
1119421926 14:74512296-74512318 CATTGGCCAAGGAAAGAGGAGGG + Intronic
1119810572 14:77514584-77514606 TATTGGCTCAGGGGAGCGGCAGG - Intronic
1125347794 15:38736601-38736623 TATGAGGTTAGGAGAGGGGATGG + Intergenic
1126512198 15:49490449-49490471 TAGTGGCTAAGGAGTGGCAATGG + Intronic
1126676561 15:51163767-51163789 GACTGGATAAGGAGAGGGCAAGG + Intergenic
1127959796 15:63882314-63882336 TACTGGGTAAGGAGAAAGGAGGG + Intergenic
1130684744 15:86026974-86026996 AATTTGCTTTGGAGAGGGGAGGG + Intergenic
1131224294 15:90611228-90611250 GATTTGCTAAGTAGAAGGGAAGG - Intronic
1132180028 15:99745274-99745296 CATTGCCAAGGGAGAGGGGAAGG - Intergenic
1132291856 15:100709412-100709434 TATTGGAGAAGGAGTGAGGAAGG + Intergenic
1133084823 16:3353877-3353899 TCCTGGCCAAGGAAAGGGGATGG + Intergenic
1134444539 16:14320842-14320864 GACTGGCAAAGGAGAGGAGAGGG + Intergenic
1135277781 16:21128307-21128329 TGGAGGCTAAGGAGAGAGGATGG + Intronic
1138660337 16:58512763-58512785 TATGGGGTAAGGTGAGTGGATGG - Exonic
1140243247 16:73224011-73224033 TATAGGCTAGGGAGGAGGGAGGG + Intergenic
1141537645 16:84693674-84693696 TATGGGCAAAGGAGTGAGGAGGG + Intergenic
1142529247 17:567880-567902 CATTGTCGAAGGGGAGGGGAGGG + Intronic
1143331592 17:6140351-6140373 TATTGCATATGCAGAGGGGAGGG - Intergenic
1143713096 17:8746879-8746901 TATATCCTCAGGAGAGGGGAGGG - Intergenic
1143714654 17:8758218-8758240 GATTGACTGAGGAGAGGGAAGGG - Intronic
1144085777 17:11807354-11807376 TTTTGGGCAAGAAGAGGGGACGG - Intronic
1145970733 17:28955126-28955148 TATGGGATAAGGGGAGGGGGTGG - Exonic
1146581822 17:34045207-34045229 TGTTGGTAAAGAAGAGGGGATGG - Intronic
1146630224 17:34464244-34464266 AATTGAGTTAGGAGAGGGGAGGG + Intergenic
1146656859 17:34639602-34639624 GATTGGCTCAGGGGAGGGAAGGG + Intergenic
1147131269 17:38410743-38410765 GACTGGCTAACTAGAGGGGAGGG - Intergenic
1147232087 17:39027084-39027106 TCCTCGCTAAGGGGAGGGGAGGG + Intergenic
1147423527 17:40334341-40334363 TGTTTACTAGGGAGAGGGGAGGG - Intronic
1147473331 17:40685178-40685200 TATTGCCAAATGAGAGTGGAAGG - Intergenic
1148155221 17:45420574-45420596 TATTGGCAAAATAGAGGGGCTGG + Intronic
1149009316 17:51838686-51838708 TATTTGCTATGTAAAGGGGAAGG - Intronic
1149394892 17:56230343-56230365 TTTTGGGGAAGGAGAGAGGAAGG + Intronic
1150571969 17:66394391-66394413 TATTGGCTTAGCAGAGGAGCTGG + Intronic
1150946700 17:69754431-69754453 TATTGGATCAGGAGAAGGGAGGG - Intergenic
1151848918 17:76678194-76678216 GCTTGGCAAAGGAGCGGGGAGGG + Intronic
1152303284 17:79507597-79507619 TCTTGTCTGAGGAGAGGGGAGGG - Intronic
1152933362 17:83121795-83121817 TTTTGTCTGAGGAGAGGGGATGG + Intergenic
1153550364 18:6256557-6256579 TAATAGCTATGAAGAGGGGAAGG + Intronic
1153843773 18:9030496-9030518 TATGGGCACAGGATAGGGGATGG + Intergenic
1155240005 18:23855948-23855970 CATGGGCTAAGGGGAGGAGACGG - Intronic
1155875210 18:31077963-31077985 TATATGTTTAGGAGAGGGGAAGG + Intronic
1157280211 18:46341978-46342000 TATTGGGAGAGGAGAGGGCAGGG + Intronic
1157757521 18:50231924-50231946 TGTTGGCCCAGGAGAGGGGGTGG - Intronic
1158521390 18:58174234-58174256 TATGGGCTCAGAATAGGGGAGGG + Intronic
1158720329 18:59918775-59918797 TACTGGCTGAGGAGTGAGGAGGG + Intergenic
1159226645 18:65546417-65546439 TATTGTCTAAGGGAAGAGGACGG - Intergenic
1160020013 18:75173031-75173053 TCTGGGCGAAGGAGAAGGGAAGG + Intergenic
1161680085 19:5675765-5675787 TATAGGCTCAGAATAGGGGAGGG - Intronic
1163197578 19:15733889-15733911 CAGTGGCCCAGGAGAGGGGATGG + Intergenic
1163551451 19:17968062-17968084 TATTGGGGGAGGGGAGGGGAAGG + Intronic
1164236596 19:23342563-23342585 GATTAGCTCAAGAGAGGGGAAGG + Intronic
1164402527 19:27911620-27911642 TATGGGGTCAGGAGAGGGGTGGG + Intergenic
1164702695 19:30296939-30296961 TGTTGGCAGTGGAGAGGGGAAGG + Intronic
1164875337 19:31681321-31681343 TCTTGGCTCAGGAAAGGGGTAGG - Intergenic
1166959366 19:46488507-46488529 TATTGGCTCTGTAGAGAGGAGGG - Intronic
1167080240 19:47272963-47272985 CGTTGGCGAAGGAAAGGGGAGGG + Intergenic
1167384366 19:49155450-49155472 TATTGGCTGGGGAATGGGGAGGG - Intergenic
925033896 2:671898-671920 TTATGGCTAAAGAGAGGGCAGGG + Intronic
926867498 2:17375884-17375906 CATTGGGGAAGGGGAGGGGAGGG - Intergenic
927989153 2:27435217-27435239 GATTGGCTCTGGTGAGGGGAGGG + Exonic
928909387 2:36403513-36403535 GATTGGCTCAGCAGAAGGGAAGG + Intronic
930149765 2:48046706-48046728 TATTAGATAAGGAGATGAGAAGG - Intergenic
930311916 2:49752849-49752871 TATTAGCTAAGAATAGAGGAAGG + Intergenic
932907216 2:75767171-75767193 TATTGGCTCTGGAGAAGAGAAGG + Intergenic
933154365 2:78955947-78955969 TATTGGGTGGGGAGAGGGGAGGG + Intergenic
934113244 2:88761689-88761711 GATTGGATATGGAGTGGGGAGGG - Intergenic
935783355 2:106527466-106527488 TATTGGCTCGGAATAGGGGAGGG - Intergenic
938470354 2:131554043-131554065 TATTGGCTAAGGAGTTGTTATGG - Intergenic
939677318 2:145088469-145088491 TCATGGTTCAGGAGAGGGGAAGG + Intergenic
942635084 2:177994965-177994987 TATTGTCTTAGGAAAGGGAAAGG + Intronic
944279279 2:197876278-197876300 TATTGGCCCAGAAGAGGGGCTGG + Intronic
944606847 2:201359456-201359478 TATTGTGTAAGGAGAGAAGAGGG + Intergenic
944843660 2:203646985-203647007 TATTGGCACAGGATGGGGGAGGG + Intergenic
945874529 2:215264401-215264423 TATTGGCTCAAAAGAGGAGATGG + Intergenic
946978578 2:225180904-225180926 TGGTGCCTAAGGAGAGGTGATGG - Intergenic
1170591381 20:17774375-17774397 TATTGCCTAAGAATGGGGGAAGG + Intergenic
1171782745 20:29436142-29436164 TATGGGGTAGCGAGAGGGGAAGG + Intergenic
1173005575 20:39137367-39137389 TCATGACTAAGGAGAGGAGATGG + Intergenic
1177123874 21:17171625-17171647 AATTGGCTAAGAATAAGGGAAGG - Intergenic
1178480854 21:32978365-32978387 CATTTGCTCAGGGGAGGGGAGGG - Intergenic
1179073293 21:38093490-38093512 TATAGGCAAAGGAATGGGGAAGG + Intronic
1179350975 21:40610585-40610607 TATTGGGGGAGGGGAGGGGATGG - Intronic
1179992960 21:44958201-44958223 CAGTGGCTATGGGGAGGGGAAGG - Intronic
1181695394 22:24590424-24590446 CTTTGGATAAGTAGAGGGGAGGG + Intronic
1182132419 22:27865741-27865763 TATTGGGTATGGGCAGGGGAGGG + Intronic
1183709507 22:39494612-39494634 TACTGGCTGAGGAAAAGGGAAGG + Intergenic
1183980916 22:41539634-41539656 CGTTGGCTAGGGTGAGGGGATGG - Intronic
1184204195 22:42990769-42990791 TATTGGCAACGGGGAGGGGTCGG - Intronic
1184672107 22:46019327-46019349 TATTTGCAAAGGATATGGGAAGG - Intergenic
950670131 3:14521019-14521041 TGGTGGCTAAGGAGGGGAGAAGG - Intronic
950880740 3:16321071-16321093 TATAGGGGAAGGAGAGGGGAGGG + Intronic
953557167 3:43955550-43955572 TACTGGACACGGAGAGGGGAAGG - Intergenic
954440509 3:50519305-50519327 TATTGGAACAGGGGAGGGGAGGG - Intergenic
955552143 3:60096342-60096364 TATAGGCTCAGAATAGGGGAGGG + Intronic
955565753 3:60243432-60243454 TACTGGCCATGGAGAGGCGATGG + Intronic
956758504 3:72414806-72414828 GGTTGCCTAAGGAGAGTGGACGG + Intronic
958843633 3:99239080-99239102 TAATGGCTAAGGAGAGTGGGGGG - Intergenic
959089956 3:101891868-101891890 TATATGCTAAGGAGAGGGAATGG + Intergenic
959158551 3:102696103-102696125 TAATGGCTAAGGAGAACGAATGG + Intergenic
960275170 3:115720912-115720934 GACAGGCTCAGGAGAGGGGAGGG - Exonic
961202270 3:125054965-125054987 CATTGGGAAAGGAAAGGGGAGGG + Intronic
961878059 3:130039313-130039335 TCATGGCTCAGCAGAGGGGAAGG - Intergenic
962914855 3:139891801-139891823 TTTGGGCCAAGGAGAGGTGAAGG + Intergenic
965147989 3:164931040-164931062 TGGTTGCTAAGGACAGGGGATGG + Intergenic
966288369 3:178324765-178324787 TATTGGCTGAGGAGAATGAACGG + Intergenic
968295729 3:197575319-197575341 TATGGGCTCAGAATAGGGGAGGG - Intergenic
968990276 4:3906349-3906371 TCATGGCCCAGGAGAGGGGAAGG - Intergenic
969735555 4:8987366-8987388 TCATGGCTCAGAAGAGGGGAAGG + Intergenic
970535359 4:17024719-17024741 TATAGGCTATGGTGAGGAGAGGG - Intergenic
970752248 4:19377941-19377963 TGCTGGCTAAGGATAGGGAAAGG - Intergenic
971483345 4:27133966-27133988 TATGGGCTTAGAATAGGGGAGGG + Intergenic
974440603 4:61911455-61911477 GATGGGGTAAGGAGATGGGAGGG + Intronic
975577597 4:75878122-75878144 TGTTGGGGAAGGACAGGGGAGGG + Intronic
975593069 4:76019272-76019294 TATTGGCTAGGGAGAGCTAATGG + Intronic
976449849 4:85175805-85175827 TAGTGGTTAAGGAGACGGTAGGG - Intergenic
977145206 4:93431075-93431097 TATTGGCTAAAGTGAGGAGAAGG + Intronic
982244748 4:153340435-153340457 TTTTGCCTAAGGAGACTGGAAGG + Intergenic
983457647 4:167984937-167984959 TTTTGGGTAAAGAGAAGGGATGG - Intergenic
984432396 4:179665386-179665408 TATTGGCTAAGGACAGGTAGGGG - Intergenic
986153380 5:5148807-5148829 TATTGTCTAATGAGAGAGGCAGG + Intronic
986857455 5:11887324-11887346 TTTTGGCAAAGGTGAGGGGAAGG - Intronic
987188565 5:15450403-15450425 TATAAGCTAAAGATAGGGGAGGG - Intergenic
987346996 5:16987841-16987863 TTATGGCTAAGGAGGGGGGAAGG - Intergenic
988589970 5:32540367-32540389 TGTTGGCTGAGGAGATGGAAGGG - Intronic
989440036 5:41459897-41459919 ATTGGGCTAAGGAGAGGGAAAGG + Intronic
990111463 5:52330708-52330730 TGGTTGCTAGGGAGAGGGGAAGG - Intergenic
990699256 5:58458523-58458545 CATTGACTAAGAAGAGGAGAAGG + Exonic
990946192 5:61252336-61252358 TGTTGGCTATGAAGAGGGCAAGG + Intergenic
991348572 5:65696164-65696186 GATAGGCAGAGGAGAGGGGAAGG - Intronic
992111832 5:73501663-73501685 TATTGGCTAAAGAAGAGGGATGG + Intronic
992362765 5:76058159-76058181 AATTGGCTATGGTGAGAGGAGGG + Intergenic
993120013 5:83763602-83763624 TATTGGCTAATTAGTAGGGAAGG + Intergenic
994272841 5:97802352-97802374 TATGGGCTCAGAATAGGGGAAGG + Intergenic
995676461 5:114668058-114668080 TATTGTCTAAGGAGATGTGTTGG - Intergenic
998121317 5:139580379-139580401 GAATGGCTGAGGAGAGTGGATGG + Intronic
998652677 5:144139170-144139192 TAAGGGATAGGGAGAGGGGAAGG + Intergenic
999401062 5:151264550-151264572 TATTGGCTAAGGAAAAAGGCAGG + Intronic
999446672 5:151645918-151645940 CTTTGACTAAGGAGAGAGGAAGG + Intergenic
999616485 5:153430242-153430264 TTTTGGTTTAGGAGTGGGGAAGG + Intergenic
1000454987 5:161437811-161437833 CATTGGATAAGGGGAGGGAAGGG + Intronic
1003633939 6:7814078-7814100 TATTGGCTATGAAGATGGAAAGG - Intronic
1004474501 6:15958906-15958928 TTTGGGCTAAGGGGTGGGGATGG + Intergenic
1004755407 6:18605329-18605351 CATTGGCTGAGGAGGTGGGATGG - Intergenic
1005370200 6:25124184-25124206 TCTGGCCTAAGGAGAGGGGCCGG + Intergenic
1005994055 6:30921136-30921158 TATTGGGTAAGGGTAGGGTAAGG + Exonic
1006349759 6:33512502-33512524 TATGGGCTAGGGGGAGGGCAGGG + Intergenic
1006510697 6:34519545-34519567 TATTAGCTGAGGAGGGGAGAAGG + Intronic
1006617810 6:35341777-35341799 TGTGGCCGAAGGAGAGGGGAGGG + Intergenic
1007344048 6:41214926-41214948 GATTGGCTATGGAGAGGGCAGGG + Intergenic
1007826620 6:44605690-44605712 GAGTTGCTAATGAGAGGGGAGGG + Intergenic
1011381221 6:86744123-86744145 ACCTGGCAAAGGAGAGGGGAGGG + Intergenic
1012668531 6:102010683-102010705 TATGGGTTAAGAAGAAGGGAGGG - Intronic
1013461107 6:110376371-110376393 TAGTGGCAGTGGAGAGGGGAAGG + Intergenic
1013540098 6:111099642-111099664 TATTTTGTATGGAGAGGGGAGGG + Intronic
1014142157 6:117956217-117956239 TGTTGGCTTAGGAGTGGGGCAGG + Intronic
1014153417 6:118084928-118084950 TATTGGCTGAGGGCAGGGAAAGG - Intronic
1014552620 6:122806717-122806739 TAATGGCTCATGAGAGGGAATGG - Intronic
1016132209 6:140488261-140488283 TATGGGCTCAGAATAGGGGAGGG + Intergenic
1016509354 6:144823798-144823820 TATTGGCTAAAGAGATAGGTTGG + Intronic
1017324458 6:153130421-153130443 CTTTGACTAAGGGGAGGGGAAGG + Intronic
1017425723 6:154319162-154319184 TTTTGGGTAAGGGGAGGGAAGGG - Intronic
1021417773 7:20407975-20407997 TATTGTGCAAGGAGAGGGAAAGG + Intronic
1021925950 7:25533744-25533766 TATGGGCTGAGAATAGGGGAGGG + Intergenic
1021957683 7:25842474-25842496 TGTCTGCTAAGGAGAGGGGGTGG + Intergenic
1022497322 7:30861240-30861262 TGTCGTCTTAGGAGAGGGGAAGG - Intronic
1023111114 7:36811617-36811639 TGTGGGCAAAGGAGAGGGGCTGG + Intergenic
1024586089 7:50843296-50843318 TGTGGGCTCAGGAGAGGGGTTGG - Intergenic
1025839608 7:65133350-65133372 TATTTGTTAAGGCCAGGGGATGG + Intergenic
1025883459 7:65562615-65562637 TATTTGTTAAGGCCAGGGGATGG - Intergenic
1025889986 7:65639991-65640013 TATTTGTTAAGGCCAGGGGATGG + Intergenic
1026252049 7:68679621-68679643 TTTTGGCTAAGGAGTGAGCAGGG - Intergenic
1030211467 7:107000427-107000449 TGGTCGTTAAGGAGAGGGGAAGG + Intergenic
1030566048 7:111157581-111157603 TATTGGAGAAGGAGTGGGGATGG + Intronic
1031329787 7:120450450-120450472 GAGTGGAAAAGGAGAGGGGATGG + Intronic
1031852490 7:126881993-126882015 TATTTGTTAAGGCCAGGGGATGG - Intronic
1032184532 7:129712764-129712786 TATTGGGTGAGGAAAGGTGAAGG + Intronic
1032430211 7:131854813-131854835 TATGGGCTCAGAATAGGGGAGGG + Intergenic
1034576702 7:152006063-152006085 AACTGGCAAAGGAGATGGGAAGG + Intronic
1034944606 7:155253814-155253836 TTTTCGGTAAGCAGAGGGGAGGG - Intergenic
1035347624 7:158214745-158214767 GATTGGTTAGGGAGAGGGGTGGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1036599571 8:10247953-10247975 TTTTGACCAAGGAGAGGGGTGGG + Intronic
1036629174 8:10498443-10498465 GATTGGCTAAATAAAGGGGAGGG + Intergenic
1038659380 8:29483500-29483522 TTTTGGCTGAGGAGGGAGGATGG + Intergenic
1041553340 8:59124665-59124687 TATTGCCAAAGGAGAGGTGTCGG + Intergenic
1042523020 8:69734248-69734270 TAGTGGCAAAGGAGGGTGGAGGG - Intronic
1042604898 8:70535518-70535540 TATAGGCTTAGAATAGGGGAGGG - Intergenic
1043266058 8:78268408-78268430 TATTGGCTCAGGTCATGGGAAGG + Intergenic
1044191618 8:89325881-89325903 AAATGGGTAAGGACAGGGGAAGG + Intergenic
1044439127 8:92202325-92202347 TATAGCCTAAGGGGATGGGAAGG + Intergenic
1046531899 8:115456989-115457011 TATGAGCTAAGGACAGGGCAGGG + Intronic
1046611354 8:116429189-116429211 TTTTAGCTAATGAAAGGGGAAGG - Intergenic
1046625029 8:116567677-116567699 ACTTGGGTAGGGAGAGGGGAGGG - Intergenic
1047551567 8:125878487-125878509 TAGTGGAGAGGGAGAGGGGAGGG + Intergenic
1048301674 8:133255853-133255875 TGTTGGCCAAGGAGAGGGGGAGG - Intronic
1048986094 8:139735875-139735897 TACTTTCTAAGAAGAGGGGAAGG + Intronic
1049610067 8:143550796-143550818 TATGGGCTCAGAACAGGGGAGGG - Intergenic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1050710793 9:8460693-8460715 TATTAGCAAAACAGAGGGGAGGG + Intronic
1051244540 9:15096702-15096724 GATTGGCTAGGGGAAGGGGAAGG - Intergenic
1051769823 9:20565307-20565329 TTTGGGCTAAGGAGTTGGGAGGG + Intronic
1052017189 9:23482695-23482717 TATTGGCTAGGTAGATGGGTGGG + Intergenic
1052935248 9:34087542-34087564 TACTGGCTAAGCAGATGTGAGGG + Exonic
1053405424 9:37871187-37871209 TATTGGGGAAGGTGGGGGGAGGG + Intronic
1053523479 9:38805568-38805590 TATTGACTAAGGAGAAGTAAGGG + Intergenic
1054195708 9:62029987-62030009 TATTGACTAAGGAGAAGTAAGGG + Intergenic
1054642700 9:67558702-67558724 TATTGACTAAGGAGAAGTAAGGG - Intergenic
1055939534 9:81636531-81636553 GAGAGGCTAAGCAGAGGGGAAGG + Intronic
1056895774 9:90548073-90548095 TATTGTCTAAGGAGTGGGAGAGG + Intergenic
1057759368 9:97860239-97860261 TAGGGGCTAAGGAGTGGGGATGG + Intergenic
1059560387 9:115328920-115328942 TATGGGGTGAGGAGAGGGGGAGG + Intronic
1061448495 9:130655752-130655774 TCTGAGCTATGGAGAGGGGAAGG + Intergenic
1185511569 X:668097-668119 GAGTGGGAAAGGAGAGGGGAGGG - Intergenic
1185948197 X:4401481-4401503 TATGGGCTCAGAATAGGGGAGGG - Intergenic
1186820712 X:13285160-13285182 TATAGGCACAGGATAGGGGAGGG - Intergenic
1186837800 X:13455279-13455301 TATTGGCTGAGTAGAGGCCAAGG + Intergenic
1186863360 X:13694882-13694904 TAGTTGCTAAGCTGAGGGGAGGG + Intronic
1186925883 X:14332972-14332994 ATTTGGCTAAGGAGAAGGGATGG - Intergenic
1187019807 X:15369255-15369277 TTTTGGTGAAGGAGAGGGGCTGG - Intronic
1187237609 X:17482898-17482920 TAGAGGCTATGGGGAGGGGATGG + Intronic
1187266084 X:17735511-17735533 TTTTGGCTAAGTAGAGGACATGG + Exonic
1187626853 X:21124124-21124146 TCTTGGCTGGAGAGAGGGGATGG - Intergenic
1188366562 X:29322926-29322948 TATTGGCTAAGGAGAGGGGAAGG - Intronic
1189641369 X:43075548-43075570 TCTTGGGTAAGAGGAGGGGATGG + Intergenic
1190066988 X:47248192-47248214 TCTGGGCTGAGGAGAGGGAAGGG - Exonic
1190279605 X:48920908-48920930 TGGTGGCTCAGGACAGGGGAGGG + Intergenic
1190608384 X:52168812-52168834 TCATGTCTCAGGAGAGGGGAAGG + Intergenic
1191712012 X:64159936-64159958 TAGTGGCTAAGGAGGGAGGGAGG + Intergenic
1193158127 X:78196271-78196293 TATTGGATAGGGGGATGGGAAGG + Intergenic
1193534965 X:82703374-82703396 TATTTGGCAAGGAGAGGGGGAGG - Intergenic
1195618459 X:106930916-106930938 TTTCGGCTAAGGGGAGGGGAGGG + Intronic
1195691611 X:107630412-107630434 TATTGGGAGAGGAGAGGGGGAGG + Intronic
1195719444 X:107852463-107852485 TCTTGGCAAAGAAAAGGGGAAGG - Intronic
1196106253 X:111899092-111899114 TAGTGGGTGAGGAGAGGGCAAGG - Intronic
1196477389 X:116104514-116104536 TATTGCCTTAGGAAAGGGAAGGG + Intergenic
1197261842 X:124328171-124328193 TCATGGCTAAGAAGAGAGGATGG - Intronic
1197892344 X:131279565-131279587 TATAGGCTGCGGAGTGGGGAGGG - Intronic
1200036651 X:153335272-153335294 CATTGACTAAGGAGACTGGAGGG - Intronic
1200136786 X:153879132-153879154 TAAGGGCAAAGGAGCGGGGAGGG + Intronic
1200246853 X:154531069-154531091 TATTTAGGAAGGAGAGGGGATGG - Intergenic
1201735559 Y:17256860-17256882 TATGGGCTCAGAATAGGGGAGGG - Intergenic