ID: 1188372532

View in Genome Browser
Species Human (GRCh38)
Location X:29386409-29386431
Sequence ATTGAGAGGCAAACTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 271}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188372532 Original CRISPR ATTGAGAGGCAAACTGGGGA AGG (reversed) Intronic
902551954 1:17224462-17224484 GTTGAAAGGCAAACTTGGGGTGG + Intronic
902726299 1:18338459-18338481 ATTGACCTCCAAACTGGGGAGGG - Intronic
903613694 1:24636303-24636325 GTAGAAAGGCAAAGTGGGGAGGG + Intronic
905337916 1:37258082-37258104 ATTGGCAGGCAGACTGAGGAAGG + Intergenic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
907281034 1:53347129-53347151 AGGGAGAAGCAAACTGGGGGAGG + Intergenic
907509489 1:54947580-54947602 ATTGAGATGCAGAGAGGGGAAGG + Intergenic
909076802 1:71058799-71058821 AGGGAGAGGGATACTGGGGAAGG + Intergenic
909679835 1:78279262-78279284 ATTCAGAGGGAAACTTTGGATGG + Intergenic
910027751 1:82678580-82678602 TCTATGAGGCAAACTGGGGAAGG - Intergenic
910236013 1:85037323-85037345 AATGGGAGGTAAACTGGGAAAGG + Intronic
912932137 1:113973404-113973426 ATTGGGTGGCAAACTGGTGTTGG - Exonic
912986238 1:114435031-114435053 ATCCAGAGGCAAACTGTGAAGGG + Intronic
915365266 1:155311595-155311617 ATGGGGAAGGAAACTGGGGAGGG + Intronic
916211521 1:162363783-162363805 ATTGAGAGAAGATCTGGGGAGGG - Intronic
916336829 1:163681774-163681796 AGAGAGTGGCAAAATGGGGATGG - Intergenic
917664242 1:177208350-177208372 GTTGAGAGGCAAATTTGGGAAGG + Intronic
918283582 1:183029615-183029637 AGAGAGAGAGAAACTGGGGAAGG - Intronic
919169580 1:193937292-193937314 ATAGAAAGGGAAAGTGGGGATGG - Intergenic
920113719 1:203604788-203604810 AAAGAGAGACAAGCTGGGGAAGG + Intergenic
920657674 1:207888493-207888515 ATTATGTAGCAAACTGGGGAGGG - Intronic
923713443 1:236405166-236405188 AGTGAGAGGGGAACTGGGAAAGG - Intronic
924606324 1:245538614-245538636 ATGGAGAGACAGACAGGGGAAGG - Intronic
1069107224 10:64397729-64397751 ATTAAGAGGCAAAACGGGGCCGG - Intergenic
1069944869 10:71978899-71978921 ATGGGGAGGCATCCTGGGGAGGG - Intronic
1071562878 10:86657017-86657039 ATGGAGAGGGACACTGGGGGTGG - Intronic
1071745198 10:88410594-88410616 ATTGAGATGAAAACCAGGGAAGG - Intronic
1071745353 10:88412496-88412518 ATTGAGATGAAAACCAGGGAAGG + Intronic
1072921505 10:99580949-99580971 CTAGAGAGGCACTCTGGGGAGGG + Intergenic
1073756093 10:106582199-106582221 ATCGAAAGACAACCTGGGGATGG - Intronic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075391205 10:122093689-122093711 ATAGAGAGAGAAACTGAGGATGG - Intronic
1075572720 10:123557401-123557423 ATTGAGAGGTGAAGTAGGGAGGG + Intergenic
1077786404 11:5389199-5389221 ATACAGAGGAAAACTGGTGAGGG + Intronic
1078563815 11:12396401-12396423 ATTGTGAGGCAAGCCTGGGAAGG + Intronic
1080424526 11:32143901-32143923 GCTGAGAGGGAAACTGGAGAAGG + Intergenic
1080716077 11:34801317-34801339 TTTGGGAAGCAACCTGGGGAAGG - Intergenic
1080866581 11:36200606-36200628 ATGGAGAGGCAACATGGTGATGG + Intronic
1081168529 11:39837304-39837326 CTAGAGAGGGAAACTTGGGATGG + Intergenic
1081567395 11:44268515-44268537 ATTGGGAGCCCAACGGGGGAGGG + Intronic
1081608206 11:44540791-44540813 TTTGGGAGGTGAACTGGGGAGGG + Intergenic
1082091228 11:48091212-48091234 ATTGAGATGCAAACATAGGAAGG - Intronic
1082694609 11:56346170-56346192 AGTGATAGGCAATCTGGGCATGG + Exonic
1083277029 11:61602734-61602756 ATTGATAGGCAGCCTGGGGCTGG + Intergenic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1084695502 11:70752190-70752212 ATTGGGAGGCCAAGGGGGGAGGG - Intronic
1085024837 11:73230325-73230347 ACTGAGAGCCAAGCAGGGGAAGG - Intronic
1085273660 11:75284606-75284628 ATAGAGAGGCAAAATGGGCCGGG + Intronic
1085307425 11:75495906-75495928 TGTAAAAGGCAAACTGGGGAAGG - Intronic
1086276882 11:85140707-85140729 ATGGAGGGGAAAAGTGGGGATGG - Intronic
1086581689 11:88407440-88407462 ATTGACAGCCAAACTGGTGAAGG - Intergenic
1087600709 11:100311449-100311471 GTTAAGAGGAAGACTGGGGATGG + Intronic
1088553021 11:111033794-111033816 TTGGAGACGCAAAATGGGGAGGG + Intergenic
1089437319 11:118481221-118481243 GTTGAGGGGGAAAGTGGGGATGG - Intronic
1089943009 11:122439411-122439433 CTTGAGAGTCACACTGTGGAAGG - Intergenic
1090490267 11:127154574-127154596 ATTCAGGGGCAGACTGTGGAAGG - Intergenic
1093196620 12:16137136-16137158 ATTGAGAGCGAAAGCGGGGAGGG + Intergenic
1093342834 12:17998965-17998987 ATGGATAGGCAAACTGGTGAAGG + Intergenic
1093691981 12:22119276-22119298 ATTCAGGGGCACACAGGGGAAGG - Intronic
1094179044 12:27571433-27571455 AATGAGAGGGAAAATGGGGGAGG + Intronic
1096497082 12:52044821-52044843 ACTGAGAGGGAAACTGAGGGAGG + Intronic
1097327085 12:58289104-58289126 CGGGAGAGGCAGACTGGGGAGGG + Intergenic
1101239656 12:102825092-102825114 ATTCTGAGGCAAACTGGGGATGG + Intergenic
1101542512 12:105677628-105677650 ATAGAGAGGCAAAATGGCAAGGG + Intergenic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1103050951 12:117779042-117779064 ATTGGGAGGGAAACCGGGGCAGG - Intronic
1104650245 12:130525993-130526015 AATAAGAGGCAAATTGGGGCAGG - Intronic
1105625303 13:22106827-22106849 ATTAAGAGGAAAACAGGGTAGGG - Intergenic
1106523855 13:30522512-30522534 AATTAGAGGTAAACTGGGGAGGG + Intronic
1106535967 13:30643345-30643367 ATAAAGAGGTAACCTGGGGATGG - Intronic
1107320931 13:39187579-39187601 ATTTAGAAGCAAAATAGGGAAGG - Intergenic
1107877880 13:44806634-44806656 ATTGAGACGCAAAGAGGTGAAGG - Intergenic
1108077364 13:46695195-46695217 ATGGAGAGGCACACAGGGCAGGG - Intronic
1108136640 13:47370258-47370280 ACTGAAAGGAAAAATGGGGAGGG + Intergenic
1109734201 13:66459935-66459957 ATTGAGCTGTAAACTGGGGGTGG - Intronic
1113174974 13:107553832-107553854 CCTGAGAGGCAAAGTAGGGATGG - Intronic
1115022169 14:28695577-28695599 ATTGAGAGCCAAACTAGGGAAGG - Intergenic
1115601262 14:34957767-34957789 ATTGGGAGTTAAACTGGGCAGGG + Intergenic
1116759569 14:48994644-48994666 ATTCAGAGAAAAACTGGGGAAGG - Intergenic
1119112576 14:71988795-71988817 ATGGAGGGTCTAACTGGGGAGGG + Intronic
1119193121 14:72697764-72697786 ATGGAGAGGAAAAATGGGGTGGG + Intronic
1121037041 14:90714882-90714904 ATAGAGATGAAAATTGGGGAGGG - Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121206419 14:92172333-92172355 ATTGAGAGGAGAAATGGGTACGG + Intergenic
1121642629 14:95495929-95495951 CTTGAGAGGCCCACTGGGGAAGG - Intergenic
1121878206 14:97474394-97474416 ATTAACAGGCAATCTGGTGAGGG - Intergenic
1121999399 14:98634469-98634491 ATTCACTGGCAACCTGGGGATGG + Intergenic
1123587885 15:21775137-21775159 TTTGGGAGGCCAAATGGGGAGGG - Intergenic
1123587920 15:21775303-21775325 TTTGGGAGGCCAAGTGGGGAGGG + Intergenic
1123624523 15:22217702-22217724 TTTGGGAGGCCAAATGGGGAGGG - Intergenic
1123624558 15:22217868-22217890 TTTGGGAGGCCAAGTGGGGAGGG + Intergenic
1124035027 15:26046756-26046778 ATTGATAGGAACACTGAGGATGG - Intergenic
1124725411 15:32152199-32152221 TTTGAGAGGCTAAGTGGGGGTGG + Intronic
1125450959 15:39806784-39806806 ATTGAGAGAAGACCTGGGGATGG - Intronic
1125943769 15:43696836-43696858 GTTCAGAGGGAGACTGGGGAAGG + Intronic
1126475838 15:49064104-49064126 AGAGAGTGGCAAAATGGGGAAGG - Intergenic
1128545041 15:68561099-68561121 ATTGAGAGGCAAAGTTGTGCTGG - Intergenic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1130883598 15:88075347-88075369 ATTGACAGTCATACTGGTGAAGG - Intronic
1132300547 15:100772962-100772984 CTTGAGAGGGAAGGTGGGGAGGG - Intergenic
1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG + Intergenic
1136296499 16:29307041-29307063 AGTGAGAGGCAGACTGGGAATGG - Intergenic
1138000647 16:53275599-53275621 ATGGAGAAGAAAACTGGGAAAGG - Intronic
1141022051 16:80506657-80506679 ATGAAGAGGCAAACAGGAGATGG - Intergenic
1141597941 16:85108574-85108596 ATTGAGAGTCACAGTGGGGCCGG + Intronic
1142058080 16:88013160-88013182 AGTGAGAGGCAGACTGGGAATGG - Intronic
1142312576 16:89322660-89322682 CTTGAGGGGGACACTGGGGAGGG + Intronic
1143675563 17:8430027-8430049 CGTGAGATGCAAGCTGGGGAGGG + Intronic
1143693698 17:8593700-8593722 ATAGAGAGACAAACTGTTGATGG + Intronic
1143906636 17:10214382-10214404 AATTAGGGGTAAACTGGGGATGG + Intergenic
1144005251 17:11093930-11093952 ATTGGCAGGAAAGCTGGGGATGG - Intergenic
1144599809 17:16601540-16601562 ATTTAGAGGCAACTAGGGGAAGG + Intergenic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146627655 17:34446479-34446501 AATGGGAGCCAAACAGGGGAAGG - Intergenic
1147398221 17:40161885-40161907 GGAGAGAGGCAAAGTGGGGACGG + Exonic
1148489058 17:48011773-48011795 CCAGAGGGGCAAACTGGGGAGGG + Intergenic
1149147470 17:53513290-53513312 AAAAATAGGCAAACTGGGGAAGG - Intergenic
1150178127 17:63083652-63083674 ATTATCAGGCAGACTGGGGAAGG - Intronic
1150178547 17:63089431-63089453 ATTGAGGGGGAAAGTGGGAAGGG + Intronic
1150221984 17:63500943-63500965 AGGGAGAGGCAACATGGGGAGGG - Intronic
1152907767 17:82978259-82978281 ATTAGGAAGCAAACTGAGGAAGG - Intronic
1153942215 18:9988211-9988233 GGTGAGAGGCAAACTGGCCATGG - Intergenic
1153943021 18:9993534-9993556 AGTGAGAAGGAAACGGGGGAAGG - Intergenic
1155182264 18:23358179-23358201 ACTGAGAAGGAAACTGGGAAAGG - Intronic
1155712280 18:28897568-28897590 TTTGGGAGGCCAACGGGGGACGG + Intergenic
1156100997 18:33594634-33594656 AATGAGGAGTAAACTGGGGAGGG + Intronic
1158050572 18:53212960-53212982 ATTGAAAGGCAGGCTGGGCATGG - Intronic
1158236413 18:55321068-55321090 ATTTAAAGCCAAAATGGGGAAGG - Intronic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159676431 18:71288839-71288861 ATTGAGACGCAACCAGGGAAAGG - Intergenic
1162018446 19:7857917-7857939 ACTGAGAGCCAGAGTGGGGAAGG + Intronic
1163738350 19:18995529-18995551 ACTGTGAGGAAAACTGGGTAAGG + Intronic
1163846621 19:19641888-19641910 ATTCAGAAGCAAACAGGGCAGGG + Intronic
1164323484 19:24171448-24171470 GTTGGGAGGCAAACTGAGGCAGG - Intergenic
1164560301 19:29287386-29287408 GTTGAGAGGCAATCCGAGGATGG - Intergenic
1164878854 19:31713983-31714005 ATTGAGAGACAACCTGAGGGTGG - Intergenic
1164906987 19:31975689-31975711 TTTGAGAGGCCAAGGGGGGAGGG + Intergenic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
924970799 2:126228-126250 CATGAGAGGGAAACTGTGGAAGG - Intergenic
924979335 2:206969-206991 AAAGAGAGGGAAACTGGGGTGGG + Intergenic
925888396 2:8412957-8412979 CTTGAGAGGCAGGCTGGAGAAGG + Intergenic
926613342 2:14969855-14969877 ATGGGAAGTCAAACTGGGGAAGG + Intergenic
928213140 2:29338880-29338902 ATTGAAATGGAGACTGGGGAAGG - Intronic
928620513 2:33083510-33083532 AATGGGAGGCAAACAGGAGAGGG + Intronic
930243861 2:48963499-48963521 ATTGACTGGCAAACTGGGGCAGG - Exonic
931131070 2:59336630-59336652 ACGGAGAGGTAAGCTGGGGAAGG + Intergenic
932518109 2:72374557-72374579 GTTGAGAGGGAAGGTGGGGATGG + Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
934118037 2:88814098-88814120 AGAGAGAGGAAAACTGGGGTGGG + Intergenic
934616763 2:95776165-95776187 ATGGAGAGACAAAATGGGAATGG - Intergenic
934644127 2:96048395-96048417 ATGGAGAGACAAAATGGGAATGG + Intergenic
934914398 2:98288703-98288725 ATTGGGAGACAAAGAGGGGAGGG - Intronic
936081191 2:109433847-109433869 CTTGAGAAGCAAACTGCAGAGGG + Intronic
936618587 2:114072839-114072861 TTTGAGAGGCAAAATGGAGAAGG - Intergenic
936671707 2:114663959-114663981 CTAGAGAGACAATCTGGGGAAGG + Intronic
939516404 2:143173969-143173991 TCTGAGGGGCAAATTGGGGAGGG - Intronic
941017226 2:160371296-160371318 TTTGAGAGGCAAAATGTAGAAGG - Intronic
941870590 2:170381011-170381033 GTTGAGAGGCTGAGTGGGGAGGG + Intronic
942177409 2:173347269-173347291 AGTGACAGGGAAACTGTGGATGG + Intergenic
942593663 2:177571861-177571883 ATGGAGAGGTAAACTGAGGTTGG + Intergenic
943332260 2:186573523-186573545 ATTAAGAGGAAAAATGAGGAAGG + Intergenic
943529762 2:189064819-189064841 ATTAAGAGGCATAGGGGGGAAGG - Intronic
944996397 2:205299631-205299653 ATTGAGAGACTAGCTGGGGGTGG + Intronic
946220729 2:218223908-218223930 ATTGAGAAGCAATCTTGTGATGG + Intronic
948861183 2:240753279-240753301 ATAGAGAGGTAAACTGAGGCAGG + Intronic
1169442617 20:5645284-5645306 ATTGAAAGGCTAACTGAGCATGG + Intergenic
1173000859 20:39104648-39104670 ATCGAGATGGAAAATGGGGAAGG + Intergenic
1173865489 20:46309743-46309765 ATGGAGATGGAAATTGGGGAAGG - Intergenic
1175391185 20:58628455-58628477 AGTGGGAGGCAAGCGGGGGAGGG - Intergenic
1178396852 21:32250476-32250498 ACTGAGAAACAACCTGGGGATGG - Intergenic
1179236982 21:39556303-39556325 GTGAAGAGGCAAACTGTGGAGGG + Intergenic
1180362793 22:11914473-11914495 ATTGAGTGTCACACTGGGGGTGG - Intergenic
1181826535 22:25520771-25520793 ATAGAAAGGCAGACTGGAGAAGG + Intergenic
1183256967 22:36768727-36768749 CATGAGAGGGAAAATGGGGAGGG - Intronic
1183676103 22:39299645-39299667 CTGGGGAGGCAAGCTGGGGAGGG - Intergenic
949523069 3:4874267-4874289 ATTTGGATTCAAACTGGGGAGGG + Intronic
949523800 3:4883010-4883032 TTTGAGAGGCCAACCGGGGGAGG + Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
952247781 3:31614408-31614430 ATGGACAAGGAAACTGGGGAGGG - Intronic
953021617 3:39118011-39118033 ATTGATAGGCAAAGCTGGGATGG - Intronic
955019541 3:55105979-55106001 ATGGAGAGTCAGCCTGGGGAGGG + Intergenic
956278430 3:67529001-67529023 ATTGAAAGGCACACTGAGGTTGG - Intronic
957178697 3:76848277-76848299 ATTCAGTGGCATACTGGCGAAGG + Intronic
957225496 3:77439747-77439769 AATGAGAGGAAAATTGGGGAGGG - Intronic
958758094 3:98274425-98274447 ATTCATAGGCAGACAGGGGAAGG + Intergenic
959475348 3:106804596-106804618 ATTGAGAGGGAAAAAGGAGAGGG - Intergenic
960932613 3:122869224-122869246 TTAGAGAGGAAAACTGGGGGGGG - Intronic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961140563 3:124552352-124552374 ATTGTTAGGTAATCTGGGGACGG - Intronic
961866679 3:129958557-129958579 AGTGGGAGTCAAGCTGGGGAAGG + Intergenic
962273776 3:133997153-133997175 GGTGAGAGGCACTCTGGGGAGGG - Intronic
963493698 3:146033555-146033577 ATTGAGATGAAAACTGGGGGAGG + Intergenic
963569566 3:146975788-146975810 AATGAGAGACACACTGGGAAAGG + Intergenic
965811869 3:172599780-172599802 TTTGAGAGGCCAAGTGGGGGTGG - Intergenic
966051068 3:175618345-175618367 CTTGAGAGACAACCTGGGTAGGG + Intronic
966611169 3:181869245-181869267 AGTGAGGGGCAAACTTAGGATGG + Intergenic
967466876 3:189816913-189816935 ATTGTGAGGTAAATTAGGGAGGG + Intronic
967947579 3:194816313-194816335 AATGTGAGGAAAACTGGGTAGGG + Intergenic
970996367 4:22271785-22271807 ATTAAGAAACAAAGTGGGGAGGG + Intergenic
976526041 4:86090097-86090119 AGGGAGGGGCAAAATGGGGAAGG + Intronic
978849191 4:113312665-113312687 ATGGTGAGGAAAAGTGGGGAGGG + Intronic
980029564 4:127811550-127811572 ATTGAGAAGCAAAATTTGGAAGG + Exonic
982596962 4:157398114-157398136 ATTGATAGGTAAACTTGGGAAGG + Intergenic
982643988 4:157999015-157999037 ATTGAGAGGCAGACAGGGGGAGG + Intergenic
982741318 4:159060263-159060285 ATTCAGAGGCCTAGTGGGGAGGG + Intergenic
983335997 4:166393238-166393260 ATGGAGAGGAAAAATGGGGTTGG - Intergenic
983413074 4:167423037-167423059 ACTGAAAGGCAGACTGGAGAGGG + Intergenic
987246457 5:16054093-16054115 ACTGAGAGCCAAGATGGGGATGG + Intergenic
987937451 5:24484927-24484949 ATTGAGAGGCTAAGGTGGGAGGG + Intergenic
989653135 5:43715774-43715796 AATAAGAGGAAAACTAGGGAAGG - Intergenic
989685042 5:44075377-44075399 GTGGTGAGGCAAACTGGGGTGGG + Intergenic
990568292 5:57052249-57052271 ATGGAGAGCCACACTGGGGGAGG - Intergenic
992827697 5:80567302-80567324 AATGAAAGGAAAACTGGGGGTGG - Intronic
992860459 5:80904109-80904131 AATAACAGGCAGACTGGGGAGGG + Intergenic
994145785 5:96393474-96393496 CTTGAGAGGCAATGAGGGGAGGG + Intronic
997466015 5:134088527-134088549 AGAAGGAGGCAAACTGGGGAAGG + Intergenic
997526484 5:134556171-134556193 CTTGAGAGGCATCCTGGGGTCGG - Intronic
998166111 5:139845016-139845038 TTTGAGAGGCAGAGTGGAGAAGG + Intergenic
998809356 5:145950526-145950548 ATAGAGAGGGAAACAGGAGAAGG + Intronic
999136049 5:149319920-149319942 AGTCAGAGGCAAGCTGTGGATGG + Intronic
999286046 5:150394992-150395014 ATGGAGAGGGAAGCTGGGGAGGG - Intronic
1000455336 5:161441960-161441982 AATGGGAGGCTAACTGGGGTGGG + Intronic
1000497073 5:161997604-161997626 GTTTAGAGGGAAAGTGGGGATGG + Intergenic
1000507968 5:162145509-162145531 AGTGAGAGGCAGAGTAGGGATGG - Intronic
1001027549 5:168236829-168236851 ATTCATAGGCAAACGTGGGAGGG - Intronic
1001299518 5:170523813-170523835 ACTGAGAGGCAGACTGGGGTAGG - Intronic
1003765793 6:9234958-9234980 ATTGGGAGGCAAAAGAGGGAGGG + Intergenic
1003959320 6:11194446-11194468 ATGAAGAGGCATACTGAGGAAGG - Intronic
1004504672 6:16238471-16238493 GTTGAGAGGCAGACTGGTTAGGG - Intergenic
1005228491 6:23671555-23671577 ATTGAGAAGAAAAGTGGGGTTGG - Intergenic
1005662912 6:28018505-28018527 AATGAGAGACAAACAGGAGATGG - Intergenic
1006015629 6:31078563-31078585 ATTGGGAGGCCAACAAGGGAAGG - Intergenic
1006497143 6:34431931-34431953 ACTGAGAGGAGAACTGGGAAGGG + Intergenic
1006761285 6:36463881-36463903 ATTGAGAGGGAAAAAGGGGAAGG + Intronic
1007093142 6:39196832-39196854 GGTGAGAGGCCACCTGGGGATGG + Intronic
1007389376 6:41541457-41541479 AAGGAGAGGCACAGTGGGGAGGG + Intergenic
1008853186 6:56049617-56049639 ATTGAGGGGCAAAAAGGAGAGGG - Intergenic
1010231065 6:73535787-73535809 ATAGAGAGGGAATCTGGGAATGG + Intergenic
1011189014 6:84711470-84711492 TTTGAGAGGCAAAATGGAGGTGG + Intronic
1011195103 6:84773158-84773180 CTTGGGAGGCAAACTTGGGTGGG + Intergenic
1014382869 6:120765584-120765606 TTTGAGAGGTCAAGTGGGGAGGG - Intergenic
1018016259 6:159714987-159715009 ACTGAAAGGCAAACTGGCTATGG - Intronic
1018115490 6:160579626-160579648 CTTGGGAGGCATAATGGGGAAGG - Intronic
1020348428 7:7190636-7190658 CTTGAAAGGGGAACTGGGGAAGG - Intronic
1021428094 7:20526174-20526196 GTTGAGAGGCAAGCTGGGCTTGG + Intergenic
1022673335 7:32476383-32476405 ATTTAAAGGCAGCCTGGGGATGG - Intergenic
1023547039 7:41328911-41328933 ACTGAGAGACTAACTTGGGAGGG + Intergenic
1028449486 7:90965163-90965185 ATGCAGAGACAAAGTGGGGATGG - Intronic
1029321426 7:99764133-99764155 ATTCAGAGGTACACTGGGGGTGG + Intronic
1030539643 7:110814188-110814210 CCAGAGAGGAAAACTGGGGATGG - Intronic
1030918484 7:115348356-115348378 AATGAGAGGTAAAATGGTGAAGG - Intergenic
1031114927 7:117657103-117657125 AATGGGAGGGAAACTTGGGAGGG + Intronic
1031873927 7:127116688-127116710 AGTGAGAGGCAATCTGTGGCTGG - Intronic
1034169140 7:149049359-149049381 TTTGTGAAGCAAACAGGGGATGG - Intergenic
1034978549 7:155461512-155461534 GTTGGGAGGCACAGTGGGGAGGG + Intronic
1035167803 7:157002153-157002175 AGTGAAAGGCAACCTGGGGATGG - Intronic
1035762794 8:2081628-2081650 ATTGAGAAGAGCACTGGGGAAGG + Intronic
1037223462 8:16554342-16554364 AATAAGAGGAAAACTGGGAATGG + Intronic
1038188871 8:25300526-25300548 AATGAGAGGCTAACTGGGGTTGG - Intronic
1039109623 8:34027641-34027663 ATGGAGAGACAGACTGGTGAGGG - Intergenic
1040489438 8:47906103-47906125 TTTGAGAGGCCAAGTCGGGAGGG + Intronic
1044242090 8:89900345-89900367 ATTAAGGGGCAGAGTGGGGATGG + Intergenic
1044337505 8:91004605-91004627 ATTCAGTGGCCCACTGGGGATGG + Intronic
1045951801 8:107860075-107860097 AGTGAAAGGATAACTGGGGAGGG + Intergenic
1046152708 8:110249320-110249342 ATTTAGGGGGAAAGTGGGGAAGG + Intergenic
1046956286 8:120066046-120066068 ATTGTGAGTAAAAATGGGGAAGG - Intronic
1047631012 8:126708577-126708599 ATTGAGAGGGAAGATGGGGAAGG - Intergenic
1048407237 8:134136268-134136290 ATTGAGAGGTACACTGGGCCTGG + Intergenic
1050405774 9:5307131-5307153 ATTGAGGGGCTAAATGGGGTTGG + Intergenic
1050579818 9:7041471-7041493 ATTGAGAAGCAAACTGGAATTGG - Intronic
1052618041 9:30868404-30868426 CTTAAGGGGCAAACTGGAGAGGG - Intergenic
1052820382 9:33133835-33133857 ATTGAGATGCCCACTGGGGTAGG - Intronic
1052977491 9:34421988-34422010 TTTGAGAGGCTGTCTGGGGATGG - Intronic
1054864671 9:69987852-69987874 ATTGATATGCATATTGGGGAGGG - Intergenic
1054916322 9:70498167-70498189 CAAGAAAGGCAAACTGGGGAGGG + Intergenic
1057231109 9:93321929-93321951 TTTGAAAGGCAAACTGCGGCCGG - Intronic
1057741848 9:97718924-97718946 ATTGAGACCCAGACTGGGAAAGG - Intergenic
1057838555 9:98466692-98466714 GATGAGAGACAAACTGGGAAAGG + Intronic
1059612039 9:115908895-115908917 ATGGAGAGGCAGATTGGAGAGGG + Intergenic
1060800879 9:126545340-126545362 GTTGGGGGGCAAAGTGGGGAGGG - Intergenic
1060855247 9:126909841-126909863 ATGGAGAGCCAAACTTGGGAAGG - Intergenic
1061497698 9:130985006-130985028 ACTGAGAGGCAAGCTGATGAGGG + Intergenic
1062218210 9:135400372-135400394 ATTGGGAGGGAAACTGAGGCAGG - Intergenic
1062522990 9:136966466-136966488 AGCGAGAGGGAAACTGGGGGAGG + Intergenic
1185554817 X:1012977-1012999 AGAGAGAGGGATACTGGGGAGGG - Intergenic
1188319461 X:28717709-28717731 ATTGAGATTCGAAGTGGGGAGGG + Intronic
1188344631 X:29048619-29048641 ATAGAGAGGAAAATTAGGGAAGG + Intronic
1188372532 X:29386409-29386431 ATTGAGAGGCAAACTGGGGAAGG - Intronic
1188864076 X:35292908-35292930 ATTGAGAGGCAGATTGTGGTTGG - Intergenic
1189361158 X:40353128-40353150 TTTGGGAGGCTAAGTGGGGAGGG - Intergenic
1189536124 X:41937016-41937038 GTGGAGAGCAAAACTGGGGAAGG - Intergenic
1190842190 X:54155536-54155558 ATTGAAAAGCAAACAGGGGAAGG + Intronic
1193947992 X:87762835-87762857 TTTGGGAGGCCAACTTGGGAGGG + Intergenic
1194989294 X:100528206-100528228 ATTTAGAATCAAAATGGGGAAGG - Intergenic
1199163165 X:144638208-144638230 ATTGAGAGGTAATGTGGAGAAGG + Intergenic
1200211871 X:154350293-154350315 ATGGACCGGCAAAATGGGGAGGG - Intronic
1200792867 Y:7315033-7315055 ATTAAAAGGTAAACTGGGCATGG - Intergenic
1201593641 Y:15641935-15641957 ATTGAGATGGAGAGTGGGGAGGG + Intergenic