ID: 1188369946

View in Genome Browser
Species Human (GRCh38)
Location X:29357713-29357735
Sequence CCTCCGTGTCATAAGGTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188369946 Original CRISPR CCTCCGTGTCATAAGGTTCT TGG Intronic
900564048 1:3323749-3323771 CCTCTTTGTTATGAGGTTCTGGG - Intronic
903788898 1:25879388-25879410 CCTCTCTGTCATAAGGGTCATGG - Intergenic
907714626 1:56915650-56915672 CATTTATGTCATAAGGTTCTTGG - Intronic
909067449 1:70952493-70952515 CTTCAGTGACATAAGGTTATGGG - Exonic
912833754 1:112977291-112977313 CCTCGGTCTCATAAAGTGCTGGG - Intergenic
916375548 1:164149644-164149666 CCACCATGTCCTAAGGTTCATGG + Intergenic
920244698 1:204578853-204578875 CCACCCTGACATAAGTTTCTTGG - Intergenic
920922725 1:210311558-210311580 CCTCCGTGTCAAAGGCTTCTCGG - Intergenic
1062814176 10:487522-487544 GTTCCGTGTCATTTGGTTCTTGG - Intronic
1063313272 10:4976668-4976690 CCTCTGTGTTCTAAGGTTCTAGG + Intronic
1065596893 10:27322018-27322040 CCTCGGTCTCCCAAGGTTCTTGG - Intergenic
1066626782 10:37415262-37415284 CCTCAGTCTCCCAAGGTTCTGGG - Intergenic
1071171789 10:82874930-82874952 CCTTCATGTCATAAGGATCTTGG + Intronic
1072722107 10:97787486-97787508 CCTCCATGTCCTAAAGTGCTGGG + Intergenic
1075951477 10:126481587-126481609 CCTCTGTGTCAGGAGGTTGTTGG + Intronic
1079956004 11:26865267-26865289 CCTCAGTGTCACAAAGTGCTAGG + Intergenic
1083017438 11:59469898-59469920 CCTCGGTGTCCTAAAGTGCTGGG - Intergenic
1083928299 11:65822811-65822833 CCTCGGTGTCCTAAAGTGCTGGG + Intergenic
1086398470 11:86441377-86441399 CCTCCTTGTCCTTAGGCTCTGGG + Exonic
1087210894 11:95445924-95445946 CCCCAGTGTCATAGGATTCTTGG + Intergenic
1088488286 11:110362338-110362360 CCTCGGTGTCCCAAAGTTCTGGG + Intergenic
1089094833 11:115911098-115911120 CCTCCGTGTCCCAAAGTTCTGGG + Intergenic
1089811176 11:121132980-121133002 CCTTGGTGTCCTAAGGTGCTGGG + Intronic
1090179141 11:124678815-124678837 CCTCCGCCTCCTAAAGTTCTGGG + Intronic
1091145986 11:133280938-133280960 CCTCATTGTCCTAACGTTCTTGG + Intronic
1095041062 12:37441324-37441346 CCTCAGTGTCCTAAAGTGCTAGG - Intergenic
1095207351 12:39453819-39453841 CCTCCGTCTCCTAAAGTCCTGGG + Intergenic
1096668566 12:53183771-53183793 CCTCAGTCTCCTAAGGTCCTGGG - Intronic
1096707624 12:53432295-53432317 CCTCAGTGTCCCAAAGTTCTGGG + Intergenic
1099197303 12:79632617-79632639 CCTCAGTCTCACAAAGTTCTGGG + Intronic
1100288493 12:93190551-93190573 CCTCCCTGTCATAAGGGTCATGG - Intergenic
1100546312 12:95605895-95605917 CCTCGGTCTCCTAAAGTTCTGGG + Intergenic
1101145682 12:101838468-101838490 CCTTGGTGTCCCAAGGTTCTGGG - Intergenic
1101364766 12:104061724-104061746 CCTTGGTCTCCTAAGGTTCTGGG - Intronic
1102216487 12:111165135-111165157 CCTCTGTGTCGTAAGGGACTAGG + Intronic
1104863449 12:131938191-131938213 CCTCAGTCTCATAAAGTGCTGGG - Intronic
1106450859 13:29880638-29880660 CCTCCCTGTCCTGAGTTTCTGGG - Intergenic
1114070927 14:19106091-19106113 CCTCCGTCTCCTAAAGTACTGGG - Intergenic
1114091334 14:19293914-19293936 CCTCCGTCTCCTAAAGTACTGGG + Intergenic
1116178201 14:41500625-41500647 CCTCAATGTCATAATGGTCTTGG + Intergenic
1116518126 14:45823180-45823202 CCTCCCTGTGATAATGTTCCTGG + Intergenic
1117522106 14:56561186-56561208 CCTCAGTGTCCCAAAGTTCTGGG - Intronic
1118742391 14:68748988-68749010 CCTCCATGGCATAAGCTTCCTGG - Intergenic
1119724272 14:76912778-76912800 CCTCGGTCTCCTAAGGTGCTGGG - Intergenic
1122397016 14:101441138-101441160 CCTCTGAGTCAGAAGGTCCTGGG - Intergenic
1125959761 15:43819781-43819803 CCTCAGTATCATAAAGTGCTGGG + Intronic
1126157532 15:45579223-45579245 CCTCCGTCTCCTAAAGTTCTGGG + Intergenic
1127216337 15:56826276-56826298 TCTCTGTGTCATCAAGTTCTAGG - Intronic
1127591680 15:60431381-60431403 CCTCCCTTTTATAAGGTTCCTGG - Intronic
1132223159 15:100119936-100119958 CCTCCATTTCATAAGGTTAGTGG - Intronic
1132824902 16:1899538-1899560 CCTCGGTCTCATAAAGTGCTGGG - Intergenic
1133943721 16:10331325-10331347 CCTCAGTCTCCTAAAGTTCTGGG - Intronic
1135238009 16:20776488-20776510 CATCCCTGTCTTAAGGGTCTGGG + Intronic
1135975057 16:27103269-27103291 CTCCCATGTCATATGGTTCTGGG - Intergenic
1136357314 16:29753497-29753519 CCTCGGTGTCCTGAAGTTCTGGG + Intergenic
1141379922 16:83567005-83567027 CCTGTGTGTCATACAGTTCTAGG + Intronic
1142015369 16:87743343-87743365 CCTCCGTTTCCTAAAGTGCTGGG + Intronic
1143716593 17:8775873-8775895 CCTCAGTCTCACAAAGTTCTGGG + Intergenic
1144879043 17:18421516-18421538 CCTCCTTTCCAGAAGGTTCTAGG + Intergenic
1145153194 17:20522878-20522900 CCTCCTTTCCAGAAGGTTCTAGG - Intergenic
1146174884 17:30659561-30659583 CCTCCGTCTCTTAAAGTGCTGGG - Intergenic
1146348340 17:32075585-32075607 CCTCCGTCTCTTAAAGTGCTGGG - Intergenic
1146384396 17:32356929-32356951 CCTCAGTGTCCTAAAGTGCTGGG - Intronic
1148003283 17:44403467-44403489 CCTCTGTGTCACAAAGTGCTGGG + Intronic
1148654699 17:49274538-49274560 CCTCCGTCTCCTAAAGTGCTGGG + Intergenic
1149688420 17:58552890-58552912 CCTCCGTTTCCCAAGGTGCTGGG - Intergenic
1151715117 17:75827390-75827412 CCTCAGAGCCAGAAGGTTCTTGG + Exonic
1152309355 17:79540180-79540202 ACTCCGAGTCAGAATGTTCTTGG - Intergenic
1152367940 17:79867831-79867853 TCTCTGTGTCATAAGATTATAGG - Intergenic
1153905194 18:9654853-9654875 CCTGCATGTCATTGGGTTCTGGG - Intergenic
1156033142 18:32736608-32736630 TCTCCATGTGATATGGTTCTTGG + Intronic
1156185921 18:34663267-34663289 CCTCAGTCTCCTAAGTTTCTGGG + Intronic
1156798118 18:41073622-41073644 CCTCAGCCTCCTAAGGTTCTGGG + Intergenic
1163200525 19:15764926-15764948 CCTCGGTGTCCTAAAGTGCTGGG - Intergenic
1167747327 19:51359767-51359789 CCTCAGTCTCCTAAGGTGCTGGG - Intronic
1167933511 19:52887835-52887857 CCTCAGTCTCCCAAGGTTCTGGG + Intronic
925178450 2:1800852-1800874 CCACGGTGTGATGAGGTTCTCGG - Intronic
928556189 2:32427534-32427556 CCTCCGTCTCCCAAGGTGCTGGG + Intronic
934668741 2:96193437-96193459 TCTCCTTGTAATAAGATTCTTGG - Intronic
935861753 2:107338722-107338744 CCTCAGTGACAAAAGGATCTTGG - Intergenic
937147759 2:119661940-119661962 CCTCGGTCTCCTAAGGTGCTGGG - Intronic
937787843 2:125923239-125923261 CCTCCATTTCATGAGGGTCTGGG + Intergenic
937812255 2:126212286-126212308 CCTCCCTGTGATTAGGTTATGGG - Intergenic
938917183 2:135954005-135954027 CCTCAGTGTCCTAAAGTGCTGGG + Intronic
939877821 2:147597881-147597903 CCTCCGTCTCAGAACCTTCTGGG - Intergenic
941893971 2:170611192-170611214 TCTCCGCTTCATAAGGATCTAGG - Intronic
942605382 2:177684988-177685010 CCTCCTTGTCATATGTTCCTGGG + Intronic
943713464 2:191124204-191124226 CCTCCGCGTCCCAAGGTGCTGGG - Intronic
944108314 2:196103363-196103385 CCTCCTTTTTATAAGGATCTTGG - Intergenic
945058040 2:205885180-205885202 CCTAATTGTCATCAGGTTCTTGG - Intergenic
945143066 2:206707825-206707847 CCACAGTGTCATAACTTTCTTGG - Intronic
948887495 2:240891505-240891527 CCTCCTGGTCACAAGGTTCTTGG - Intronic
1171535652 20:25886236-25886258 CCTCGGTGTCCTAAAGTGCTGGG - Intergenic
1171572208 20:26263670-26263692 CCTCGGTGTCCTAAAGTGCTGGG + Intergenic
1171805434 20:29674944-29674966 CCTCGGTGTCCTAAAGTGCTGGG + Intergenic
1173524400 20:43720976-43720998 CCTCTGTGTCATACTGTTATGGG + Intergenic
1173978687 20:47206548-47206570 CCTCGGTGTCCTAAAGTGCTGGG - Intergenic
1177377193 21:20286278-20286300 CCTCAGTCTCCTAAAGTTCTGGG + Intergenic
1180489393 22:15828557-15828579 CCTCCGTCTCCTAAAGTACTGGG - Intergenic
1180585715 22:16887539-16887561 CCTCAGTCTCCTAAGGTGCTAGG - Intergenic
949953058 3:9245378-9245400 CCTCAGTGTCATTGGGTGCTTGG - Intronic
950369358 3:12515329-12515351 CCTCCCTGTCATAAGCTTTGAGG - Intronic
952938217 3:38417939-38417961 CCTCGGTTTCCTAAAGTTCTAGG - Intronic
954737452 3:52718042-52718064 CCTCAGTCTCCCAAGGTTCTGGG + Intronic
956424884 3:69123716-69123738 CCTCGGTGTCCCAAAGTTCTGGG + Intergenic
957180942 3:76876422-76876444 CCTCAGCCTCATAAAGTTCTGGG - Intronic
963264802 3:143229279-143229301 CCTCCGTCTCACAAAGTGCTGGG - Intergenic
964512349 3:157466668-157466690 CTTCCGTGTCATTTGGATCTTGG - Intronic
966430125 3:179823037-179823059 CATCCGTGGCATAAAGTTCATGG + Intronic
967721039 3:192816898-192816920 CATCTTTCTCATAAGGTTCTTGG + Intronic
974002391 4:56524721-56524743 CCTCGGTCTCATAAAGTCCTGGG + Intergenic
974053471 4:56962608-56962630 CCTCGGTCTCCTAAAGTTCTGGG - Intergenic
975257444 4:72254758-72254780 CCTCCGTCTCCTAAAGTGCTGGG + Intergenic
976510513 4:85903459-85903481 CATCAGTGTCATTAGATTCTGGG - Intronic
984813135 4:183813014-183813036 CCTCCGTGTCTGTGGGTTCTGGG + Intergenic
985846109 5:2349342-2349364 CCTCAGTGTCACAAAGTGCTGGG + Intergenic
986204596 5:5611437-5611459 GCTGCGTGGCATAAAGTTCTGGG + Intergenic
987950933 5:24674590-24674612 CCTCGGTGTCCCAAGGTGCTGGG + Intergenic
989476241 5:41876820-41876842 GCTCCCTGTCAGAAGGTGCTTGG - Intergenic
992410790 5:76503423-76503445 CCTCAGTGTCCTAAAGTGCTGGG + Intronic
994640587 5:102404243-102404265 CCTCAGTGTCCTAAAGTGCTGGG - Intronic
998238627 5:140422373-140422395 CCTCTGTGTCCCAAGGTGCTGGG + Intronic
1001772184 5:174304922-174304944 CCTCCATGGCATAGGGTCCTGGG - Intergenic
1002721602 5:181264772-181264794 CCTCCGTCTCCTAAAGTGCTGGG - Intergenic
1007323031 6:41040830-41040852 CCTCTGAGTCATAAAGTCCTAGG + Intronic
1008674040 6:53800500-53800522 CCTCCGTCTCCTAAAGTTCTGGG + Intronic
1011546562 6:88487754-88487776 CCTCAGTGTCCCAAAGTTCTGGG - Intergenic
1014303764 6:119715087-119715109 CCTCCATCTCAGAAGGCTCTGGG + Intergenic
1017500975 6:155022548-155022570 CCTCAGCCTCATAAGGTACTGGG + Intronic
1025167058 7:56721755-56721777 CCTCAGTCTCCTAAGGTGCTGGG + Intergenic
1025222079 7:57120299-57120321 CCTATGTCTCATAAGGTTCGAGG + Exonic
1025287116 7:57672953-57672975 CCTCGGTGTCCTAAAGTGCTGGG - Intergenic
1025625915 7:63221521-63221543 CCTCCGTGTCCCAAAGTGCTGGG - Intergenic
1025656200 7:63521614-63521636 CCTCCGTGTCCCAAAGTTCTGGG + Intergenic
1028231932 7:88316206-88316228 CCTCCGTGTCCCAAAGTGCTAGG - Intergenic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1036690348 8:10941106-10941128 TCTCCGTGTCATAAGGCAGTGGG - Intronic
1037514610 8:19618279-19618301 CCTCTGTGTCATAATTTTCAGGG - Intronic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1038413402 8:27375614-27375636 CCTCCTGGTCATAAGCTACTAGG + Intronic
1039956427 8:42210471-42210493 CATCCTTGTCATAAGTTTCTTGG - Intergenic
1046267699 8:111852475-111852497 CCTCAGCCTCATAAAGTTCTAGG + Intergenic
1048274004 8:133052160-133052182 CCTCCGAGTCATAAGCCTCTTGG + Intronic
1053165895 9:35843405-35843427 CCTCAGTGTCTTAGGGGTCTTGG + Intronic
1059142773 9:111869871-111869893 CCTCAGTGTCCCAAAGTTCTGGG + Intergenic
1059869721 9:118559013-118559035 TCTCCTTATCATAAGCTTCTTGG + Intergenic
1059967773 9:119632843-119632865 CCTCAGTATCCTAAAGTTCTGGG - Intergenic
1061784877 9:133021633-133021655 CCTCCGTCTCCCAAAGTTCTGGG - Intergenic
1062423863 9:136497199-136497221 CCTCCGTGCCTTGAGGTCCTTGG + Exonic
1062441945 9:136574208-136574230 CCTCGGTCTCTTAAAGTTCTGGG + Intergenic
1062646964 9:137552676-137552698 CTTCCGAGTCCGAAGGTTCTGGG + Intergenic
1188369946 X:29357713-29357735 CCTCCGTGTCATAAGGTTCTTGG + Intronic
1189004543 X:36982368-36982390 CCTCAGTCTCCTAAAGTTCTGGG - Intergenic
1191715564 X:64191510-64191532 CCTCCCTGGCATGAGCTTCTCGG + Exonic
1192100691 X:68261323-68261345 CCTCCCTGTCATAAGGCTAGAGG + Intronic
1193180897 X:78455329-78455351 CTTCCCTGTCATAAGGTTGTTGG - Intergenic